RMCP Vol. 15 Num. 1 (2024) : January-March (English Version)

Edición Bilingüe
Bilingual Edition
ISSN: 2448-6698
Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 15 Núm. 1, pp. 1-248, ENERO-MARZO-2024
Rev. Mex. Cienc. Pecu. Vol. 15 Núm. 1, pp. 1-248, ENERO-MARZO-2024

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 15 Numero 1, Enero-Marzo
2024. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada
por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP).
Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad
de México, www.inifap.gob.mx.
Distribuida por el Centro de Investigación Regional Sureste, Calle 6 No. 398 X 13, Avenida
Correa Racho, Col. Díaz Ordaz, Mérida Yucatán, C.P. 97130.
Editor responsable: Arturo García Fraustro Reservas de Derechos al Uso Exclusivo número
04-2022-033116571100-102, ISSN: 2448-6698, otorgados por el Instituto Nacional del
Derecho de Autor (INDAUTOR).
Responsable de la última actualización de este número: Arturo García Fraustro, Campo
Experimental Mocochá, Km. 25 Antigua Carretera Mérida–Motul, Mocochá, Yuc. C.P. 97454.
http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización
en enero de 2024.
Granja avícola de producción de huevo en el
sector Tierra Dura, provincia Espaillat,
República Dominicana
Autor: Joel Alex Tamara DIRECTORIO
FUNDADOR
John A. Pino
EDITOR EN JEFE EDITORES ADJUNTOS
Arturo García Fraustro Oscar L. Rodríguez Rivera
Alfonso Arias Medina
EDITORES POR DISCIPLINA
Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México
Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, Dr. Ricardo Basurto Gutiérrez, INIFAP, México
Dr. Alfonso Juventino Chay Canul, Universidad Autónoma de Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y
Tabasco, México Zootecnia, UNAM, México
Dra. Maria Cristina Schneider, Universidad de Georgetown, Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina
Estados Unidos Veterinaria y Zootecnia, Universidad Veracruzana, México
Dr. Feliciano Milian Suazo, Universidad Autónoma de Dr. Carlos López Coello, Facultad de Medicina Veterinaria y
Querétaro, México Zootecnia, UNAM, México
Dr. Javier F. Enríquez Quiroz, INIFAP, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de
Dra. Martha Hortencia Martín Rivera, Universidad de Sonora Química. UADY
URN, México Dra. Guillermina Ávila Ramírez, UNAM, México
Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora Dr. Emmanuel Camuus, CIRAD, Francia.
URN, México Dr. Héctor Jiménez Severiano, INIFAP., México
Dr. James A. Pfister, USDA, Estados Unidos Dr. Juan Hebert Hernández Medrano, UNAM, México
Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma
Dr. Sergio Iván Román-Ponce, INIFAP, México Metropolitana-Xochimilco, México
Dr. Jesús Fernández Martín, INIA, España Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID
Dr. Maurcio A. Elzo, Universidad de Florida Salud Animal e Inocuidad, México
Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dr. José Juan Hernández Ledezma, Consultor privado
Dra. Nydia Edith Reyes Rodríguez, Universidad Autónoma del Dr. Fernando Cervantes Escoto, Universidad Autónoma
Estado de Hidalgo, México Chapingo, México
Dra. Maria Salud Rubio Lozano, Facultad de Medicina Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma
Veterinaria y Zootecnia, UNAM, México Metropolitana Xochimilco, México
Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Alfredo Cesín Vargas, UNAM, México
Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Dra. Marisela Leal Hernández, INIFAP, México
Investigaciones Agrícolas, España Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados,
Dr. José Armando Partida de la Peña, INIFAP, México México
Dr. José Luis Romano Muñoz, INIFAP, México Dra. Itzel Amaro Estrada, INIFAP, México
Dr. Jorge Alberto López García, INIFAP, México
Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de
Baja California, México
TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera
Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y
Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal
(RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso
(www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).
I
REVISTA MEXICANA DE CIENCIAS PECUARIAS
La Revista Mexicana de Ciencias Pecuarias es un órgano trimestral en formato bilingüe Español e Inglés. El costo
de difusión científica y técnica de acceso abierto, revisada total por publicar es de $ 7,280.00 más IVA por manuscrito
por pares y arbitrada. Su objetivo es dar a conocer los ya editado.
resultados de las investigaciones realizadas por cualquier Se publica en formato digital en acceso abierto, por lo que
institución científica, relacionadas particularmente con las se autoriza la reproducción total o parcial del contenido de
distintas disciplinas de la Medicina Veterinaria y la los artículos si se cita la fuente.
Zootecnia. Además de trabajos de las disciplinas indicadas
El envío de los trabajos de debe realizar directamente en el sitio
en su Comité Editorial, se aceptan también para su
evaluación y posible publicación, trabajos de otras oficial de la revista. Correspondencia adicional deberá dirigirse al
disciplinas, siempre y cuando estén relacionados con la Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69
Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México.
investigación pecuaria.
Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele):
Se publican en la revista tres categorías de trabajos: rodriguez_oscar@prodigy.net.mx.
Artículos Científicos, Notas de Investigación y Revisiones
La correspondencia relativa a suscripciones, asuntos de
Bibliográficas (consultar las Notas al autor); la
responsabilidad de cada trabajo recae exclusivamente en intercambio o distribución de números impresos anteriores, deberá
los autores, los cuales, por la naturaleza misma de los dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias
Pecuarias, Campo Experimental Mocochá, Km. 25 Antigua
experimentos pueden verse obligados a referirse en
algunos casos a los nombres comerciales de ciertos Carretera Mérida–Motul, Mocochá, Yuc. C.P. 97454;
productos, ello sin embargo, no implica preferencia por los garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx.
productos citados o ignorancia respecto a los omitidos, ni Inscrita en la base de datos de EBSCO Host y la Red de Revistas
tampoco significa en modo alguno respaldo publicitario Científicas de América Latina y el Caribe, España y Portugal
hacia los productos mencionados. (RedALyC) (www.redalyc.org), en la Red Iberoamericana de
Revistas Científicas de Veterinaria de Libre Acceso
Todas las contribuciones serán cuidadosamente evaluadas
por árbitros, considerando su calidad y relevancia (www.veterinaria.org/revistas/ revivec), indizada en el “Journal
académica. Queda entendido que el someter un Citation Report” Science Edition del ISI (http://thomsonreuters.
com/) y en los Índices SCOPUS y EMBASE de Elsevier
manuscrito implica que la investigación descrita es única
e inédita. La publicación de Rev. Mex. Cienc. Pecu. es (www.elsevier.com)
VISITE NUESTRA PÁGINA EN INTERNET

Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx
Revista Mexicana de Ciencias Pecuarias is an open access Part of, or whole articles published in this Journal may be
peer-reviewed and refereed scientific and technical reproduced, stored in a retrieval system or transmitted in
journal, which publishes results of research carried out in any form or by any means, electronic, mechanical,
any scientific or academic institution, especially related to photocopying or otherwise, provided the source is
different areas of veterinary medicine and animal properly acknowledged.
production. Papers on disciplines different from those Manuscripts should be submitted directly in the official web site.
shown in Editorial Committee can be accepted, if related Additional information may be mailed to Associate Editor, Revista
to livestock research. Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia
The journal publishes three types of papers: Research Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52
Articles, Technical Notes and Review Articles (please (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx.
consult Instructions for authors). Authors are responsible For subscriptions, exchange or distribution of previous printed
for the content of each manuscript, which, owing to the issues, please contact: Editor-in-Chief of Revista Mexicana de
nature of the experiments described, may contain Ciencias Pecuarias, Campo Experimental Mocochá, Km. 25 Antigua
references, in some cases, to commercial names of certain Carretera Mérida–Motul, Mocochá, Yuc. C.P. 97454;
products, which however, does not denote preference for garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx.
those products in particular or of a lack of knowledge of Registered in the EBSCO Host database. The Latin American and
any other which are not mentioned, nor does it signify in the Caribbean Spain and Portugal Scientific Journals Network
any way an advertisement or an endorsement of the (RedALyC) (www.redalyc.org). The Iberoamerican Network of free
referred products. access Veterinary Scientific Journals (www.veterinaria.org/
All contributions will be carefully refereed for academic revistas/ revivec). Thomson Reuter´s “Journal Citation Report”
relevance and quality. Submission of an article is Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS
understood to imply that the research described is unique and EMBASE (www.elsevier.com) and the Essential Electronic
and unpublished. Rev. Mex. Cien. Pecu. is published Agricultural Library (www.teeal.org)
quarterly in original lenguage Spanish or English. Total fee .
charges are US $ 425.00 per article in both printed
languages.
VISIT OUR SITE IN THE INTERNET
Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx
II
REVISTA MEXICANA DE CIENCIAS PECUARIAS
REV. MEX. CIENC. PECU. VOL. 15 No. 1 ENERO-MARZO-2024
CONTENIDO
Contents
ARTÍCULOS
Articles
Pág.
Generación de nuevas ecuaciones para estimar la biomasa aérea a partir de variables

morfológicas obtenidas de pastos en agostaderos de Nuevo León, México
Generation of new equations to estimate aerial biomass based on morphological variables obtained
from grasses in rangelands of Nuevo León, Mexico
Juan Emmanuel Segura Carmona, José Israel Yerena Yamallel, Hugo Bernal Barragán, Eduardo
Alanís Rodríguez, Luis Gerardo Cuéllar Rodríguez, Javier Jiménez Pérez .......................................1
Índice de área foliar e indicadores de productividad forrajera de Lotus corniculatus L.

en diferentes contenidos de humedad del suelo y estaciones del año
Leaf area index and forage productivity indicators of Lotus corniculatus L. at different soil moisture
contents and seasons of the year
Aurelio Pedroza Sandoval, Sahara Xolocotzi Acoltzi, Ricardo Trejo Calzada, Gabino García de los
Santos, Perpetuo Álvarez Vázquez, Jesús Guadalupe Arreola Ávila ...................…….....................17
Microsilages elephant grass BRS Capiaçu added with commercial microbial consortium
on different days of regrowth
Microensilados de pasto elefante BRS Capiaçu adicionados con consorcio microbiano comercial en
diferentes días de rebrote
Allan Stênio da Silva Santos, Daniel Louçana da Costa Araújo, Ivone Rodrigues da Silva, Matheus
Sousa Araújo, Arnaud Azevêdo Alves, Henrique Nunes Parente, Maria Elizabete de Oliveira, João
Batista Lopes. ........................................................................................................................32
Agronomic performance of palisade grass under different doses of liquid blood waste
and chemical composition of soil
Comportamiento agronómico del pasto insurgente bajo diferentes dosis de residuos sanguíneos
líquidos y composición química del suelo
Marcello Hungria Rodrigues, Clarice Backes, Alessandro José Marques Santos, Lucas Matheus
Rodrigues, Arthur Gabriel Teodoro, Cinthya Cristina Fernandes de Resende, Adriana Aparecida
Ribon, Pedro Rogerio Giongo, Patrick Bezerra Fernandes, Ana Beatriz Graciano da Costa..............49
III
Efecto de aceites esenciales sobre la producción de metano en la fermentación in vitro
de pasto llanero
Effect of essential oils on the production of methane in the in vitro fermentation of Koronivia grass
Paulino Sánchez-Santillán, Luis Antonio Saavedra-Jiménez, Nicolás Torres-Salado, Jerónimo
Herrera-Pérez, Marco Antonio Ayala-Monter..............................................................................69
Effect of the administration of intraruminal selenium boluses in goat kids on

biomarkers of oxidative stress in plasma
Efecto de la administración de bolos intrarruminales de selenio en cabritos sobre biomarcadores de
estrés oxidativo en plasma
Gabriela Rodríguez Patiño, Víctor Manuel Díaz Sánchez, J. Efrén Ramírez Bribiesca, Arturo Aguirre
Gómez, Alma Luisa Revilla Vázquez, Patricia Ramírez Noguera, Jorge Luis Tórtora Pérez, Raquel
López Arellano. ...............................................................................................……........………..83
Prevalencia e intensidad de varroosis y nosemosis de las abejas melíferas ( Apis

mellifera) en seis regiones del estado de Jalisco, México
Prevalence and intensity of varroosis and nosemosis of honey bees (Apis mellifera) in six regions of
the state of Jalisco, Mexico
Ana K. Ramos-Cuellar, Álvaro De la Mora, Francisca Contreras-Escareño, Nuria Morfin, José M.
Tapia-González, José O. Macías-Macías, Tatiana Petukhova, Adriana Correa-Benítez, Ernesto
Guzman-Novoa ......................................................................................………..................…….98
Relación entre el desarrollo corporal y la respuesta reproductiva de vaquillas a

protocolos de sincronización de estros en el sistema lechero de pequeña escala
Relationship between body development and reproductive response of heifers to estrus
synchronization protocols in the small-scale dairy system
Eliab Estrada-Cortés, Fernando Villaseñor-González, Héctor Raymundo Vera-Ávila, Héctor Jiménez-
Severiano, Eugenio Villagómez-Amezcua Manjarrez, Mario Alfredo Espinosa-Martínez ................115
The effect of age, sex and postmortem aging on meat quality traits and biochemical
profile of different muscles from Brangus cattle
El efecto de la edad, el sexo y la maduración post mortem sobre la calidad de la carne y el perfil
bioquímico de músculos de bovinos Brangus
Julieta Fernández Madero, Laura Pouzo, Darío Pighín, Jorge Alejandro Navarro, Fernando Ailán,
César Federico Guzmán, Enrique Paván ..................................................................................130
Construcción y validación de cuestionarios para evaluar el riesgo de los antibióticos

veterinarios en el consumo de huevo e impacto en la seguridad alimentaria
Construction and validation of questionnaires to assess the risk of veterinary antibiotics in egg
consumption and their impact on food safety
Eriberto Joel Tejada Rodríguez, Andrea Arreguín.........................................................……..……149
Estudio del impacto de las ganaderías de bovino de lidia en la dehesa española

Study of the impact of fighting cattle farms in the Spanish dehesa
José Manuel Sanes, Juan Seva, María Jesús Gamón, Inmaculada Torrego, Eliana Abellán ..........176
IV
Análisis in silico de genes diana de miRNAs posiblemente inducidos por la infección
con tuberculosis
In silico analysis of miRNA target genes possibly induced by tuberculosis infection
Elba Rodríguez-Hernández, Laura Itzel Quintas-Granados, Feliciano Milian Suazo, Ana María Anaya
Escalera ...............................................................................................................................192
REVISIONES DE LITERATURA
Reviews
El sistema alfalfilla-Sinorhizobium meliloti como interacción útil para la fijación de

nitrógeno y mejorador de suelo. Revisión
The sweet clover-Sinorhizobium meliloti system as a useful interaction for nitrogen fixation and
as a soil improver. Review
Gabriel Gallegos Morales, Omar Jiménez Pérez, Juan Manuel Sánchez Yañes, Perpetuo Álvarez
Vázquez, Francisco Castillo Castillo .........................................................................................208
Principales componentes bioactivos y propiedades terapéuticas del veneno de abeja

(Apis mellifera L.). Revisión
Main bioactive components and therapeutic properties of bee ( Apis mellifera L.) venom. Review
Karla Itzél Alcalá-Escamilla, Yolanda Beatriz Moguel-Ordóñez ....................................................230
V
Actualización: octubre, 2023
NOTAS AL AUTOR
La Revista Mexicana de Ciencias Pecuarias se edita bibliográficas una extensión máxima de 30 cuartillas y
completa en dos idiomas (español e inglés) y publica tres 5 cuadros.
categorías de trabajos: Artículos científicos, Notas de
6. Los manuscritos de las tres categorías de trabajos que
investigación y Revisiones bibliográficas.
se publican en la Rev. Mex. Cienc. Pecu. deberán
Los autores interesados en publicar en esta revista contener los componentes que a continuación se
deberán ajustarse a los lineamientos que más adelante se indican, empezando cada uno de ellos en página
indican, los cuales, en términos generales, están de aparte.
acuerdo con los elaborados por el Comité Internacional de Página del título
Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Resumen en español
Panam 1989;107:422-437. Resumen en inglés
Texto
1. Sólo se aceptarán trabajos inéditos. No se admitirán
Agradecimientos y conflicto de interés
si están basados en pruebas de rutina, ni datos
experimentales sin estudio estadístico cuando éste Literatura citada
sea indispensable. Tampoco se aceptarán trabajos
que previamente hayan sido publicados condensados 7. Página del Título. Solamente debe contener el título
o in extenso en Memorias o Simposio de Reuniones o del trabajo, que debe ser conciso pero informativo; así
Congresos (a excepción de Resúmenes). como el título traducido al idioma inglés. En el
manuscrito no se debe incluir información como
2. Todos los trabajos estarán sujetos a revisión de un
nombres de autores, departamentos, instituciones,
Comité Científico Editorial, conformado por Pares de
direcciones de correspondencia, etc., ya que estos
la Disciplina en cuestión, quienes desconocerán el
datos tendrán que ser registrados durante el proceso
nombre e Institución de los autores proponentes. El
de captura de la solicitud en la plataforma del OJS
Editor notificará al autor la fecha de recepción de su
(revisar el Instrucctivo para envío de artículos en la
trabajo.
dirección: http://ciencias pecuarias.inifap.gob.mx.
3. El manuscrito deberá someterse a través del portal de
8. Resumen en español. En la segunda página se debe
la Revista en la dirección electrónica:
incluir un resumen que no pase de 250 palabras. En
http://cienciaspecuarias.inifap.gob.mx, consultando
él se indicarán los propósitos del estudio o
el “Instructivo para envío de artículos en la
investigación; los procedimientos básicos y la
página dela Revista Mexicana de Ciencias Pecuarias”.
metodología empleada; los resultados más
Para su elaboración se utilizará el procesador de
importantes encontrados, y de ser posible, su
Microsoft Word, con letra Times New Roman a 12
significación estadística y las conclusiones principales.
puntos, a doble espacio. Asimismo, se deberán llenar
A continuación del resumen, en punto y aparte,
los formatos de postulación, carta de originalidad y no
agregue debidamente rotuladas, de 3 a 8 palabras o
duplicidad y disponibles en el propio sitio oficial de la
frases cortas clave que ayuden a los indizadores a
revista.
clasificar el trabajo, las cuales se publicarán junto con
4. Por ser una revista con arbitraje, y para facilitar el el resumen.
trabajo de los revisores, todos los renglones de cada
9. Resumen en inglés. Anotar el título del trabajo en
página deben estar numerados de manera continua a
inglés y a continuación redactar el “abstract” con las
lo largo de todo el documento; asimismo cada página
mismas instrucciones que se señalaron para el
debe estar numerada, inclusive cuadros, ilustraciones
resumen en español. Al final en punto y aparte, se
y gráficas.
deberán escribir las correspondientes palabras clave
5. Los artículos tendrán una extensión máxima de 20 (“keywords”).
cuartillas a doble espacio, sin incluir páginas de Título,
10. Texto. Las tres categorías de trabajos que se publican
y cuadros o figuras (los cuales no deberán exceder de
en la Rev. Mex. Cienc. Pecu. consisten en lo
ocho y ser incluidos en el texto). Las Notas de
siguiente:
investigación tendrán una extensión máxima de 15
cuartillas y 6 cuadros o figuras. Las Revisiones
VI
texto, en los cuadros y en las ilustraciones se deben
a) Artículos científicos. Deben ser informes de trabajos
identificar mediante números arábigos entre
originales derivados de resultados parciales o finales
paréntesis, sin señalar el año de la referencia. Evite
de investigaciones. El texto del Artículo científico se
hasta donde sea posible, el tener que mencionar en el
divide en secciones que llevan estos
texto el nombre de los autores de las referencias.
encabezamientos:
Procure abstenerse de utilizar los resúmenes como
Introducción Material referencias; las “observaciones inéditas” y las
y MétodosResultados “comunicaciones personales” no deben usarse como
Discusión referencias, aunque pueden insertarse en el texto
Conclusiones e implicaciones (entre paréntesis).
Literatura citada
Reglas básicas para la Literatura citada
En los artículos largos puede ser necesario agregar Nombre de los autores, con mayúsculas sólo las
subtítulos dentro de estas divisiones a fin de hacer iniciales, empezando por el apellido paterno, luego
más claro el contenido, tanto en Material y métodos como iniciales del materno y nombre(s). En caso de
en las secciones de Resultados y de Discusión, las apellidos compuestos se debe poner un guión entre
cuales también pueden presentarse como una sola ambos, ejemplo: Elías-Calles E. Entre las iniciales de
sección. un autor no se debe poner ningún signo de
b) Notas de investigación. Consisten en puntuación, ni separación; después de cada autor sólo
modificaciones a técnicas, informes de casos clínicos se debe poner una coma, después del último autor se
de interés especial, preliminares de trabajos o debe poner unpunto.
investigaciones limitadas, descripción de nuevas El título del trabajo se debe escribir completo (en su
variedades de pastos; así como resultados de idioma original) luego el título abreviado de la revista
investigación que a juicio de los editores deban así ser donde se publicó, sin ningún signo de puntuación;
publicados. El texto contendrá la misma información inmediatamente después el año de la publicación,
del método experimental señalado en el inciso a), luego el número del volumen, seguido del número
pero su redacción será corrida del principio al final del (entre paréntesis) de la revista y finalmente el número
trabajo; esto no quiere decir que sólo se supriman los de páginas (esto en caso de artículo ordinario de
subtítulos, sino que se redacte en forma continua y revista).
coherente.
Puede incluir en la lista de referencias, los artículos
c) Revisiones bibliográficas. Consisten en el
aceptados, aunque todavía no se publiquen; indique la
tratamiento y exposición de un tema o tópico de
revista y agregue “en prensa” (entre corchetes).
relevante actualidad e importancia; su finalidad es la
de resumir, analizar y discutir, así como poner a En el caso de libros de un solo autor (o más de uno,
disposición del lector información ya publicada sobre pero todos responsables del contenido total del libro),
un tema específico. El texto se divide en: después del o los nombres, se debe indicar el título
Introducción, y las secciones que correspondan al del libro, el número de la edición, el país, la casa
desarrollo del tema en cuestión. editorial y el año.
11. Agradecimientos y conflicto de interés. Siempre Cuando se trate del capítulo de un libro de varios
que corresponda, se deben especificar las autores, se debe poner el nombre del autor del
colaboraciones que necesitan ser reconocidas, tales
capítulo, luego el título del capítulo, después el
como a) la ayuda técnica recibida; b) el
nombre de los editores y el título del libro, seguido del
agradecimiento por el apoyo financiero y material,
país, la casa editorial, año y las páginas que abarca el
especificando la índole del mismo; c) las relaciones
capítulo.
financieras que pudieran suscitar un conflicto de
intereses. Las personas que colaboraron pueden ser En el caso de tesis, se debe indicar el nombre del
citadas por su nombre, añadiendo su función o tipo de autor, el título del trabajo, luego entre corchetes el
colaboración; por ejemplo: “asesor científico”, grado (licenciatura, maestría, doctorado), luego el
“revisión crítica de la propuesta para el estudio”, nombre de la ciudad, estado y en su caso país,
“recolección de datos”, etc. Siempre que corresponda, seguidamente el nombre de la Universidad (no el de
los autores deberán mencionar si existe algún la escuela), y finalmente el año.
conflicto de interés.
12. Literatura citada. Numere las referencias
consecutivamente en el orden en que se mencionan
por primera vez en el texto. Las referencias en el
VII
Autor de capítulo.
Emplee el estilo de los ejemplos que aparecen a
continuación: IX) Roberts SJ. Equine abortion. In: Faulkner LLC editor.
Abortion diseases of cattle. 1rst ed. Springfield,
Illinois, USA: Thomas Books; 1968:158-179.
Revistas
Artículo ordinario, con volumen y número. (Incluya el Memorias de reuniones.
nombre de todos los autores cuando sean seis o X) Loeza LR, Angeles MAA, Cisneros GF. Alimentación
menos; si son siete o más, anote sólo el nombre de de cerdos. En: Zúñiga GJL, Cruz BJA editores.
los seis primeros y agregue “et al.”). Tercera reunión anual del centro de investigaciones
I) Basurto GR, Garza FJD. Efecto de la inclusión de grasa forestales y agropecuarias del estado de Veracruz.
o proteína de escape ruminal en el comportamiento Veracruz. 1990:51-56.
de toretes Brahman en engorda. Téc Pecu Méx XI) Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE.
1998;36(1):35-48. Concentración de insulina plasmática en cerdas
Sólo número sin indicar volumen. alimentadas con melaza en la dieta durante la
inducción de estro lactacional [resumen]. Reunión
II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, nacional de investigación pecuaria. Querétaro, Qro.
reproductive failure and corneal opacity (blue eye) in 1998:13.
pigs associated with a paramyxovirus infection. Vet
Rec 1988;(122):6-10. XII) Cunningham EP. Genetic diversity in domestic
animals: strategies for conservation and
III) Chupin D, Schuh H. Survey of present status of the use development. In: Miller RH et al. editors. Proc XX
of artificial insemination in developing countries. VI eltsville
B Symposium: Biotechnology’s role in genetic
World Anim Rev 1993;(74-75):26-35. improvement of farm animals. USDA. 996:13.
1
No se indica el autor. Tesis.
IV) Cancer in South Africa [editorial]. S Afr Med J XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis
1994;84:15. y babesiosis bovinas en becerros mantenidos en una
zona endémica [tesis maestría]. México, DF:
Suplemento de revista. Universidad Nacional Autónoma de México; 1989.
V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett XIV) Cairns RB. Infrared spectroscopic studies of solid
SE. Body composition at puberty in beef heifers as oxigen [doctoral thesis]. Berkeley, California, USA:
influenced by nutrition and breed [abstract]. J Anim University of California; 1965.
Sci 1998;71(Suppl 1):205.
Organización como autor.
Organización, como autor.
XV) NRC. National Research Council. The nutrient
VI) The Cardiac Society of Australia and New Zealand.
requirements of beef cattle. 6th ed. Washington,
Clinical exercise stress testing. Safety and performance
DC, USA: National Academy Press; 1984.
guidelines. Med J Aust 1996;(164):282-284.
XVI) SAGAR. Secretaría de Agricultura, Ganadería y
En proceso de publicación. Desarrollo Rural. Curso de actualización técnica para
la aprobación de médicos veterinarios zootecnistas
VII) Scifres CJ, Kothmann MM. Differential grazing use of
responsables de establecimientos destinados al
herbicide treated area by cattle. J Range Manage [in
press] 2000. sacrificio de animales. México. 1996.
XVII) AOAC. Oficial methods of analysis. 15th ed.
Arlington, VA, USA: Association of Official Analytical
Libros y otras monografías Chemists. 1990.
Autor total. XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary
VIII) Steel RGD, Torrie JH. Principles and procedures of NC, USA: SAS Inst. Inc. 1988.
statistics: A biometrical approach. 2nd ed. New XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.).
York, USA: McGraw-Hill Book Co.; 1980.
Cary NC, USA: SAS Inst. Inc. 1985.
VIII
Publicaciones electrónicas Abreviaturas de uso frecuente:
XX) Jun Y, Ellis M. Effect of group size and feeder type cal caloría (s)
on growth performance and feeding patterns in cm centímetro (s)
growing pigs. J Anim Sci 2001;79:803-813. °C grado centígrado (s)
http://jas.fass.org/cgi/reprint/79/4/803.pdf. DL50 dosis letal 50%
Accessed Jul 30, 2003. g gramo (s)
XXI) Villalobos GC, González VE, Ortega SJA. Técnicas ha hectárea (s)
para estimar la degradación de proteína y materia h hora (s)
orgánica en el rumen y su importancia en rumiantes i.m. intramuscular (mente)
en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. i.v. intravenosa (mente)
http://www.tecnicapecuaria.org/trabajos/20021217 J joule (s)
5725.pdf. Consultado 30 Ago, 2003. kg kilogramo (s)
XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level km kilómetro (s)
on milk production, body weight change, feed L litro (s)
conversion and postpartum oestrus of crossbred log logaritmo decimal
lactating cows in tropical conditions. Livest Prod Sci Mcal megacaloría (s)
2002;27(2-3):331-338. http://www.sciencedirect. MJ megajoule (s)
com/science/journal/03016226. Accessed Sep 12, m metro (s)
2003. msnm metros sobre el nivel del mar
13. Cuadros, Gráficas e Ilustraciones. Es preferible µg microgramo (s)
que sean pocos, concisos, contando con los datos µl microlitro (s)
necesarios para que sean autosuficientes, que se µm micrómetro (s)(micra(s))
entiendan por sí mismos sin necesidad de leer el texto. mg miligramo (s)
Para las notas al pie se deberán utilizar los símbolos ml mililitro (s)
convencionales. mm milímetro (s)
14 Versión final. Es el documento en el cual los autores min minuto (s)
ya integraron las correcciones y modificaciones ng nanogramo (s)
indicadas por el Comité Revisor. Se les enviará a los P probabilidad (estadística)
autores un instructivo que contendrá los puntos p página
esenciales para su correcta elaboración. Las PC proteína cruda
fotografías e imágenes deberán estar en formato jpg
PCR reacción en cadena de la polimerasa
(o compatible) con al menos 300 dpi de resolución.
Tanto las fotografías, imágenes, gráficas, cuadros o pp páginas
tablas deberán incluirse en el mismo archivo del texto. ppm partes por millón
Los cuadros no deberán contener ninguna línea % por ciento (con número)
vertical, y las horizontales solamente las que delimitan rpm revoluciones por minuto
los encabezados de columna, y la línea al final del seg segundo (s)
cuadro. t tonelada (s)
15. Una vez recibida la versión final, ésta se mandará para TND total de nutrientes digestibles
su traducción al idioma inglés o español, según UA unidad animal
corresponda. Si los autores lo consideran conveniente UI unidades internacionales
podrán enviar su manuscrito final en ambos idiomas. vs versus
16. Tesis. Se publicarán como Artículo o Nota de xg gravedades
Investigación, siempre y cuando se ajusten a las Cualquier otra abreviatura se pondrá entre paréntesis
normas de esta revista. inmediatamente después de la(s) palabra(s)
17. Los trabajos no aceptados para su publicación se completa(s).
regresarán al autor, con un anexo en el que se
19. Los nombres científicos y otras locuciones latinas se
explicarán los motivos por los que se rechaza o las
deben escribir en cursivas.
modificaciones que deberán hacerse para ser
reevaluados.
18.
IX
Updated: October, 2023
INSTRUCTIONS FOR AUTHORS
Revista Mexicana de Ciencias Pecuarias is a scientific Title page

journal published in a bilingual format (Spanish and Abstract
English) which carries three types of papers: Research Text
Articles, Technical Notes, and Reviews. Authors interested Acknowledgments and conflict of interest
in publishing in this journal, should follow the below- Literature cited
mentioned directives which are based on those set down
by the International Committee of Medical Journal Editors
(ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 7. Title page. It should only contain the title of the
work, which should be concise but informative; as well
1. Only original unpublished works will be accepted. as the title translated into English language. In the
Manuscripts based on routine tests, will not be manuscript is not necessary information as names of
accepted. All experimental data must be subjected to authors, departments, institutions and
statistical analysis. Papers previously published correspondence addresses, etc.; as these data will
condensed or in extenso in a Congress or any other have to be registered during the capture of the
type of Meeting will not be accepted (except for application process on the OJS platform
Abstracts). (http://cienciaspecuarias.inifap.gob.mx).
2. All contributions will be peer reviewed by a scientific 8. Abstract. On the second page a summary of no more
editorial committee, composed of experts who ignore than 250 words should be included. This abstract
the name of the authors. The Editor will notify the should start with a clear statement of the objectives
and must include basic procedures and methodology.
author the date of manuscript receipt.
The more significant results and their statistical value
3. Papers will be submitted in the Web site and the main conclusions should be elaborated briefly.
http://cienciaspecuarias.inifap.gob.mx, according the At the end of the abstract, and on a separate line, a
“Guide for submit articles in the Web site of the list of up to 10 key words or short phrases that best
Revista Mexicana de Ciencias Pecuarias”. Manuscripts describe the nature of the research should be stated.
should be prepared, typed in a 12 points font at 9. Text. The three categories of articles which are
double space (including the abstract and tables), At published in Revista Mexicana de Ciencias
the time of submission a signed agreement co-author Pecuarias are the following:
letter should enclosed as complementary file; co-
authors at different institutions can mail this form a) Research Articles. They should originate in primary
independently. The corresponding author should be works and may show partial or final results of
research. The text of the article must include the
indicated together with his address (a post office box
following parts:
will not be accepted), telephone and Email.
Introduction
4. To facilitate peer review all pages should be numbered
Materials and Methods
consecutively, including tables, illustrations and
Results
graphics, and the lines of each page should be
Discussion
numbered as well.
Conclusions and implications
5. Research articles will not exceed 20 double spaced Literature cited
pages, without including Title page and Tables and In lengthy articles, it may be necessary to add other
Figures (8 maximum and be included in the text). sections to make the content clearer. Results and
Technical notes will have a maximum extension of 15 Discussion can be shown as a single section if
pages and 6 Tables and Figures. Reviews should not considered appropriate.
exceed 30 pages and 5 Tables and Figures.
b) Technical Notes. They should be brief and be
6. Manuscripts of all three type of articles published in evidence for technical changes, reports of clinical
Revista Mexicana de Ciencias Pecuarias should cases of special interest, complete description of a
contain the following sections, and each one should limited investigation, or research results which
begin on a separate page. should be published as a note in the opinion
of the editors. The text will contain the same
X
information presented in the sections of t he e. When a reference is made of a chapter of book
research article but without section titles. written by several authors; the name of the author(s)
of the chapter should be quoted, followed by the title
c) Reviews. The purpose of these papers is to
summarize, analyze and discuss an outstanding topic. of the chapter, the editors and the title of the book,
The text of these articles should include the following the country, the printing house, the year, and the
sections: Introduction, and as many sections as initial and final pages.
needed that relate to the description of the topic in f. In the case of a thesis, references should be
question. made of the author’s name, the title of the research,
10. Acknowledgements. Whenever appropriate, the degree obtained, followed by the name of the City,
collaborations that need recognition should be State, and Country, the University (not the school),
specified: a) Acknowledgement of technical support; and finally the year.
b) Financial and material support, specifying its
nature; and c) Financial relationships that could be the Examples
source of a conflict of interest.
The style of the following examples, which are partly
People which collaborated in the article may be based on the format the National Library of Medicine
named, adding their function or contribution; for of the United States employs in its Index Medicus,
example: “scientific advisor”, “critical review”, “data should be taken as a model.
collection”, etc.
11. Literature cited. All references should be quoted in
their original language. They should be numbered Journals
consecutively in the order in which they are first
Standard journal article (List the first six authors
mentioned in the text. Text, tables and figure
followed by et al.)
references should be identified by means of Arabic
numbers. Avoid, whenever possible, mentioning in the I) Basurto GR, Garza FJD. Efecto de la inclusión de grasa
text the name of the authors. Abstain from using o proteína de escape ruminal en el comportamiento
abstracts as references. Also, “unpublished de toretes Brahman en engorda. Téc Pecu Méx
observations” and “personal communications” should 1998;36(1):35-48.
not be used as references, although they can be
inserted in the text (inside brackets). Issue with no volume
Key rules for references II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis,
reproductive failure and corneal opacity (blue eye) in
a. The names of the authors should be quoted
pigs associated with a paramyxovirus infection. Vet
beginning with the last name spelt with initial capitals,
Rec 1988;(122):6-10.
followed by the initials of the first and middle name(s).
In the presence of compound last names, add a dash III) Chupin D, Schuh H. Survey of present status of the
between both, i.e. Elias-Calles E. Do not use any use of artificial insemination in developing countries.
punctuation sign, nor separation between the initials World Anim Rev 1993;(74-75):26-35.
of an author; separate each author with a comma,
even after the last but one. No author given
b. The title of the paper should be written in full,
IV) Cancer in South Africa [editorial]. S Afr Med J
followed by the abbreviated title of the journal without
1994;84:15.
any punctuation sign; then the year of the publication,
after that the number of the volume, followed by the
number (in brackets) of the journal and finally the Journal supplement
number of pages (this in the event of ordinary article). V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett
c. Accepted articles, even if still not published, can SE. Body composition at puberty in beef heifers as
be included in the list of references, as long as the influenced by nutrition and breed [abstract]. J Anim
journal is specified and followed by “in press” (in Sci 1998;71(Suppl 1):205.
brackets). Organization, as author
d. In the case of a single author’s book (or more
VI) The Cardiac Society of Australia and New Zealand.
than one, but all responsible for the book’s contents),
Clinical exercise stress testing. Safety and
the title of the book should be indicated after the
performance guidelines. Med J Aust 1996;(164):282-
names(s), the number of the edition, the country, the
printing house and the year. 284.
XI
In press XVII) AOAC. Official methods of analysis. 15th ed.
Arlington, VA, USA: Association of Official Analytical
VII) Scifres CJ, Kothmann MM. Differential grazing use of
Chemists. 1990.
herbicide-treated area by cattle. J Range Manage [in
press] 2000. XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary
NC, USA: SAS Inst. Inc. 1988.
Books and other monographs
XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.).
Author(s) Cary NC, USA: SAS Inst. Inc. 1985.
VIII) Steel RGD, Torrie JH. Principles and procedures of

Electronic publications
statistics: A biometrical approach. 2nd ed. New
York, USA: McGraw-Hill Book Co.; 1980. XX) Jun Y, Ellis M. Effect of group size and feeder type
on growth performance and feeding patterns in
Chapter in a book growing pigs. J Anim Sci 2001;79:803-813.
http://jas.fass.org/cgi/reprint/79/4/803.pdf.
IX) Roberts SJ. Equine abortion. In: Faulkner LLC editor. Accesed Jul 30, 2003.
Abortion diseases of cattle. 1rst ed. Springfield,
Illinois, USA: Thomas Books; 1968:158-179. XXI) Villalobos GC, González VE, Ortega SJA. Técnicas
para estimar la degradación de proteína y materia
Conference paper orgánica en el rumen y su importancia en rumiantes
en pastoreo. Téc Pecu Méx 2000;38(2): 119-134.
X) Loeza LR, Angeles MAA, Cisneros GF. Alimentación
http://www.tecnicapecuaria.org/trabajos/20021217
de cerdos. En: Zúñiga GJL, Cruz BJA editores.
5725.pdf. Consultado 30 Jul, 2003.
Tercera reunión anual del centro de investigaciones
forestales y agropecuarias del estado de Veracruz. XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding
Veracruz. 1990:51-56. level on milk production, body weight change, feed
XI) Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. conversion and postpartum oestrus of crossbred
Concentración de insulina plasmática en cerdas lactating cows in tropical conditions. Livest Prod Sci
alimentadas con melaza en la dieta durante la 2002;27(2-3):331-338.
inducción de estro lactacional [resumen]. Reunión http://www.sciencedirect.com/science/journal/030
nacional de investigación pecuaria. Querétaro, Qro. 16226. Accesed Sep 12, 2003.
1998:13.
12. Tables, Graphics and Illustrations. It is preferable
XII) Cunningham EP. Genetic diversity in domestic that they should be few, brief and having the
animals: strategies for conservation and necessary data so they could be understood without
development. In: Miller RH et al. editors. Proc XX reading the text. Explanatory material should be
Beltsville Symposium: Biotechnology’s role in placed in footnotes, using conventional symbols.
genetic improvement of farm animals. USDA.
1996:13. 13. Final version. This is the document in which the
authors have already integrated the corrections and
Thesis modifications indicated by the Review Committee. The
works will have to be elaborated with Microsoft Word.
XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis
y babesiosis bovinas en becerros mantenidos en una Photographs and images must be in jpg (or
zona endémica [tesis maestría]. México, DF: compatible) format with at least 300 dpi resolution.
Universidad Nacional Autónoma de México; 1989. Photographs, images, graphs, charts or tables must
be included in the same text file. The boxes should
XIV) Cairns RB. Infrared spectroscopic studies of solid not contain any vertical lines, and the horizontal ones
oxigen [doctoral thesis]. Berkeley, California, USA: only those that delimit the column headings, and the
University of California; 1965.
line at the end of the box.
Organization as author
14. Once accepted, the final version will be translated into
XV) NRC. National Research Council. The nutrient Spanish or English, although authors should feel free
requirements of beef cattle. 6th ed. Washington, to send the final version in both languages. No
DC, USA: National Academy Press; 1984. charges will be made for style or translation services.
XVI) SAGAR. Secretaría de Agricultura, Ganadería y 15. Thesis will be published as a Research Article or as a
Desarrollo Rural. Curso de actualización técnica para Technical Note, according to these guidelines.
la aprobación de médicos veterinarios zootecnistas
responsables de establecimientos destinados al 16. Manuscripts not accepted for publication will be
sacrificio de animales. México. 1996. returned to the author together with a note explaining
XII
the cause for rejection, or suggesting changes which ml milliliter (s)
should be made for re-assessment. mm millimeter (s)
min minute (s)
17. List of abbreviations:
ng nanogram (s)
cal calorie (s) P probability (statistic)
cm centimeter (s) p page
°C degree Celsius CP crude protein
DL50 lethal dose 50% PCR polymerase chain reaction
g gram (s) pp pages
ha hectare (s) ppm parts per million
h hour (s) % percent (with number)
i.m. intramuscular (..ly) rpm revolutions per minute
i.v. intravenous (..ly) sec second (s)
J joule (s) t metric ton (s)
kg kilogram (s) TDN total digestible nutrients
km kilometer (s) AU animal unit
L liter (s) IU international units
log decimal logarithm vs versus
Mcal mega calorie (s) xg gravidity
MJ mega joule (s)
The full term for which an abbreviation stands should
m meter (s)
precede its first use in the text.
µl micro liter (s)
µm micro meter (s) 18. Scientific names and other Latin terms should be
written in italics.
mg milligram (s)
XIII
https://doi.org/10.22319/rmcp.v15i1.6457
Article
Generation of new equations to estimate aerial biomass based on

morphological variables obtained from grasses in rangelands of Nuevo
León, Mexico
Juan Emmanuel Segura Carmonaa
José Israel Yerena Yamallel a*
Hugo Bernal Barragán b
Eduardo Alanís Rodríguez a
Luis Gerardo Cuéllar Rodríguez a
Javier Jiménez Pérez a
a
Universidad Autónoma de Nuevo León. Facultad de Ciencias Forestales. Kilómetro 145,
Carretera nacional 85, Linares, N.L. México.
b
Universidad Autónoma de Nuevo León. Facultad de Agronomía. México.
* Corresponding author: israel.yerena@gmail.com
Abstract:
The estimation of aerial biomass of grasses contributes to carrying out efficient and
sustainable management of rangelands. This study aimed to generate new equations to
estimate the aerial biomass of grasses present in rangelands in Nuevo León, Mexico, based
on data collected from the total number (n= 745) of individuals of the five species of grasses:
Cenchrus ciliaris Linnaeus, Pappophorum bicolor Fourn, Aristida purpurea Nutt, Tridens
texanus Watson and Paspalum pubiflorum Fourn present in the sampling plots. Using the
maximum height and the height of the vegetative stems, the aerial, basal, and compressed
diameters, and volumes measured in each of the collected individuals, linear (stepwise) and
nonlinear equations were generated to estimate the aerial biomass (dry matter basis) of the
1
Rev Mex Cienc Pecu 2024;15(1):1-16
grasses cut at ground level. Six general equations with the best statistical fit for the total
species collected were selected. General equation III had the best values of R2 =0.88 and AIC
=3079, using the five variables evaluated. General equation IV had an R2 =0.86 and AIC
=3530, using only the variable compressed diameter. The selected specific equations
estimated the aerial biomass of the grasses Cenchrus ciliaris (R2=0.88, r=0.94),
Pappophorum bicolor (R2 =0.86, r =0.92), Aristida purpurea (R2=0.92, r=0.96), Tridens
texanus (R2 =0.91, r =0.96), and Paspalum pubiflorum (R2 =0.93, r = 0.97). The new
equations are a reliable alternative to indirectly estimate the aerial biomass of the grasses of
the rangelands of northeastern Mexico in a faster and less expensive manner than the
traditional method.
Keywords: Allometric equations, Cenchrus ciliaris, Native grasses, Compressed diameter.
Received: 04/05/2023
Accepted: 25/09/2023
Introduction
The rangelands distributed around the world cover more than 50 % of the earth’s surface and
provide biomass that supplies a fundamental ecosystem service on which wildlife,
population, and livestock farming, the main economic activity in this ecosystem, depend(1,2).
In the last century, rangelands have suffered degradation due to episodes of drought and
overgrazing due to an excessive stocking rate(3,4), due to failures in efficient and sustainable
use of the rangeland to cover the forage biomass requirements of the cattle herd(5). Therefore,
it is essential to have reliable estimates of the amount of forage available for cattle that allow
the proper use of forage, avoidance of overgrazing, and the satisfaction of the needs of
animals(6,7).
The traditional method for estimating aerial biomass production is that of cutting and
weighing grass; although this destructive method is accurate, it is usually expensive and time-
consuming(8,9). In addition, the random distribution of vegetation makes it necessary to
increase the recommended number of samples per site (15-20 samples(10)), ideally collected
at each forage growing season(8).
Indirect methods (non-destructive, since they do not require cutting the grass present) arise
as an alternative to the traditional one (destructive, which involves cutting and weighing the
2
grass present) to determine the aerial biomass of forage in the rangeland since they have the
advantage of achieving estimates of the biomass of large areas in a faster way(11,12).
Subjective empirical methods of visual estimation have the disadvantage of a high variation
in results among people who perform them in different periods of time(13). Graduated plates
or sticks have been used in recent decades to estimate forage biomass in meadows with
homogeneous vegetation(14,15). New methodologies for biomass estimation have been
developed through the use of satellite images(16), radar images(17), and unmanned vehicles(18);
however, these are mainly carried out in cultivated areas.
The rangelands have different types of vegetation with heterogeneous distribution. For
example, in the Tamaulipan thornscrub (TTS), shrub and semi-shrub species predominate,
sometimes constituting more than 80 % of the botanical composition, while grass species and
other weeds hardly exceed 10 and 6 %, respectively(19,20). Under these conditions, allometric
models developed by relating the biomass production data obtained from the traditional
method with the measurements made in morphological characteristics of the individual are a
good option to estimate the biomass of grasses objectively. Once the model is generated,
biomass estimation can only be done by measuring the necessary vegetative variables,
without the need to cut the plants(5,9).
Studies prior to this work have been conducted in meadows under irrigated and monoculture
conditions(15,21,22). For rangeland conditions, results obtained under arid conditions in
Arizona(23) and multispecies conditions in Argentina(9) have been published. There are reports
of equations generated specifically for estimating the biomass of certain grass species, such
as those reported based on 40 plants from C. ciliaris grass meadows in southern Arizona,
relating biomass with basal diameter and plant height(24), as well as equations generated for
A. purpurea in a previous study(25), using the diameter of the plant at different heights as
variables.
In Europe, an indirect estimation methodology was developed for grass species(21), which
used a measure called minimum volume, obtained by joining all the stems of the plant by
applying a subjective, non-standardized force to form a minimum volume.
The present study aimed to generate new equations to estimate the aerial biomass of five
species of grasses present in the rangelands of Nuevo León, Mexico, based on the
measurement of their morphological variables, which could serve as an alternative to replace
the need to cut grass as in the traditional method.
3
Material and methods
The study was conducted in an area of 132 ha of rangelands in the municipality of Marín,
Nuevo León (25°52'28"N; 100°03'24"W), in which precipitation varies between 400 and 600
mm per year, and the average temperature ranges from 20 to 22 °C(26). The primary vegetation
type is Tamaulipan thornscrub (TTS), in addition to having areas of induced grassland and
agriculture.
In January 2021, 31 sampling plots of 100 square meters (10 m x 10 m) were randomly
established within the study area with vegetation typical of the Tamaulipan thornscrub, and
five 1 m2 subplots were delimited within each plot, in which was collected and weighed (dry
matter basis) all the individuals of grasses present in each of the 155 subplots evaluated, in a
design similar to that previously used in areas of rangeland(27). A perimeter fence was placed
around each plot to prevent disturbances. All plots were cut at 3 to 5 cm height at the
beginning of the study and in each sampling. The first sampling was conducted from June 15
to July 15, 2021, and the second was conducted in the autumn from October 18 to November
8, 2021. In both cases, the sampling was carried out 30 to 40 d after a rainfall greater than
150 mm (in the first sampling) and 231 mm (in the case of the second sampling) since,
according to previous studies(28), the flowering of the Cenchrus ciliaris grass occurs between
25 and 35 d after regrowth as a result of precipitation of 150 mm, which is considered as the
threshold for the productivity of the species Cenchrus ciliaris(29) during the summer and
autumn.
In each subplot, all plants of the grass species present were sampled and identified
individually at the genus and species level. A Truper® pro-Lock FX-5M tape measure was
used to measure the variables described below and shown in Figure 1A:
1. Maximum height (H): distance between the ground and the highest part of the stems
and leaves.
2. Height of the vegetative stem (Hvs): distance between the ground and most vegetative
leaves, usually those without a spike.
3. Basal diameter (Bd): of the circumference of the base of the plant.
4. Aerial diameter (Ad): at the height of the vegetative stems.
5. Using Traceable® model 6˝ digital calipers, the compressed diameter (Cd, Figure 1)
was measured at half the height of the grass using an experimental prototype that, through a
retractable band, applies a graduated uniform pressure of 2 kg on the vegetative stems.
6. Using the morphological variables of Figure 1A, circular aerial cover (CACOV),
ellipsoidal aerial cover (EACOV), circular basal cover (CBCOV), and ellipsoidal basal cover
(EBCOV) were calculated. The volumes of the cylinder (in its CYL1 to CYL5 modalities)
4
and cone (in CON1 to CON5 modalities), indicated in Figure 1B, were based on previous
proposals(30).
Each of the 745 plants sampled was identified, measured, and cut with hand scissors at
ground level to record its fresh weight (g) in the field and stored in a Kraft paper bag.
Subsequently, the samples were taken to the laboratory and dried in a forced air oven at
60 °C until reaching a constant weight in order to obtain their dry weight (g) by using a scale
with a capacity of 500 g with a minimum division of 0.1 g (Torrey brand, model Lab-500).
Figure 1: Variables measured in grass plants (A) and shapes of estimated volumes (B)
H= height ; Hvs= height of vegetative stems ; Bd= basal diameter; Cd= compressed diameter; Ad= aerial
diameter.
The 745 individuals found in the sampling subplots were identified, measured, and cut. The
plants of the five grass species present in the study area: Cenchrus ciliaris (n= 424
individuals), Pappophorum bicolor (n= 125 individuals), Aristida purpurea (n= 107
individuals), Tridens texanus (n= 59 individuals) and Paspalum pubiflorum (n= 30
individuals) were collected for the generation of equations.
A total of 19 independent variables (aerial diameter, basal diameter, compressed diameter,

height, vegetative stem height, circular basal cover, elliptical basal cover, circular aerial
cover, elliptical aerial cover, volume of cylinder 1, volume of cylinder 2, volume of cylinder
3, volume of cylinder 4, volume of cylinder 5, volume of cone 1, volume of cone 2, volume
of cone 3, volume of cone 4, volume of cone 5) and a dependent variable (measured biomass
[g DM] per individual of the grass species) were subjected to linear regression, stepwise
regression(9) and nonlinear regression (logarithmic, inverse, quadratic, cubic, power,
exponential) analysis in the IBM SPSS software to generate biomass prediction equations
both generally and specifically (for each of the five grass species found in the samplings).
5
To assess the quality of the biomass estimate achieved with the new general and specific
equations, each of the values recorded in the destructive sampling was compared with the
predicted values of each of the equations. The coefficient of determination of the regression
(R2)(27), the standard error (SE)(30)), Pearson’s correlation (r)(18), the normalized root mean
squared error (NRMSE)(21), and the Akaike information criterion (AIC)(27) were calculated.
The six general equations developed with the best statistical fits of AIC, NRMSE, R2, SE,
and r were selected to estimate the total species collected, and a specific equation was selected
for each of the five recorded grass species.
Results
The grasses Cenchrus ciliaris and Paspalum pubiflorum presented values of aerial and basal
cover, aerial and basal diameter, and fresh and dry weight (P<0.05) higher than the rest of
the species (Table 1). Cenchrus ciliaris recorded an average value of dry weight per
individual higher than that of Aristida purpurea and Tridens texanus (P<0.05), while
Paspalum pubiflorum and Pappophorum bicolor obtained intermediate values.
The estimates of aerial biomass calculated with the six new general equations generated in
the present study had coefficients of determination (R2) that varied between 0.77 and 0.90,
while Pearson’s correlation coefficient (r) ranged from 0.88 to 0.94. The normalized root
mean squared error (NRMSE) ranged from 0.68 to 0.48, and the Akaike information criterion
(AIC) took values from 3553 to 3079 (Table 2).
6
Table 1: Average values of aerial cover, basal cover, aerial diameter, basal diameter,
compressed diameter, maximum height, height of vegetative stems, fresh weight, and dry
weight per individual of each species in 1 m2 experimental subplots
Cover Diameter Height Weight
Species AER Basal AER Basal Compressed MAX Vegetative Fresh Dry
(cm²) (cm²) (cm) (cm) (mm) (cm) stems (cm) (g) (g)
Cenchrus
ciliaris 729ab 190a 28a 14a 19a 52a 27a 53a 22a
Pappophorum
bicolor 355bc 52bc 20bc 8bc 13abc 52a 23ab 15bcd 10ab
Aristida
purpurea 277bc 29c 17cd 6c 9bcd 45ab 20bc 7cd 5b
Tridens
texanus 208c 37bc 16cd 6c 6d 34cd 16c 5d 3b
Paspalum
pubiflorum 799a 104abc 30a 11ab 13ab 40bc 23ab 48ab 13ab
AER= aerial; MAX= maximum.

abcd
Different letters within the same column indicate a significant difference (P<0.05).
Equation I is a linear model that incorporates the measurement of cone 5 (Figure 1B), which
is calculated based on three direct variables (aerial diameter, compressed diameter, and
height of the vegetative stems), and whose estimates have an R2 of 0.77, r=0.88,
NRMSE=0.64, AIC=3469. The estimates calculated with equation II (linear) from the data
generated by the variables aerial diameter, compressed diameter, height, and height of the
vegetative stems have an R2 of 0.87, r= 0.93, NRMSE= 0.49, and AIC= 3108. Equation III
(linear) incorporates the data of the five measured variables to calculate estimates that have
an R2 of 0.88, r= 0.94, NRMSE= 0.48, AIC= 3079 (Figure 2A).
7
Figure 2: Regression of predicted values and observed values
A) General equation III (Table 2). B) General equation IV (compressed diameter). C) Specific equation for
Cenchrus ciliaris. D) Specific equation for Pappophorum bicolor (Table 2). E) Specific equation of Aristida
purpurea. F) Specific equation of Tridens texanus (Table 2). All graphs were set to zero.
Nonlinear equations IV (R2= 0.86, r= 0.88, NRMSE= 0.67, AIC= 3530; Figure 2B), V (R2=
0.89, r= 0.88, NRMSE= 0.68, AIC= 3553) and VI (0.90, r= 0.88, NRMSE= 0.67, AIC= 3530)
are from the power model and use fewer variables. The estimates calculated using equation
IV, which uses the compressed diameter as the only variable, have an R2=0.86 (Figure 2B).
Equation V uses cylinder 3, calculated from the compressed diameter and height of the plant,
to estimate aerial grass biomass with R2=0.89. Equation VI uses cylinder 5 (Figure 1B),
calculated from the compressed diameter and height of the vegetative stems, to estimate
aerial biomass with R2= 0.90 (Table 2).
8
In the case of equations generated specifically for each of the grass species, comparisons
between the estimated values and the results recorded directly from aerial biomass yielded
R2 values from 0.86 to 0.93. The values of r (Pearson) ranged from 0.92 to 0.97. For NRMSE,
values from 0.40 to 0.24 were recorded, and AIC took values from 1603 to -18 (Table 2). In
the specific case of the equation generated for Cenchrus ciliaris, a good fit of the estimated
values of aerial biomass was achieved, with R2 of 0.88, r= 0.94, NRMSE= 0.40, AIC= 1603,
using the five variables measured (Figure 2C).
The results estimated using the five variables with the specific equation for the species
Pappophorum bicolor (Table 2) had a fit of (R2= 0.86, r =0.92, NRMSE= 0.29, AIC= 287)
(Figure 2D).
The information collected from 107 individuals of Aristida purpurea allowed the generation
of a specific equation for this grass species (Table 2), whose estimates, based on the five
variables measured, had a fit with a coefficient of determination of 0.92, r=0.96, NRMSE=
0.27, AIC= 87. (Figure 2E).
Table 2: General and specific allometric equations generated based on morphological

variables to indirectly estimate the aerial biomass of grasses (g DM-1)
NRM
2
Id Equation R SE r SE AIC
General equations
I Y= 0.9648 + 0.0026CON5 0.77 10.1 0.88 0.64 3469
II Y= 2.5343 + 0.0027CON5 + 0.0139CYL3 - 0.0295CACOV 0.87 7.8 0.93 0.49 3108

+0.8253Cd - 0.2595Hvs + 0.0002CYL1
III Y= 1.2159 + 0.0032CON5 + 0.0447CYL3 - 0.0421CACOV 0.88 7.5 0.94 0.48 3079
+ 0.8939Cd - 0.3478Hvs + 0.0003CYL1 - 0.0253CON2 +
0.5790Bd + 0.0084CYL2
IV Y= 0.1213 * Cd1.6818 0.86 0.4 0.88 0.67 3530
V Y= 0.4473 * CYL30.7288 0.89 0.4 0.88 0.68 3553
VI Y= 0.8084 * CYL50.7078 0.90 0.4 0.88 0.67 3530
Specific equations
C.c. Y= 0.2862 + 0.0032CON5 - 0.0753CACOV + 1.4623Cd - 0.88 9.0 0.94 0.40 1603
0.0767CON4 + 0.0279CYL4+ 0.0902CBCOV - 0.3257Hvs
+ 0.0022CYL1- 0.0032CON1 + 0.0931CYL5
P.b. Y= 2.1060 + 0.0490CYL3 + 0.0050CON4 + 0.0002CON3 - 0.86 3.0 0.92 0.29 287
0.0050EBCOV
9
A.p. Y= -0.6641 + 0.1138CYL5 + 0.1257Ad + 0.0046CON2 - 0.92 1.5 0.96 0.27 87

0.0816CBCOV + 0.1951Cd
T.t. Y= 0.5474 + (0.1672 * CYL3) + (-0.0012 * CYL3) + (1.18 0.91 0.9 0.96 0.30 -18
× 10-5 * CYL3)
P.p. Y= -0.0371 +(0.2744 * CYL3) + (-0.0020 * CYL3) + (6 × 0.93 2.3 0.97 0.24 57
10-6 * CYL3)
Linear model equations= I, II, III, C.c., P.b., and A.p.; Power model equations= IV, V and VI; Cubic model
equations= T.t. and P.p.; Y= Aerial biomass (g DM-1); R2= Coefficient of determination; SE=Standard error;
r= Pearson’s correlation coefficient; NRMSE= Normalized root mean squared error; AIC= Akaike
Information Criteria; C.c.= Cenchrus ciliaris; P.b.= Pappophorum bicolor; A.p.= Aristida purpurea; T.t.=
Tridens texanus; P.p.= Paspalum pubiflorum. See Figure 1 for Bd, Ad, Cd, H, Hvs, EBCOV, CBCOV,
CACOV, CYL1, CYL2, CYL3, CYL4, CYL5, CON1, CON2, CON3, CON4, CON5. All regression
coefficients were significant (P<0.05).
The variable cylinder 3, calculated from the height of the plant and the compressed diameter, was the basis for
generating the specific equations for Tridens texanus and Paspalum pubiflorum in the cubic model, whose
estimates had a fit of R2 of 0.91, r=0.96, NRMSE=0.30, AIC=-18 for Tridens texanus (Figure 2F) and
R2=0.93, r=0.97, NRMSE=0.24, AIC=57 for P. pubiflorum.
Discussion
The linear and polynomial equations generated in the present study based on the sampling of
vegetative measurements and biomass weight records of grasses present in the rangeland
allowed the estimation of the aerial biomass of grasses present in the rangeland with a high
degree of precision.
The new general allometric equations established in the present study had values of R2 (0.77
to 0.93) higher than those previously reported (R2 from 0.25 to 0.85) for estimates of general
equations for two grasses and two pseudo-grasses in the Peruvian Andes(27). Allometric
equations generated in Chubut, Argentina(23), by evaluating 50 individuals from three species
of grasses, had R2 values (between 0.72 and 0.86) similar to those obtained in the present
study.
The number of plots established in the present study was similar to that previously used(27);
however, in the present study, there were plots of 100 m2, while in the previous study(27), they
had plots of 4 m2. In addition, in each of the 31 plots of the present study, the values of
botanical composition, vegetative measurements, and biomass of the grasses present in five
subplots were recorded. With this, there was greater reliability of the recorded measurements
and the calculated averages for the generation of the equations.
10
The species C. ciliaris had a significant presence in the grass vegetation observed in the
rangeland evaluated since it represented 57 % of the total number (n= 745) of individuals
collected and its biomass, calculated considering the number of individuals and the average
weight of the individuals of the species shown in Table 1, represented 80 % of the biomass
recorded in the rangeland evaluated. In the areas assessed in the present study, the C. ciliaris
grass present was established by natural dispersion, evidencing its high potential to establish
itself in the rangelands in Mexico(31). The native species with the highest presence in the
present study was Pappophorum bicolor, which had a record of 125 individuals, that is,
17 % of the total, whose biomass represented only 11 % of the total biomass (Table 1).
The compressed diameter was the variable included in 100 % of the general allometric
equations and in 97 % of the specific equations, both for the linear and nonlinear model,
generated in the present study for each grass species. The height of the vegetative stems was
included in 87 % of the general equations. The variables vegetative stem height and plant
height were included in 71 % of the specific equations. These variables have been directly
related to forage density(32). Some authors(30) reported that, in meadows with optimal
conditions for their development, the variable vegetation cover is the one that can best
indirectly estimate the biomass. Mahood et al(22) determined that vegetation cover is a good
predictor for biomass estimation, with an R2 of up to 0.89 in Bromus tectorum plant
communities.
An indirect estimation methodology implemented for grass species in Western Europe(21)

used a measure called minimum volume as a variable, consisting of manually joining all the
stems of the plant until forming a minimum volume; nevertheless, the applied force was
subjective, varying according to the person performing the measurement and it could even
vary when the same person exerts different pressure due to fatigue when repeatedly making
the sampling. By applying the same compression force, the compaction device used in the
present work generated greater certainty of the results obtained.
The NRMSE values calculated in each of the new equations generated in the present study
determine the dispersion of the estimated data with respect to the observed data, with 0 being
the ideal fit(33). In contrast, the Akaike criterion compares and selects from a group of
prediction models that use the same experimental data the most appropriate to forecast the
expected values compared to the observed values, which in this case should be the model
with the lowest AIC value(34,35). The values of NRMSE and AIC are very useful in the
selection of the best models.
The specific equation generated in the present study for Cenchrus ciliaris had a value of
R2=0.87, and with it, an R2 similar to that reported in a study (R2 of 0.82(24)) to generate
allometric equations relating biomass with the measurement of basal diameter and height of
40 plants of C. ciliaris grass meadows in southern Arizona. The equation generated in the
11
present study for A. purpurea resulted in an R2= 0.89, similar to those reported (R2 from 0.82
to 0.90) in a previous study(25), for the species A. purpurea, using the diameter of the plant at
different heights. Some authors(30) generated equations to estimate aerial biomass from the
analysis of 93 plants of Agropyron desertorum and reported coefficients of variation (R2 from
0.76 to 0.88) slightly lower than those of the present study. The new equations generated in
this study are potential candidates to replace the cutting, drying, and weighing phases
performed in the traditional method(36).
The development of allometric equations with application in rangelands is of utmost

importance to achieve sustainable ecosystem management(27). These non-destructive
vegetation samplings have advantages in terms of time and budget compared to traditional
sampling and also allow growth monitoring at the individual level(21,37).
The importance of 19 variables related to the morphological characteristics of grasses present

in the rangeland was evaluated to estimate the production of aerial biomass per plant. This
information was used to generate 6 new general equations for five grass species present in
the study area and 5 new specific equations (one for each grass species Cenchrus ciliaris,
Pappophorum bicolor, Aristida purpurea, Tridens texanus, and Paspalum pubiflorum),
which reliably and practically estimate the production of biomass without destroying
(cutting) the plant. The new equations generated in this study are a viable option to replace
the cutting phase of the samples in the traditional method of estimating the production of
aerial biomass of grasses in the rangeland. The development of general (multispecies) and
specific (for a particular grass species) allometric equations is a reliable alternative to
indirectly estimate the aerial biomass of the grasses of the rangelands of northeastern Mexico
more quickly and less expensively than the traditional method.
Acknowledgments
CONAHCYT is thanked for the scholarship granted to the first author during the
development of this research.
12
Literature cited:
1. ILRI. (International Livestock Research Institute), IUCN. (International Union for
Conservation of Nature), FAO. (Food and Agriculture Organization of the United
Nations), WWF. (World Wide Fund for Nature), UNEP. (United Nations Environment
Programme) & ILC. (International Land Coalition). Rangelands Atlas. Nairobi Kenya:
ILRI. 2021 https://hdl.handle.net/10568/114064. Accessed Apr 1, 2023.
2. Jones MO, Robinson NP, Naugle DE, Maestas JD, Reeves MC, et al. Annual and 16-day
rangeland production estimates for the western United States. Rangeland Ecol
Management 2021;(77):112-117.
3. Mganga KZ, Musimba NKR, Nyariki DM, Nyangito MM, Mwang'ombe AW. The choice
of grass species to combat desertification in semi‐arid Kenyan rangelands is greatly
influenced by their forage value for livestock. Grass Forage Sci 2015;70(1):161-167.
4. Williams DG, Baruc Z. African grass invasion in the Americas: ecosystem consequences
and the role of ecophysiology. Biolog Invasions 2000;(2):123-140.
5. Murphy DJ, Shine P, Brien BO, Donovan MO, Murphy MD. Utilising grassland
management and climate data for more accurate prediction of herbage mass using the
rising plate meter. Precision Agric 2021;(22):1189-1216.
6. Mundava C, Helmholz P, Schut T, Corner R, McAtee B, Lamb D. Evaluation of vegetation

indices for rangeland biomass estimation in the Kimberley area of Western Australia.
ISPRS Annals of the Photogrammetry, Remote Sensing and Spatial Information
Sciences. 2014;(II-7):47-53.
7. Grüner E, Astor T, Wachendorf M. Biomass prediction of heterogeneous temperate

grasslands using an SfM approach based on UAV imaging. Agronomy 2019;9(2):54.
8. Murphy DJ, Murphy MD, O’Brien B, O’Donovan MA. Review of precision technologies
for optimising pasture measurement on irish grassland. Agriculture 2021;(11):600.
https://doi.org/10.3390/agriculture11070600.
9. Nafus AM, McClaran MP, Archer SR, Throop HL. Multispecies allometric models predict
grass biomass in semidesert rangeland. Rangeland Ecol Management 2009;62(1):68-72.
10. Fernández HH. Estimación de la disponibilidad de pasto. Cuadernillo clásico de forrajeras

INTA, SAGPYA, Argentina. 2004;(98):9-12.
11. Tackenberg O. A new method for non-destructive measurement of biomass, growth rates,
vertical biomass distribution and dry matter content based on digital image analysis.
Ann Botany 2007;99(4):777-783.
13
12. Butterfield HS, Malmström CM. The effects of phenology on indirect measures of
aboveground biomass in annual grasses. Int J Remote Sensing 2009;30(12):3133-3146.
13. Andariese SW, Covington WW. Biomass estimation for four common grass species in
northern Arizona ponderosa pine. Rangeland Ecology Management/J Range
Management Archives 1986;39(5):472-473.
14. Harmoney KR, Moore KJ, George JR, Brummer EC, Russell JR. Determination of
pasture biomass using four indirect methods. Agronomy J 1997;89(4):665-672.
15. Damiran D, DelCurto T, Darambazar E, Clark AA, Kennedy PL, Taylor R. Visual
obstruction: weight technique for estimating production on northwestern bunchgrass
prairie rangelands. In: Proc Western Sec, Am Soc Anim Sci 2007;(58):225-228.
16. Chen Y, Guerschman J, Shendryk Y, Henry D, Harrison MT. Estimating pasture biomass
using sentinel-2 imagery and machine learning. Remote Sens 2021;(13):603.
17. Xu K, Su Y, Liu J, Hu T, Jin S, et al. Estimation of degraded grassland aboveground

biomass using machine learning methods from terrestrial laser scanning data. Ecological
Indicators 2020;(108):105747.
18. Viljanen N, Honkavaara E, Näsi R, Hakala T, Niemeläinen O, Kaivosoja J. A novel

machine learning method for estimating biomass of grass swards using a
photogrammetric canopy height model, images and vegetation indices captured by a
drone. Agriculture 2018;(8):70.
19- Marroquín-Castillo JJ, Alanís-Rodríguez E, Jiménez-Peréz J, Aguirre-Calderón O, Mata-

Balderas JM, Chavez-Costa AC. Composición florística y diversidad de un área
restaurada post-minería en el matorral espinoso tamaulipeco. Polibotánica 2016;42(1):1-
17.
20. Valdez C, Guzmán MA, Valdés A, Forougbakhch R, Alvarado MA, Rocha A. Estructura
y diversidad de la vegetación en un matorral espinoso prístino de Tamaulipas, México.
Rev Biología Trop 2018;66(4):1674-1682.
21. Pottier J, Jabot F. Non-destructive biomass estimation of herbaceous plant individuals: a

transferable method between contrasted environments. Ecological Indicators
2017;(72):769-776.
22. Mahood AL, Fleishman E, Balch JK, Fogarty F, Horning N, Leu M, et al. Cover-based
allometric estimate of aboveground biomass of a non-native, invasive annual grass
(Bromus tectorum L.) in the Great Basin, USA. J Arid Environ 2021;(193):104582.
14
23. Flombaum P, Sala OE. A non-destructive and rapid method to estimate biomass and
aboveground net primary production in arid environments. J Arid Environ
2007;69(2):352-358.
24. McDonald CJ, McPherson GR. Creating hotter fires in the Sonoran Desert: Buffelgrass
produces copious fuels and high fire temperatures. Fire Ecology 2013;39(4):26-39.
25. Sorensen GE, Wester DB, Rideout-Hanzak S. A nondestructive method to estimate

standing crop of purple threeawn and blue grama. Rangeland Ecol Management
2012;65(5):538-542.
26. INEGI. Instituto Nacional de Estadística y Geografía. Prontuario de información

geográfica municipal de los Estados Unidos Mexicanos Marín, Nuevo León. Clave
geoestadística 19034. México, 2009.
27. Oliveras I, Eynden M, Malhi Y, Cahuana N, Menor C, Zamora F, et al. Grass allometry
and estimation of above‐ground biomass in tropical alpine tussock grasslands. Austral
Ecol 2014;39(4):408-415.
28. González Y, Mendoza F. Determinación del momento óptimo de cosecha de las semillas
de Cenchrus ciliaris híbrido CIH-2. Pastos Forrajes 1996;19(1):59-64.
29. Martin MH, Cox JR, Ibarra FF. Climatic effects on buffelgrass productivity in the
Sonoran Desert. Rangeland Ecol Management/J Range Management Archives
1995;48(1): 60-63.
30. Johnson PS, Johnson CL, West NE. Estimation of phytomass for ungrazed crested
wheatgrass plants using allometric equations. Rangeland Ecol Management/J Range
Management Archives 1988;41(5):421-425.
31. Siller-Clavel P, Badano EI, Villarreal-Guerrero F, Prieto-Amparán JA, Pinedo-Álvarez,

et al. Distribution patterns of invasive buffelgrass (Cenchrus ciliaris) in Mexico
estimated with climate niche models under the current and future climate. Plants
2022;11(9):1160.
32. Barnetson J, Phinn S, Scarth P. Estimating plant pasture biomass and quality from UAV
imaging across Queensland’s Rangelands. Agri Engineering 2020;2(4):523-543.
33. Soto-Bravo F, González-Lutz MI. Análisis de métodos estadísticos para evaluar el

desempeño de modelos de simulación en cultivos hortícolas. Agronomía
Mesoamericana 2019;30(2):517-534.
34. Martınez DR, Albín JL, Cabaleiro JC, Pena TF, Rivera FF, Blanco V. El criterio de
información n de Akaike en la obtención n de Modelos Estadísticos de Rendimiento.
Conference: XX Jornadas de Paralelismo. Coruña, España. 2009;439-444.
15
35. Cavanaugh JE, Neath AA. The Akaike information criterion: Background, derivation,
properties, application, interpretation, and refinements. Wiley Interdisciplinary
Reviews: Computational Statistics 2019;11(3):e1460.
36. INIFAP (Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias). Ajuste

de carga animal en tierras de pastoreo, Manual de capacitación. Instituto Nacional de
Investigaciones Forestales, Agrícolas y Pecuarias Cuajimalpa. México. 2011.
37. Mills A, Smith M, Moot D. Relationships between dry matter yield and height of
rotationally grazed dryland lucerne. N Z Grasslands 2016;(78):185-196.
16
Article
Leaf area index and forage productivity indicators of Lotus corniculatus

L. at different soil moisture contents and seasons of the year
Aurelio Pedroza Sandoval a

Sahara Xolocotzi Acoltzi a*
Ricardo Trejo Calzada a
Gabino García de los Santos b
Perpetuo Álvarez Vázquez c
Jesús Guadalupe Arreola Ávila a
a
Universidad Autónoma Chapingo. Unidad Regional Universitaria de Zonas Áridas.
Carretera Gómez Palacio - Ciudad Juárez, km 40. 35230, Bermejillo, Durango, México.
b
Colegio de Postgraduados. Campus Montecillo. Estado de México, México.
c
Universidad Autónoma Agraria Antonio Narro. Coahuila, México.
*Corresponding author: xolocotzi18@gmail.com
Abstract:
The objective of the study was to evaluate the response of leaf area index and forage
productivity of Lotus corniculatus clover genotypes with two different soil moisture contents
under shade netting conditions. A randomized experimental block design in a split plot
arrangement with three replicates was used. The large plots were soil moisture contents:
optimum (OSMC: 26 % ± 1.5) and suboptimal (SSMC: 22 % ± 1.5); and the small plots were
L. corniculatus accessions: 255301, 255305, 202700, 226792, and the bird’s-foot trefoil
(Estanzuela Ganador) variety. The variables measured were leaf area index (LAI), dry matter
biomass production (DM) (g plant-1), dry forage increase rate (DFIR) (g plant-1 d-1), and leaf-
to-stem ratio (L/S), plus the climatic variables of temperature (°C) and relative moisture (%)
in the shade net. Accession 255305 was the best responder in LAI, DM, and DFIR, with
values of 3.2, 94.9 g plant-1, and 0.30 g plant-1 d-1, respectively, with OSMC; while the bird’s-
17
foot trefoil had the best response in LAI with SSMC. There were no differences (P≤0.05)
between the genetic materials evaluated in DM and DFIR, with average values of 82.4 g
plant-1 and 0.26 g plant-1 d-1, respectively. Accessions 255301 and 226792 were the best L/S
ratio with values of 2.9 and 2.5, respectively. In general, the best productive performance in
terms of DM was obtained in spring, summer, and summer-autumn, with values of 17.5, 11.7,
and 17.7 g plant-1, respectively.
Keywords: Livestock, Fodder clover, Stress physiology, Leaf area, Arid zones.
Introduction
In Mexico, 76.3 % of the water volume is used for agricultural and livestock activities(1). This
high-water consumption is related to poor water management and the establishment of crops
with high water requirements, which aggravates the problem of water scarcity in arid zones.
In these regions, droughts are becoming more frequent and more intense, and their effect is
causing economic losses in agrifood production, resulting in food shortages, reduced supply
of inputs for the industrial sector, and degradation of agroecosystems(2). In addition, climate
change has increased extreme temperature and rainfall events with a negative effect on the
various productive activities, among which forage production stands out(3). This economic
activity is of great importance in the country. The average national production amounts to 30
million 950 thousand tons(4), 26.7 % of which corresponds to the cultivation of alfalfa
(Medicago sativa L.), which is a crop with a high demand for water resources(5).
In the Comarca Lagunera of the states of Durango and Coahuila, Mexico, there is a serious
problem of water scarcity and overexploitation of the aquifer(1). In addition, the establishment
of agricultural crops with high water demand is common, having a negative impact from the
economic, social, and environmental point of view(6). This region is the country's main dairy
basin, and alfalfa is the main forage crop, established to feed 955,115 head of cattle in the
pasture(7). The traditional irrigation system for this crop generates a demand of approximately
2.0 m of irrigation sheet per year(8,9).
The high demand for agrifood products such as milk, the low availability of water resources,
and the use of forage crops with low water use efficiency make it imperative to explore ways
to make water use more efficient for production purposes in the agricultural sector. The use
of alternative crops to such traditional crops as alfalfa, which compete with these in quantity
18
and productive quality with less water requirements, is a viable option that can help mitigate
the problem of water scarcity, with the support of other techniques such as the use of
vegetative covers, which reduce the high evaporation rate(10).
Among the forage crops with potential in marginal agriculture conditions, various Lotus
species stand out, the main of which is L. corniculatus, used for its stress tolerance to different
adverse environmental factors as a way to improve forage production in several countries
with dry summers and marked seasonality effect. Certain reports indicate the absence in New
Zealand, Uruguay, and Chile of genetic materials of L. corniculatus, which have performed
well in response to water deficit conditions(11,12). There are a number of varieties and genetic
accessions of L. corniculatus that show high flexibility of adaptation to different
environments, such as tolerance to drought, flooding, acid soils, and high levels of Al and
Mn(13).
One of the properties of this perennial forage species is its high capacity for regrowth after
cutting or grazing, although the regeneration rate varies depending on the variety and the type
of stress due to extreme temperatures, soil moisture content, and physical-chemical and
fertility characteristics of the soil(14,15). The objective of this study was to evaluate the
response capacity in terms of leaf area and forage productivity of various accessions and a
variety of L. corniculatus with optimum and suboptimal soil moisture content under shade-
mesh conditions in northern Mexico.
Geographical location of the study area
The experiment was established in the experimental field of the Regional University Unit of
Arid Zones of the Autonomous University of Chapingo, in Bermejillo, Durango, Mexico,
located at the coordinates 25.8° N and 103.6° LW, at an altitude of 1,130 m asl. The region
has a dry desert climate with summer rains and cool winters, an average annual rainfall of
258 mm, an average annual evaporation of 2,000 mm, and an average annual temperature of
21 °C, with maximum temperatures of 33.7 °C and minimum temperatures of 7.5 °C (16).
Experimental design and management
A randomized block design in a split plot arrangement with three replications was used. The
large plots had two soil moisture contents —optimal OSMC (26 % ± 1.5) and suboptimal
SSMC (22 % ± 1.5)— established on the basis of the moisture abatement curve(17), according
to the regression equation obtained:
19
%𝑆𝑀 = 26.57 + 13.52x + 4.97X 2
Where: SM%= soil moisture content, and X is the negative energy stress in MPa, considering
that the field capacity (FC) and the permanent wilting point (PWP) correspond to an energy
stress of 0 and -1.5 MPa, respectively. The FC and PWP were calculated based on the above,
which were 26.5 % and 17.5 %, respectively. The small plots containing four accessions and
one variety of L. corniculatus from different regions (Table 1).
Table 1: Relationship, origin, and growth habit of Lotus corniculatus genetic materials
evaluated in the experiment
Code/ Name of Place of origin Growth habit
accessions/varieties
255301 France Semi-erect
255305- Italy Semi-erect
202700 Uruguay Erect
226792 Canada Semi-erect
Estanzuela Ganador Uruguay Erect
The experimental unit was one plant in each 20 kg rigid plastic pot 35 cm in diameter and
31.3 cm in height. Each pot was filled with 18 kg of a substrate mixture with a 50:30:20 ratio
of soil:compost:sand. The substrate had a sandy loam texture, with a proportion of 52 % sand,
26 % silt, and 22 % clay, and a pH of 8.69, an EC of 10.76 dS m-1, and a bulk density of 1.46
g cm-3. A digital ORIA thermometer/hygrometer placed inside the shade net recorded the
daily temperature (°C) and relative moisture (%) during the evaluation period.
Irrigation was applied every four days, and the soil moisture contents were measured by
gravimetry, for which purpose the weight of the pots in the OSMC was maintained at 23.9
kg, and that of SSMC, at 23.0 kg. An average of 0.6 L of water per irrigation was added to
both moisture contents, restoring the OSMC to 27.5 % and the SSMC to 23.5 % as upper
limits of soil moisture, and leaving both values to decrease to 24.5 % and 20.5 % as lower
limits, respectively. A margin of 3.5 % (20.5 - 17.5) was considered a usable moisture range
so that the plant did not reach PWP.
20
A total of seven fresh material cuts were made: the first one in July 2021 and the last one in
May 2022. They previously had an adaptation period of 60 d after transplanting, and a
standardization cut was made 45 d before the first cut. For the cuttings, growth periods were
considered according to the seasons and the intermediate periods: spring-summer (Sp-Su),
summer (Su), summer-autumn (Su-A), autumn (A), winter (W), winter-spring (W-Sp), and
spring (Sp). The time interval between cuts was 45 d, except for W, when it was extended to
90 d due to the slow growth of the plant due to the decrease in temperature.
Measured variables
The leaf area index was calculated. For this purpose, the leaf surface area was first determined
by randomly selecting 10 complete stems per plant at each cutting date; the leaves were then
separated from the stems and spread and photographed on a white paper surface; the
photographs were processed with ImageJ for each treatment and repetition according to the
experimental design. Subsequently, equation 1, adapted to the conditions of the experiment,
was used to obtain the leaf area index(18).
𝐿𝐴∗𝑁𝑆
𝐿𝐴𝐼 = --------------(1)
𝑇𝑆𝐴
Where: LA= leaf area of a stem (cm2); NS= number of stems, and TSA= total soil surface
area in cm2 (pot surface area= 962.11 cm2).
The leaves harvested at each cutting date per treatment were dried in a HAFO® (model 1600,
USA) forced-air oven at 60 °C for 24 h or until attaining a constant weight; the dry material
was weighed on a Shimadzu analytical balance (model AY220M), and the dry matter (DM)
production for each cutting was determined.
The dry fodder increase rate (DFIR) was estimated by dividing the dry weight of forage
harvested by the number of days of growth elapsed from one cutting period to the next, with
the following equation:
𝐴𝑚𝑜𝑢𝑛𝑡 𝑜𝑓 𝑓𝑜𝑑𝑑𝑒𝑟 (𝑔 𝑀𝑆 𝑝𝑙𝑎𝑛𝑡 −1 )

𝐷𝐹𝐼𝑅 = -------------(2)
𝐷𝑎𝑦𝑠 𝑜𝑓 𝑔𝑟𝑜𝑤𝑡ℎ 𝑒𝑙𝑎𝑝𝑠𝑒𝑑
The leaf/stem ratio (L/S) was obtained from a representative subsample of 10 stems from
each treatment, for which purpose the leaf and stem components were separated and placed
separately in a HAFO® (model 1600, USA) forced-air oven at 60 °C for 24 h. Subsequently,
the leaf/stem ratio was calculated as the quotient between the leaf dry weight (g DM) and the
stem dry weight (g DM).
21
Data analysis
The Statistical Analysis System software(19) was utilized to process the database, performing
an analysis of variance and a Tukey multiple range test (P≤0.05) to identify the effect of each
treatment effect. In addition, Excel version 6.0 was used for regression analysis.
Results and discussion
Temperature and relative humidity
During the period from June 2021 to May 2022, a mean maximum temperature of 30 °C and
mean minimum of 20 °C, as well as a maximum of 46.9 °C and minimum of -4.6 °C, were
recorded inside the shade net (Figure 1), with mean and maximum temperatures per day of
16.6 to 40.1, 19.8 to 32.7, 9.8 to 37 and 4.5 to 30 °C during the spring, summer, fall and
winter seasons, respectively. The average relative moisture recorded ranged between 44 and
73 %, with a minimum of 5-10 % in the months of May through July , and a maximum of
100 % during the rainy season, in July, August and September, with a regional historical
annual average rainfall of 258 mm(16). In order to avoid alterations of the soil moisture content
in the pots due to the effect of rain, the experimental area occupied by the pots was covered
with plastic during these periods.
22
Figure 1: Maximum, and minimum temperatures and monthly relative moisture (RM)
recorded during the evaluation of various genetic materials of L. corniculatus under shade-
mesh conditions from July 2021 to May 2022 in Bermejillo, Dgo.
50.0 80
Relative moisture (%)

70
Temperature (°C)
40.0
60
30.0 50
20.0 40
10.0 30
20
0.0 10
-10.0 0
JUN
AUG
OCT
DEC
JAN
MAR
APR
JUL
NOV
MAY
SEP
FEB
Months
RM Min temp Max temp
Leaf area index
The leaf area index (LAI) was significantly higher (P≤0.05) in accession 255305 at OSMC,
with a value of 4.7, followed in importance by accession 255301 and the bird’s-foot trefoil
variety, with values of 4.1 and 3.7, respectively. In SSMC, the bird’s-foot trefoil variety stood
out with 3.9 and was followed in importance by the other accessions, except for 226792,
which registered the lowest value of 2.6 (Table 2). The leaf surface area achieved by a plant
during its development defines the capacity of the plant canopy to intercept
photosynthetically active radiation, the primary source for the proper development of organs
and tissues(20). According to these results, the LAI in general was slightly negatively affected
by the suboptimal soil moisture condition, although the bird’s-foot trefoil variety showed an
above-average performance of the LAI attained under optimal soil moisture conditions.
Dry matter production
The DM production was higher with an optimal soil moisture content, amounting to an
average of 98 g plant-1, compared to the suboptimal content (SSMC), which recorded an
average of 82 g plant-1 without statistical difference (P≤0.05) between the genetic materials
tested in this study; while with an OSMC, accession 255305 had the best response, with 131.8
g plant-1 (Table 2). The above suggests that biomass productivity is directly dependent on
the soil moisture content, and all the genetic materials of L. corniculatus are negatively
23
affected to the same degree by a suboptimal soil moisture content. These results differ from
those reported in a clover adaptability study in which 12 materials were evaluated under
temperate field conditions(8), where accession 202700 and the bird’s-foot trefoil variety were
reportedly the most productive, possibly due to the environmental conditions of temperature,
ranging between 5 and 32 °C, which are more favorable for this crop
Dry fodder increase rate
The dry fodder increase rate (DFIR) was consistent with the results shown for DM, with a
statistical difference (P≤0.05) in the OSMC plot corresponding to accession 255305 as the
most outstanding, with a DFIR of 0.43 g plant-1 d-1 and no statistical difference between the
rest of the genetic materials evaluated. Whereas the SSMC plot had the lowest values, of 0.26
g plant-1 d-1 in average, with no statistical difference between the evaluated accessions and
varieties (Table 2). Both the yield and the biomass accumulation of different forage crops
develop dynamically(21) due to the formation of new tissue, which is highly influenced by
environmental and management conditions, mainly by the temperature and water
availability(22).
Leaf/stem ratio
The leaf-to-stem ratio (L/S) was similar in both moisture contents, with average values of 2.3
and 2.2 in OSMC and SSMC, respectively, with statistical difference between genetic
materials in both cases. Accession 255301 excelled in OSMC with an L/S of 2.9 and 226792
in SSMC with a value of 2.5 (Table 2). The results suggest that, in this variable, the genetic
materials are not affected when going from an optimal soil moisture condition to a suboptimal
one, which makes it possible to save water, without significantly affecting this productivity
indicator. It is desirable that this value be as high as possible, as it is determined by the leaf
component; this organ is the most digestible part of the forage and has the highest protein
content —much higher than the other organs of the plant— and therefore has the highest
nutritional value(23). The L/S results obtained for accessions 255305, 202700 and 226792 at
both soil moisture contents were similar to those obtained in a temperate region of Mexico(8)
where values of 2.4, 1.7 and 2.3, respectively, were reported. Additionally, the values
obtained in accession 255301 and bird’s-foot trefoil were higher than those obtained in the
aforementioned studies, which reported a ratio of 2.0 and 1.5, compared to the 2.9 and 1.9
obtained in the present study in OSMC. This is relevant, given that the study was carried out
in a hot dry climate where, even under a shading mesh, extreme weather events occurred that
are regarded as very unfavorable conditions compared to the cold temperate climates from
which most of the genetic materials in this study originate.
24
Table 2: Leaf area index and productivity indicators of L. corniculatus accessions/variety

under optimal and suboptimal soil moisture contents
DM DFIR
Accession/ LAI L/S
(g plant-1) (g plant-1 d-1)
variety
OSMC SSMC OSMC SSMC OSMC SSMC OSMC SSMC
255301 4.1ab 3.0ab 98.8b 74.5a 0.32b 0.24a 2.9a 2.2ab
255305 4.7a 3.3ab 131.8a 85.7a 0.43a 0.27a 2.4ab 2.3ab
202700 3.0b 3.6ab 89.3b 94.9a 0.29b 0.30a 1.7b 1.7b
226792 2.7b 2.6b 79.5b 79.3a 0.25b 0.26a 2.5ab 2.5a
Bird’s-foot 90.7b 78.4a

3.7ab 3.9a 0.28b 0.24a 1.9b 2.2ab
trefoil
Mean 3.6 3.3 98.0 82.4 0.32 0.26 2.3 2.2

OSMC= optimum soil moisture content (26 % ± 1.5); SSMC= suboptimal soil moisture content (22 % ± 1.5);
LAI= leaf area index; DM= dry matter; DFIR= dry fodder increase rate; L/S= leaf/stem ratio.
ab
Figures with the same letters within the same column are considered equal (P>0.05).
Seasonal dynamics of production indicators
In general, the seasonal behavior of L. corniculatus exhibited variations in terms of the

variables LAI, DM, and DFIR, which were higher during spring, summer and summer-
autumn —particularly DM— with a production of 17.5, 11.7, and 17.7 g plant-1, respectively,
and a drastic decrease during the winter season (Figure 2A, 2B and 2C); while the L/S
remained stable throughout the evaluation period (Figure 2D).
25
Figure 2: Seasonal dynamics of: A) Leaf area index (LAI); B) Dry matter (DM); C) Dry
fodder increase rate (DFIR), and D) Leaf-to-stem (L/S) ratio of L. corniculatus in different
seasons of the year with optimal (OSMC) and suboptimal (SSMC) soil moisture contents,
during the June 2021 to May 2022 period
8 25
A) B)
DM (g plant-1)
6 20
15
LAI
4
10
2 5
0 0
S-S S S-A A W W-S S S-S S S-A A W W-S S
DFIR (g DM plant-1 day-1)
0.6 3.5
C) D)
0.5 3
0.4 L/S 2.5
0.3 2
0.2 1.5
0.1 1
0 0.5
S-S S S-A A W W-S S S-S S S-A A W W-S S
Seasons time Seasons time
OSMC SSMC OSMC SSMC
The LAI showed the highest values in the spring, summer and summer-autumn periods,
standing out in the OSMC plot during the summer, and then exhibiting an even behavior
between the two soil moisture contents (OSMC and SSMC) in the rest of the year (Figure
2A). A similar behavior was observed for DM (Figure 2B) and DFIR (Figure 2C). L/S
showed less variation by soil moisture content during the entire evaluation period (Figure
2C). These results coincide with the seasonal behavior of the temperature, which increases
with the beginning of spring and reaches its highest values during the summer, being related
to a higher incidence of solar radiation, with the consequent increase in the photosynthetic
rate, and then begins to decrease in autumn, due to the beginning of the decrease in
temperature(24). Higher LAI values translate into higher biomass production(25).
The productivity results obtained coincide with those obtained in a temperate region of
Mexico(26), where the highest yields were obtained in spring and the lowest in autumn;
however, they do not coincide with the production obtained in summer, which registered the
highest values in the present study. This response behavior suggests that it is related to the
26
higher temperature regime, with an average of 22 °C, which favors the growth and
development of L. corniculatus(8). Although there was a decrease in forage production in the
winter period, the DM production increased again in spring, which proves the tolerance of
the plants to low temperatures, down to -4 °C, and their ability to recover after the thermal
stress(27).
Knowledge of L. corniculatus forage accumulation per day and its seasonal influence will
allow future estimates of forage yield and persistence during the aforementioned periods of
the year and will make it possible to establish different management and utilization strategies
under field conditions. In this case, the highest DFIR was obtained in the spring, summer and
autumn periods for both soil moisture contents, where OSMC exhibited the highest value, of
0.53 g plant-1 d-1.
The response obtained for the L/S variable was most stable between cutting periods in the
plots with the two established moisture contents, showing differences only in spring-summer,
when the ratio was higher in the OSMC plot (2.8) and in the SSMC plot (2.6), followed by
the winter and spring periods. This behavior is similar to that observed in a temperate
region(26), where the highest L/S values were observed in winter and autumn, followed by
spring and summer, with values of 2.4, 2.7, 2.0 and 2.1, respectively. This indicator shows
that there are no differences between the genetic materials evaluated for the same
phenological stage(28). Based on this characteristic, it is possible to implement a sequence of
forage utilization in future clover farms for the purpose of improving the production and
nutritional quality of the plants(29,30).
The best productive behavior of the evaluated accessions and varieties of the L. corniculatus
clover was observed in the spring, summer and summer-autumn seasons; accession 255305
stood out for its leaf area index, dry matter production, and dry fodder increase rate under
optimal soil moisture conditions (26 °C ± 1.5), while the bird’s-foot trefoil variety exhibited
a better leaf area index under water deficit conditions. The evaluation of the genetic materials
of L. corniculatus based on such variables as leaf area index and production indicators will
allow the selection of those with the greatest potential for adaptability as an alternative forage
crop in environmental conditions of extreme temperatures and water deficit like those that
are prevalent in the arid zones of northern Mexico.
Acknowledgments and conflict of interest
The authors are grateful to the National Council for Humanities Science and Technology
(Consejo Nacional de Humanidades Ciencias y Tecnologías, CONAHCyT) for the support
27
provided to Sahara Xolocotzi Acoltzi for her Master’s thesis; to the Postgraduate College
(Colegio de Posgraduados) for the donation of the genetic materials used in the study, and to
the General Direction of Graduate Studies of the Autonomous University of Chapingo
(Universidad Autónoma Chapingo) for the financial support provided through the strategic
institutional project with the code number 20017-EI.
The authors declare that they have no conflict of interest.
Literature cited:
1. CONAGUA. Comisión Nacional del Agua. Estadísticas del agua en México. 2018.
https://sina.conagua.gob.mx/publicaciones/EAM_2018.pdf .
2. Lobato SR, Mejía EPI. Perspectivas de la sequía actual en México. Perspectivas IMTA
2021;16: 1-3. https://www.imta.gob.mx/gobmx/DOI/perspectivas/2021/b-imta-
perspectivas-2021-16.pdf .
3. Castillo A. Generación de híbridos interespecíficos de L. uliginosus x L. corniculatus y

evaluación de la respuesta a déficit hídrico [tesis doctorado]. Uruguay; Universidad de
la República de Uruguay; 2012.
https://www.colibri.udelar.edu.uy/jspui/bitstream/20.500.12008/3933/1/uy24-
16039.pdf.
4. SIAP. Servicio de Información Agroalimentaria y Pesquera. Alfalfa verde, producción y

comercio exterior. México. 2018. https://www.gob.mx/siap/articulos/alfalfa-verde-
produccion-y-comercio-exterior.
5. SIAP. Servicio de Información Agroalimentaria y Pesquera. Panorama Agroalimentario

2022. 2022. https://online.pubhtml5.com/aheiy/gryd/#p=1.
6. Ramírez BBA, González EA, Salas GJM, García SJA. Tarifas eficientes para el agua de
uso agrícola en la Comarca Lagunera. Rev Mex Cienc Agríc 2019;10(3):539-550.
http://doi.org/10.29312/remexca.v10i3.1295.
7. SIAP. Servicio de Información Agroalimentaria y Pesquera. Bovino para leche, población

ganadera. 2021.
https://www.gob.mx/cms/uploads/attachment/file/744951/Inventario_2021_bovinos_c
arne_y_leche.pdf .
8. García BDV, Guerrero RJD, García SG, Lagunes RSA. Rendimiento y calidad de forraje
de genotipos de Lotus corniculatus L., en el Estado de México. Nov Sci 2014; 7(1):170-
189. https://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S2007-
07052015000100010.
28
9. Reta SDG, Castellanos GPC, Olague RJ, Quiroga GHM., Serrato CJS, Gaytán MA.
Potencial forrajero de cuatro especies leguminosas en el ciclo de verano en la Comarca
Lagunera. Rev Mex Cienc Agríc 2013;4(5):659-671.
10. Bacarrillo-López R, Pedroza-Sandoval A, Inzunza-Ibarra MA, Flores-Hernández A,

Macías-Rodríguez FJ. Productividad de forraje de variedades de nopal (Opuntia spp.)
bajo diferentes regímenes de humedad del suelo. Ecosist Recur Agropec 2021;8(3):1-
10. http://doi.org/10.19136/era.a8n3.2878.
11. PROCISUR. Programa Cooperativo para el Desarrollo Tecnológico Agroalimentario y

Agroindustrial del Cono Sur. LOTASSA: Un puente entre la genómica y las pasturas
del siglo XXI. Instituto Interamericano de Cooperación para la Agricultura. 2010.
https://repositorio.iica.int/handle/11324/6573.
12. Barry TN, Kemp PD, Ramírez-Restrepo CA, López-Villalobos N. Sheep production and
agronomic performance of Lotus corniculatus under dryland farming. NZGA: Research
and Practice Series 2003;(11):109-115. http://doi.org/10.33584/rps.11.2003.3003.
13. Guillen R, Widdup K. Program of improvement in Lotus corniculatus L.: Base

Germplasm characterization. Lotus Newsletter 2008;(38):1-67.
http://www.inia.org.uy/sitios/lnl/vol382/guillen1.pdf .
14. Varón LES. Fitometabolitos secundarios que inciden en el valor nutricional de Lotus
corniculatus como forraje para rumiantes. Rev Investig Agrar Ambient 2014;5(1):131-
146. https://doi.org/10.22490/21456453.938.
15. Difante DSG, Do Nacimento JD, Batista-Euclides VP, Da Silva SC, Barbosa AR,
Concalves VW. Sward structure and nutritive value of tanzania guineagrass subjected
to rotational stocking managements. Rev Bras de Zoot 2009;38(1):9-19.
http://doi.org/10.1590/S1516-35982009000100002.
16. Medina GG, Díaz PG, López HJ, Ruíz CJA, Marín SM. Estadísticas climatológicas
básicas del estado de Durango (Periodo 1961 – 2003). Libro Técnico № 1. Campo
Experimental Valle del Guadiana. CIRNOC-INIFAP. 2005.
17. Richards LA. Porous plate apparatus for measuring moisture retention and transmission
by soil. Soil Sci 1948;(66):105-110.
18. Reis LS, de Acevedo CAV, Albuquerque AW, Junior JFS. Índice de área foliar e
produtividade do tomate sob condicoes de ambiente protegido. Rev Bras Eng Agr Amb
2013;17(4):386-391. https://doi.org/10.1590/S1415-43662013000400005.
19. SAS, Institute. SAS/STAT® 9.2. Use’s Guide Release. Cary, NC: SAS Institute Inc.
USA. 2009.
29
20. Warnock R, Valenzuela J, Trujillo A, Madriz P, Gutiérrez M. Área foliar, componentes

del área foliar y rendimiento de seis genotipos de caraota. Agr Trop 2006;56(1):21-42.
http://ve.scielo.org/scielo.php?script=sci_arttext&pid=S0002-192X2006000100002.
21. Valentine I, Matthew C. Plant growth, development and yield. In: White J, Hodgson J
editors. New Zealand Pasture and Crop Science. Auckland, New Zealand; Ed. Oxford
University Press; 1999:11-27.
22. Ramírez RO, Hernández GA, Cerneiro da Silva S, Pérez PJ, Enríquez QJF, Quero CAR,
Herrera HJG, Cervantes NA. Acumulación de forraje, crecimiento y características
estructurales del pasto Mombaza (Panicum maximum Jacq.) cosechado a diferentes
intervalos de corte. Téc Pecu Méx 2009;47(2):203-213.
https://www.redalyc.org/articulo.oa?id=61312116008.
23. Lamb JF, Jung HJG, Sheaffer CC, Samac DA. Alfalfa leaf protein and stem cell wall
polysaccharide yields under hay and biomass management systems. Crop Sci
2007;47(4):1407-1415. http://doi.org/10.2135/cropsci2006.10.0665.
24. Caron B, Sgarbossa J, Schwerz F, Elli EF, Elder E, Behling A. Dynamics of solar
radiation and soybean yield in agroforestry systems. Ann Acad Bras Cienc
2018;90(4):3799-3812. http://dx.doi.org/10.1590/0001-3765201820180282.
25. Escalante EJA. Área foliar, senescencia y rendimiento del girasol de humedad residual
en función del nitrógeno. Terra Latinoamericana. 1999;17(2):149-157.
https://www.redalyc.org/articulo.oa?id=57317208.
26. Álvarez VP, García SG, Guerrero RJ, Mendoza PSI, Ortega CM, Hernández GA.
Comportamiento productivo de Lotus corniculatus L. dependiente de la estrategia de
cosecha. Agrociencia 2018;52(8):1081-1093.
https://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S1405-
31952018000801081.
27. Sbrissia AF, Da Silva SC, Sarmento DOL, Molan LK, Andrade FME, Goncalves AC,
Lupinacci AV. Tillering dynamics in palisadegrass swards continuously stocked by
cattle. Plant Ecol 2010;(206):349-359.
https://link.springer.com/article/10.1007/s11258-009-9647-7.
28. Araya MM, Boschini FC. Producción de forraje y calidad nutricional de variedades de
Pennisetum purpureum en la meseta central de Costa Rica. Agron Mesoam
2005;16(1):37-43. http://www.mag.go.cr/rev_meso/v16n01_037.pdf.
30
29. Beltrán SI, Hernández AG, García EM, Pérez PJ, Kohashi JS, Herrera JG, Quero AR,
González SS. Efecto de la altura y frecuencia de corte en el crecimiento y rendimiento
de pasto Buffel (Cenchrus ciliaris) en un invernadero. Agrociencia 2005;39(2):137-147.
https://agrociencia-colpos.org/index.php/agrociencia/article/view/377.
30. Cruz HA, Hernández GA, Enríquez QJF, Gómez VA, Ortega JE, Maldonado GNM.
Producción de forraje y composición morfológica del Pasto Mulato (Brachiaria híbrida
36061) sometido a diferentes regímenes de pastoreo. Rev Mex Cienc Pecu
2011;2(4):429-443.
https://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S2007-
11242011000400007&lng=es&tlng= .
31
Article
Microsilages elephant grass BRS Capiaçu added with commercial

microbial consortium on different days of regrowth
Allan Stênio da Silva Santos a
Daniel Louçana da Costa Araújo a
Ivone Rodrigues da Silva a*
Matheus Sousa Araújo a
Arnaud Azevêdo Alves a
Henrique Nunes Parente b
Maria Elizabete de Oliveira a
João Batista Lopes a
a
Federal University of Piaui, Teresina, Piauí, Brazil.
b
Federal University of Maranhão, Chapadinha, Maranhão, Brazil.
*Corresponding author: ivonezootecnista@gmail.com
Abstract:
This study aimed to evaluate whether bacterial inoculation improves the fermentative,
microbiological, and chemical characteristics of silages of the elephant grass cv. BRS
Capiaçu on different regrowth days. The experimental design was completely randomized
and set up in a 3x2 factorial arrangement (three regrowth days, with and without
inoculant), with four replications. There was a significant interaction between the
regrowth days and inoculant on the pH, ammoniacal nitrogen (N-NH3), and effluent
losses (EL) of the silages. Inoculation decreased the EL with the advance of regrowth
days and increased the dry matter recovery index compared to the silages without
inoculant. The population of molds and yeasts decreased when inoculation was adopted
to the forage harvested after 85 d. There was a significant interaction between the dry
matter (DM), crude protein (CP) and neutral detergent fiber corrected for ash and protein
32
(NDFap) contents of the silages. Inoculation in the grass harvested after 85 d increased
the DM contents of the silage. The highest CP contents were observed in the silages after
85 d. The NDFap contents of the grasses harvested after 110 and 135 d were higher than
those of the grass harvested after 85 d. The NDFap contents of the silages without
inoculant increased with the harvest age. The BRS Capiaçu forage silage harvested at 110
d demonstrated favorable performance for silage production. However, the influence of
inoculant use was low for the characteristics evaluated.
Keywords: Biological inputs, Pennisetum purpureum, Quality.
Introduction
Elephant grass (Pennisetum purpureum Schum) stands out among the tropical grasses
used for silage due to its high production capacity, nutritive value, adaptability to the local
edaphoclimatic conditions, number of varieties, easy cultivation, and high acceptability
by animals (1).
The low soluble solids and dry matter contents associated with the high buffering power
of this grass negatively influence the fermentation process during ensilage and cause
losses that compromise silage quality(2). From this perspective, new cultivars have been
developed to improve the characteristics of elephant grass, e.g., the cultivar BRS Capiaçu.
Released in 2016 by Embrapa Gado de Leite, the cultivar BRS Capiaçu has stood out due
to its high dry matter yield (72t ha-1 yr-1), producing about 30 % more forage mass (300t
MV ha-1 yr-1), showing more soluble carbohydrates and crude protein contents in relation
to other elephant grass cultivars, and being a less expensive alternative than maize as a
perennial crop that does not require annual seed purchase(3,4,5).
Biological inputs are widely used as bacterial inoculants in the ensilage of elephant grass
to improve the population of lactic acid bacteria, which decrease the pH and intensify
fermentation, thus reducing losses caused by undesirable microorganisms and increasing
the nutrient quality of silages(6,7,8).
Furthermore, the harvest age of elephant grass during ensilage influences the
development of microbial populations since the low moisture content and the high
concentration of soluble carbohydrates are necessary for the development of lactic acid
33
bacteria(9,10). Therefore, balancing forage production and quality is essential to producing

BRS Capiaçu grass silages.
As a forage recently released on the market, studies on the cultivar BRS Capiaçu,
especially for its use as silage, are still required to provide appropriate conditions for
fermentation. In this scenario, this study aimed to identify whether bacterial inoculation
improves the fermentative, microbiological, and chemical characteristics of the silage of
the elephant grass (Pennisetum purpureum Schum.) cultivar BRS Capiaçu on different
regrowth days.
Treatments and ensilage management
The experiment was conducted in Teresina, Piauí, Brazil (latitude: 5o 2’28.41 S,

longitude: 42o 47’0.08 W, at an elevation of 67 m asl.) from March 2019 to March 2021.
The elephant grass (Pennisetum purpureum Schum) used in the experiment was subjected
to manual uniformization at a mean height of 10 cm from the ground, followed by
fertilization with 50 kg of N ha-1, 60 kg of K2O ha-1, and 60 kg of P2O5 supplied as urea,
potassium chloride, and single superphosphate, respectively. Except for phosphate
fertilization, all other nutrients were resupplied after 47 d according to soil analysis and
the recommendations of Embrapa (2008). The grass was irrigated daily using a micro-
sprinkler system from March to June 2019.
A completely randomized design was set up in a 2x3 factorial arrangement. The

treatments corresponded to the bacterial inoculant combinations and the grass regrowth
days, identified as follows: Factor 1) Bacterial inoculation when ensilage: presence and
absence of inoculant; Factor 2) Days of grass regrowth: 85, 110, and 135 d. Based on this
arrangement, six treatments were generated, and each was evaluated with four
replications, totaling twenty-four experimental units.
The forage was harvested after 85, 110 and 135 d of regrowth from an area of 60 m2
already established, delimiting 20 m2 for each evaluated age. The plants were cut
manually, with a cleaver, at a height of 10 cm from the ground and chopped into fragments
of 1 to 2 cm, in a stationary shredder. After this process, chopped forage was manually
homogenized with the silage additive according to each treatment and placed in plastic
trays.
The lyophilized bacterial inoculant SILOTRATO® was applied during the ensilage of the
BRS Capiaçu grass following the recommendations of the manufacturer (two grams per
34
ton of green mass), such as ensuring product quality until the expiration date, exclusive
use for animal feed and non-toxicity. The bacterial inoculant was composed of various
homofermentative lactic acid bacteria, facultative homofermentative bacteria, and
facultative heterofermentative bacteria, and 5 % of an enzyme complex with a count limit
of 1010 CFU.g-1, according to each harvest age and control treatment (without inoculant
application).
Cylindrical experimental silos made of polyvinyl chloride (PVC) were used in the assays,
each measuring 50 cm in length and 10 cm in width. Each silo received 1.3 kg of dry
sand, which was separated from the forage by a shading screen to allow quantifying the
effluent produced.
After complete homogenization, the grass was deposited in the silos and compacted with
the aid of a wooden piston by adopting a density of 600 kg m-3 of natural matter per silo.
After being filled, the silos were closed with tap covers containing Bunsen valves, sealed
with adhesive tape, and weighed. Then, the silos were stored at ambient temperature and
opened 83 d after ensilage.
Fermentative losses and dry matter recovery index
The dry matter losses through gas and effluent and the dry matter recovery index (DMRI)
were quantified by the weight difference according to the equations described by Schmidt
et al(11). The gas losses were obtained according to equation 1:
PG = [(PsChf − PsCha)/(MVFE × MSFE)] × 100 (1)
where: PG= gas losses, PsChf= filled silo weight at the beginning of ensilage (kg),
PsCha= filled silo weight at the end of ensilage (kg), MVFE = ensiled forage fresh matter
(kg), MSFE= ensiled forage dry matter (%) discounting the weight of the sand added to
the silo.
The effluent losses were obtained by equation 2:
EL (kg/t of MV) = [(PVf − Ts) − (PVi − Ts)]/MFi × 100 (2)
where: EL= effluent losses, PVf= empty silo weight + sand weight at the end of ensilage
(kg), Ts= silo tare, PVi= empty silo weight + sand weight at the beginning of ensilage
(kg), MFi= forage mass at the beginning of ensilage (kg).
The dry matter recovery rate was estimated using equation 3:
DMRI(%) = (MFf × MSf)/(MFi × MSi) × 100 (3)
35
where: DMRI= dry matter recovery index (%), MFf= forage matter at the end of ensilage
(kg), MSf= dry matter at the end of ensilage (%DM), MFi= forage matter at the beginning
of ensilage (kg), MSi = forage dry matter content at the beginning of ensilage (%DM).
pH and ammoniacal nitrogen
Before ensilage, the chemical composition of the BRS Capiacu grass was analyzed at
each harvest age (Table 1).
Table 1: Chemical composition of the BRS Capiaçu grass at different harvest ages
Item Regrowth ages (days)
85 110 135
DM 16.8 21.9 26.0
OM 91.0 92.1 91.9
ASH 9.0 7.9 8.1
CP 6.1 5.4 3.9
EE 1.3 1.3 1.6
NDFap 72.9 71.8 71.0
ADF 52.8 56.5 51.6
NFC 10.7 14.6 15.4
HEM 20.1 15.3 19.4
DM= dry matter, OM= organic matter, ASH= ashes; CP= crude protein, EE= ether extract,
NDFap= neutral detergent fiber corrected for ash and protein, ADF= acid detergent fiber, NFC=
non-fiber carbohydrates, HEM= hemicellulose.
When the silos were opened, the samples were separated and split into three aliquots, the
first of which was used fresh soon after homogenization to determine the pH according
to Silva and Queiroz(12). The ammoniacal nitrogen (N-NH3) was determined according to
Ferreira et al(13) based on the silage extract.
Chemical composition
After thawing, the second aliquot was pre-dried in a forced-air oven at 55 °C and ground
to pass through a 1 mm sieve in a Wiley knife mill. The subsamples were analyzed for
dry matter (DM; method 934.01), ash (method 942.05), crude protein (CP; method
978.04), and ether extract (EE; method 920.39) according to AOAC(14). Neutral detergent
fiber corrected for ash and protein (NDFap), acid detergent fiber (ADF) and hemicellulose
36
were determined by the sequential method according to the procedures described by Van
Soest et al(15) adapted for autoclave (0.5 atm/1h) using TNT bags with a porosity of 100
µm(16).
Microbiological profile
The third aliquot was used to evaluate the microbiological profile of the silages by
quantifying the microbial populations of Lactobacillus sp., Clostridium sp., filamentous
fungi, and yeasts. The entire microorganism analysis was performed in a laminar flow
cabinet.
The microbial populations in the silage were quantified by preparing an aqueous

suspension with a fresh silage sample (25g) in 225 mL of peptone water, which was
manually homogenized for three minutes. After homogenization, decimal dilutions were
prepared in sterile tubes containing 9 mL of the solution and then sown in duplicate in
sterile Petri dishes at dilutions of 10-1, 10-2, and 10-3. The count of Lactobacillus was
performed by adding 20 mL of MRS agar to the plates (Lactobacillus MRS agar). After
homogenization and solidification of the culture medium, 10 mL of the same agar was
added to form the overlayer. The dishes were then incubated at 35 ± 2 °C for 72 h in a
bacteriological incubator.
The bacterial count of the genus Clostridium was performed by adding 20 mL of

Clostridium perfringens agar and a 0.85 % egg yolk/saline emulsion at a proportion of
1:1 in the Petri dishes. Then, the inoculation was performed with 0.1 mL of the
corresponding dilutions. Subsequently, 10 mL of the same agar was added to form the
overlayer. Finally, the dishes were incubated at 35 ± 2 °C in anaerobiosis for 48 h in a
bacteriological incubator. The filamentous fungi and yeasts were counted by adding 20
mL of Potato Dextrose Agar (PDA) with 10 % tartaric acid in the Petri dishes. After the
culture medium solidified, 0.1 mL of the corresponding dilutions was added to the dishes,
which were then incubated at 37 ± 2 °C for 120 h in a bacteriological incubator. The
microorganisms were counted after incubation, and the results were expressed as log
CFU g-1(17).
Statistical analysis
The data referring to fermentative losses, chemical composition, and the microbiological
profile were analyzed using the least squares method, by the GLM procedure, and by
performing the analysis of variance and the SNK means comparison test through the
37
PROC NLIN procedure of the SAS software (Statistical Analysis System, version 9.0) at
a significance level of 0.05.
The statistical model used was as follows:
Yijk=µ+αi+βj+(α*βij)+eijk (4)
where:
Yijk= dependent variable,
µ= overall mean,
αi= inoculation effect (fixed effect; i = presence and absence when ensilage), βj = effect
of the grass regrowth days (fixed effect; j = 85, 110, and 135 d),
α*βij= effect of the interaction between the bacterial inoculant and the grass regrowth
days,
eijk= random error associated with each observation.
Results
There was a significant interaction (P<0.05) between the regrowth days and inoculation
on the fermentative characteristics of pH, ammoniacal nitrogen (N-NH3), and effluent
losses (EL) of the BRS Capiaçu grass silage (Table 2). The silage harvested after 85 d
showed the lowest (P<0.05) pH (3.5), which increased to 3.79 when the inoculant was
applied, an effect observed only for the silage of the forage harvested at the shortest age
(85 d). The silage harvested after 135 d showed the lowest (P<0.05) N-NH3 content
(1.50 %) in relation to the forages harvested after 85 and 135 d.
No difference was observed in the N-NH3 values of the silages regarding inoculation
(P>0.05), with a mean of 1.95 % N-NH3. Regarding the losses of ensiled mass, the
effluent losses (EL) of the BRS Capiaçu grass silages were, on average, 145.53 kg t-1.
However, when the inoculant was applied to the forage harvested at 135 d, the effluent
losses decreased.
38
Table 2: Fermentative characteristics of BRS Capiaçu grass silages at different harvest ages and bacterial inoculation
Harvest ages (days) P-value
Item Inoculant Mean SEM Inoculant x
85 110 135 Inoculant Harvest age
harvest age
With 3.79Ab 4.23Aa 4.26Aa 4.10
pH 0.07 0.4002 <0.0001 0.0095
Without 3.50Bc 4.49Aa 4.13Ab 4.04
Mean 3.65 4.20 4.36
With 1.97Aa 2.17Aa 1.72Aa 1.95
NH3-N, % TN 0.08 0.5128 0.0005 0.0327
Without 2.50Aa 2.10Aa 1.50Ab 2.03
Mean 2.23 2.13 1.61
With 165.14Aa 154.46Ab 93.58Bc 137.73
Effluent losses, kg t-1 5.42 0.1753 <0.0001 0.0014
Without 150.95Aa 150.44Aa 135.19Aa 145.53
Mean 158.04 152.45 114.39
With 2.48 0.41 0.44 1.11A
Gas losses, % of DM 0.18 0.8266 0.0025 0.5000
Without 1.83 0.85 0.40 1.03A
Mean 2.16a 0.63b 0.42b
With 73.99 89.12 87.29 83.47A
Dry matter recovery, % of DM 2.18 0.5732 <0.0001 0.1143
Without 75.14 83.60 89.09 82.61A
Mean 74.57b 86.36a 88.19a
SEM= standard error of the mean.
Means followed by the same lowercase letter in the row and uppercase letter in the column do not differ by the SNK test at a 5% significance level.
39
The gas losses (PG) were higher (P<0.05) in the BRS Capiaçu grass silage harvested after
85 d (2.16 %), whereas inoculation did not reduce (P>0.05) this parameter. The highest
DMRI (P>0.05) was obtained in the silages of the forages harvested after 110 and 135 d,
15.08 % higher than the DMRI of the forage harvested after 85 d (Table 2).
The population of lactic acid bacteria (LAB) was higher (P<0.05) in the silage of the BRS
Capiaçu grass forage harvested after 85 and 110 d (5.9 log10 CFU g-1). However,
inoculation did not decrease (>0.05) the population of LAB (Table 3).
There was significant interaction (P<0.05) of the regrowth days and inoculation on the
population of molds and yeasts of the BRS Capiaçu grass silage. The population of molds
and yeasts was, on average, 4.0 log10 CFU g-1. However, when the inoculant was applied
to the forage, the concentration of molds and yeasts was observed between the ages of 85
and 135 d, while in the treatments without application of inoculants, no significant
differences (P>0.05) were observed between the assessed ages. No populations of
Clostridium spp. were detected (Table 3).
There was significant interaction (P<0.05) of the regrowth days and inoculation on the
dry matter (DM), ash, crude protein (CP) and neutral detergent fiber corrected for ash and
protein (NDFap) of the BRS Capiaçu grass silages. The DM content of the silages
increased (P<0.05) with the harvest age, ranging from 29.36 % in the silage of the forage
harvested after 85 d to 34.15 % in the forage harvested after 135 d. Inoculation increased
(P<0.05) the DM content of the forage harvested after 85 d from 27.33 % to 29.36 %
(Table 4).
40
Table 3: Microbiological profile of BRS Capiaçu grass silages at different harvest ages and bacterial inoculation

-1
Item (log10 CFU g ) Inoculant Mean SEM
Inoculant x
harvest age
With 6.0 5.4 3.8 5.1A
Lactic acid bacteria 0.25 0.2575 0.0005 0.8815
Without 6.2 5.9 4.8 5.5A
Mean 6.1a 5.7a 4.0b
With 3.4Ab 3.8Aab 4.6Aa 3.9

Molds and yeasts 0.21 0.8008 0.5663 0.0137
Without 5.0Aa 3.7Aa 3.3Aa 4.0
Mean 4.2 3.7 4.0

41
Table 4: Chemical composition of BRS Capiaçu grass silages at different harvest ages and bacterial inoculation
Item (%) Inoculant Mean SEM
Inoculant x
harvest age
With 29.36Ac 30.55Ab 34.15Aa 31.35
DM 0.38 0.5097 <0.0001 0.0223
Without 27.33Bc 31.67Ab 34.21Aa 31.07
Mean 28.35 31.11 34.21
With 8.66Aa 6.97Bb 7.56Ab 7.73

Ash 0.12 0.0088 <0.0001 0.0053
Without 8.97Aa 8.29Ab 7.39Ac 8.21
Mean 8.81 7.63 7.47
With 5.21Aa 3.54Bb 3.32Ab 4.02

CP 0.14 0.0297 <0.0001 <0.0001
Without 5.37Aa 4.61Ab 2.91Bc 4.28
Mean 5.26 4.08 3.12
With 1.32 0.89 0.79 1.00B

EE 0.04 0.0497 <0.0001 0.1510
Without 1.29 1.01 1.02 1.11A
Mean 1.30ª 0.95b 0.90b
With 68.59Ab 72.08Aa 71.91Aa 70.86

NDFap 0.42 0.1345 <0.0001 0.0214
42
Without 68.83Ac 70.70Ab 71.96Aa 70.49
Mean 68.71 71.39 71.93
With 47.67 49.20 49.94 48.94A

ADF 0.20 0.0406 <0.0001 0.8647
Without 46.64 48.62 49.25 48.17B
Mean 47.15b 48.91a 49.60a
DM= dry matter, CP= crude protein, EE= ether extract, NDFap= neutral detergent fiber corrected for ash and protein, ADF= acid detergent fiber,
43
The highest ash, CP, and EE contents (P<0.05) were observed in the silage of the BRS
Capiaçu grass harvested after 85 d. In contrast, inoculation of the forage harvested after
110 d resulted in the lowest (P<0.05) ash content (6.97 % vs 8.29 %). Inoculation resulted
in the lowest (P<0.05) EE content in the silage (1.0 %) in relation to the silage without
inoculation (1.11 %). Inoculation resulted in equivalence (P>0.05) in the CP content of
the silages of the forages harvested after 110 and 135 d (3.43 %), although lower (P<0.05)
than the silage of the forage harvested after 85 d (5.21 %). The CP content of the forage
without inoculation decreased (P<0.05) with the advance of regrowth days (Table 4).
The NDFap contents of BRS Capiaçu grass forage silage harvested at 110 and 135 d
(88.45 % and 72 %) were higher (P<0.05) than those of forage silage harvested at 85 d
(84.81 % and 68.59 %). The NDFap contents of uninoculated silages increased (P<0.05)
with harvest age (Table 4).
The ADF contents were lower (P<0.05) in the silage of the forage harvested after 85 d.
Inoculant application resulted in the highest (P<0.05) ADF conten t in the silage
(48.94 %) in relation to the absence of inoculant (48.17 %) (Table 4).
Discussion
The conservation of forage in the ensiling process is based on the principle of

conservation in an anaerobic environment, where the absence of oxygen in the silo
predisposes to the increase of lactic acid bacteria (LAB), which emit pH and prevent the
development of undesirable microorganisms that harm the quality of the silage(18).
The application or not of inoculant did not influence the population of molds and yeasts
in the forage silage. The silages of the forages harvested at younger ages (85 and 110 d)
showed a greater population of LAB, favoring the fermentation of the forage harvested
after 85 d due to its lowest pH. According to Kung et al(19), the possible explanations for
flaws in the use of LAB-based inoculants include the intense competition of the epiphytic
flora and soluble carbohydrates, excess oxygen, and problems during inoculation.
The low pH of the silages (<4.5) favored the absence of Clostridium spp. in this study.
According to Pahlow et al(20), these bacteria demand high pH values for their
development. The presence of undesirable microorganisms is mainly associated with
flaws during fermentation.
The absence of Clostridium ssp. in the silages of the present study, responsible for
proteolysis during ensilage, contributed to the low N-NH3 concentrations obtained in the
silages. Furthermore, the fact that the pH values of the silages were below 4.5 increases
the fermentation efficiency and reduces protein hydrolysis in non-protein nitrogen
44
compounds (21). Similar results were obtained for the silage of the elephant grass cv. Roxo
with bacterial inoculation(22).
The low PG values can be attributed to the absence of Clostridium spp. bacteria in the
silages of the present study, the main ones responsible for CO2 production and other acids.
Inoculation was unfavorable in reducing the pH due to the reduced losses observed in this
study. In all silages, the dry matter contents (DM) increased from as the age regrowth
days increased. According to Van Soest(23), the increase in DM is mainly due to the high
effluent losses resulting from the low DM contents before ensilage, which was observed
in the present study. With regard to inoculant application, an increase in DM content was
observed only at 85 d of cutting age, treatment with the lowest DM content.
Microbial inoculation reduced the proteolytic activity of the silages, resulting in a rapid
pH reduction since proteolytic bacteria develop better in silages with higher pH values.
Therefore, the high pH value in the forages harvested after 110 and 135 d (4.20 and 4.36)
favored CP reduction compared to the silages harvested after 85 d, which showed the
highest CP and the lowest pH (3.65). The BRS Capiaçu grass silages showed CP contents
lower than the 7 % minimum proposed by Church(24) as necessary to sustain microbial
activity in the rumen, indicating the need for protein supplementation in order to meet the
nutrient requirements of ruminants.
Inoculation in the BRS Capiaçu grass forage resulted in the lowest EE content in relation
to the silage without the inoculant. However, these silages showed less than 8 % of EE,
which is recommended by McGuffey and Schingoethe(25) to prevent reductions in food
consumption and limited ruminant performance. However, the low EE proportion impacts
the energy value of silages, considering the calorific value of lipids in relation to other
organic compounds.
According to Wilson(26), tropical grasses require support structures represented by the cell
wall. Therefore, the older the plant age, the greater the proportion of cell wall components
and the lower the cell content. These statements justify the results of the BRS Capiaçu
silages harvested after 85 d, which showed the lowest contents of fibrous constituents
(NDFap and ADF) and the highest contents of non-fiber constituents (CP and EE)
compared to the regrowth days of 110 and 135 d.
Inoculation in the BRS Capiaçu grass forage resulted in the highest ADF content in
relation to the non-inoculated sample. A similar behavior was observed by others(7,27),
who mention increased ADF contents (48.35 % and 46.86 %) in silages of the elephant
grass cultivars Napier and Cameron with bacterial inoculant. Inoculation in the silages of
the BRS Capiaçu grass may have increased the cellulose contents through the absence of
activity in the enzymatic complex of the inoculant, solubilizing cell wall constituents(28),
and increasing the ADF contents.
45
The BRS Capiaçu forage silage harvested at 110 d demonstrated favorable performance
for silage production. However, the influence of inoculant use was low for the
characteristics evaluated. These results indicate that the BRS Capiaçu cultivar naturally
can have good ensiling capacity and the use of inoculants can be ineffective as it depends
on several factors, such as forage management, concentration of epiphytic bacteria and
the inoculant, in addition to environmental conditions. Therefore, to more
comprehensively evaluate the potential of using inoculants, it is necessary to use specific
inoculants in the BRS Capiaçu cultivar. These investigations can provide valuable
insights into the effectiveness and economic viability of using inoculants to optimize the
fermentation and quality of BRS Capiaçu silage harvested at different ages.
Acknowledgments
Thanks to the Postgraduate Program in Tropical Animal Science of the Federal University
of Teresina, Piauí, Brazil, the National Council for Scientific and Technological
Development (CNPq, Brasília, DF, Brazil), and the Federal Institute of Maranhão
(Caxias, Maranhão, Brazil).
Conflicts of Interest
The authors have no conflicts of interest to declare.
Literature cited:
1. Cardoso AM, Araujo SAC, Rocha NS, Domingues FN, Azevedo JC, Pantoja LA.
Elephant grass silage with the addition of crambe bran conjugated to different
specific mass. Acta Scientiarum. Anim Sci 2016;38:375-382.
2. Retore M, Alves JP, Junior MAPO, Mendes SS. Qualidade da silagem do capim-
elefante BRS Capiaçu. Dourados, MS: Embrapa Agropecuária Oeste; 2020.
3. Pereira AV, Lédo FJS, Machado JC. BRS Kurum. Capiaçu – New elefhant grass
cultivars for grazing and cut-and-carry system. Crop Breed Applied Biotech 2017;
17:59-62.
4. Monção FP, Costa MAMS, Rigueira JPS, Sales ECJ, Leal DB, Silva MFP, et al.
Productivity and nutritional value of BRS capiaçu grass (Pennisetum purpureum)
managed at four regrowth ages in a semiarid region. Trop Anim Health Prod 2020;
52:235-241.
46
5. Pereira AV, Oliveira JC, Ledo FJS, Diniz FH, Xavier DF, Lanes JJSN, et al. BRS
Capiaçu e BRS Kurumi: Cultivo e uso. Brasília, DF: Embrapa, 2021.
6. Desta ST, Yuan X, Li J, Shao T. Ensiling characteristics, structural and

nonstructural carbohydrate composition and enzymatic digestibility of Napier
grass ensiled with additives. Biores Technol 2016;221:447-454.
7. Costa R, Silva RC, Souza ED, Vieira EM, Nascimento TSS, Alencar AP. Bagaço
de cana-de-açúcar (Saccharum officinarum L.) na ensilagem do capim-elefante
(Pennisetum purpureum Schum) com ou sem inoculante bacteriano. Rev Acta
Kariri-Pesquisa e Desenvolvimento 2017;2:29-36.
8. Shah AA, Xianjun Y, Zhihao D, Junfeng L, São T. Microbiological and chemical

profiles of elephant grass inoculated with and without Lactobacillus plantarum
and Pediococcus acidilactici. Archives Microbiol 2018;200:311-328.
9. Cândido MJD, Gomide CAM, Alexandrino E, Gomide JA, Pereira WE.

Morfofisiologia do dossel de Panicum maximum cv. Mombaça sob lotação
intermitente com três períodos de descanso. Rev Brasileira Zoot 2005;34:406-415.
10. Zanine AM, Santos EM, Ferreira DJ, Gomes-Pereira O. Populações microbianas
e componentes nutricionais nos órgãos do capim-tanzânia antes e após a
ensilagem. Semina: Ciênc Agrár 2007;28:143-150.
11. Schmidt P. Perdas fermentativas na ensilagem, parâmetros digestivos e

desempenho de bovinos de corte alimentados com rações contendo silagens de
cana-de-açúcar (tese de doutorado). Piracicaba, SP: Universidade de São Paulo;
2006.
12. Silva DJ, Queiroz AC. Análise de alimentos: métodos químicos e biológicos. 3a
ed. Viçosa, MG: UFV; 2002.
13. Ferreira DA, Gonçalves LC, Molina LR, Castro-Neto AC, Tomich TR.
Características de fermentação da silagem de cana-de-açúcar tratada com ureia,
zeólita, inoculante bacteriano e inoculante bacteriano/enzimático. Arquivo
Brasileiro Med Vet Zoot 2007;59:423-433.
14. AOAC - Official methods of analysis. 12th ed. Washington, DC. Association of
Official Analytical Chemists. 1990.
15. Van-Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral
detergent fiber, and nonstarch polyssacharides in relation to animal nutrition. J
Dairy Sci 1991;74:3583-3597.
16. Valente TNP, Detmann E, Filho SCV, Queiroz AC, Sampaio CB, Gomes DI.
Avaliação dos teores de fibra em detergente neutro em forragens, concentrados e
fezes bovinas moídas em diferentes tamanhos e em sacos de diferentes tecidos.
Rev Brasileira Zoot 2011;40:1148–1154.
47
17. Silva N, Junqueira VCA, Silveira NFA. Manual de métodos de análise

microbiológica de alimentos. Varela, SP; 1997.
18. Machado FS, Rodriguez NM, Rodrigues JAS, Ribas, MN, Teixeira AM, Ribeiro
Júnior GO, et al. Qualidade da silagem de híbridos de sorgo em diferentes estádios
de maturação. Arquivo Brasileiro Med Vet Zoot 2012; 64:711-720.
19. Kung Jr L, Stokes MR, Lin CJ. Silage aditives. In: American Society of
Agronomy, Silage Science and Technology. Madison, WI; 2003:305-360.
20. Pahlow G, Muck RE, Driehuis F, Oude-Elferink SJWH, Spoelstra SF.

Microbiology of ensiling. In: American Society of Agronomy, Silage Science and
Technology. Madison, WI; 2003:31-93.
21. McDonald P, Henderson AR, Heron SJE. The biochemistry of silage. 2ª ed.
Marlow: Chalcomb Publications; 1991.
22. Bernardes TF, Souza NSS, Silva JSLP, Santos IAP, Faturi C, Domingues F. Uso
de inoculante bacteriano e melaço na ensilagem de capim-elefante. Rev Ciênc
Agrá, Amazonian J Agr Environ Sci 2013;56:173-178.
23. Van Soest P. Nutritional ecology of the ruminant. New York, EUA: Cor-nell
University Press; 1994.
24. Church DC. The ruminal animal digestive physiology and nutrition. New Jarsey:
Prentice Hall, 1988.
25. McGuffey RK, Schingoethe DJ. Feeding value of a high oil variety of sunflowers
as silage to lactating dairy cows. J Dairy Sci 1980;63:1109-1113.
26. Wilson JR. Cell wall characteristics in relation to forage digestion by ruminants:
review. J Agr Sci 1994;122:173-182.
27. Rodrigues PHM, Lopes TFT, Andrade SJT, Melotti L, Lucci CS, Lima FR. et al.
Adição de inoculantes microbianos sobre a composição química e perfil
fermentativo da silagem de capim-elefante (Pennisetum purpureum Schum.).
Acta Scientiarum. Anim Sci 2003;25:397-402.
28. Coan RM, Vieira PF, Silveira RN, Reis RA, Malheiros EB, Pedreira, MS.
Inoculante enzimático-bacteriano, composição química e parâmetros
fermentativos das silagens dos capins Tanzânia e Mombaça. Rev Brasileira Zoot
2005;34:416-424.
48
Article
Agronomic performance of palisade grass under different doses of

liquid blood waste and chemical composition of soil
Marcello Hungria Rodrigues a
Clarice Backes a
Alessandro José Marques Santos a
Lucas Matheus Rodrigues a
Arthur Gabriel Teodoro b
Cinthya Cristina Fernandes de Resende a
Adriana Aparecida Ribon a
Pedro Rogerio Giongo a
Patrick Bezerra Fernandes c*
Ana Beatriz Graciano da Costa d
a
Universidade Estadual de Goiás. Programa de Pós-graduação em Produção Animal e
Forragicultura, São Luís de Montes Belos, Goiás, Brazil.
b
Universidade Federal de Goiás. Programa de Pós-graduação em Zootecnia, Goiânia,
Goiás, Brazil.
c
Instituto Federal Goiano. Programa de Pós-graduação em Zootecnia, Rio Verde, Goiás
Brazil.
d
Universidade Federal do Vale do São Francisco. Programa de Pós-graduação em
Ciência Animal Petrolina, Pernambuco, Brazil.
* Corresponding author: bezerrazpatrick@gmail.com
49
Abstract:
The aim of the present study was to assess the agronomic performance and chemical
composition of soil cultivated with palisade grass (Urochloa brizantha cv. Marandu)
subjected to growing doses of liquid blood waste. The experiment followed the
completely randomized blocks design with six treatments and four repetitions. The
following doses of processed liquid blood waste were applied to test palisade grass’
yield: 0, 150, 300, 450 and 600 m3 ha-1. In addition, it was used in conjunction with
chemical fertilization at a rate of 50 kg ha-1 of P2O5 and 100 kg ha-1 of N (this treatment
was not managed with liquid blood residue). Palisade grass forage yield was influenced
by the fertilization strategy (P<0.001) – the highest values observed for this variable
were recorded under blood waste doses of 450 m3 ha-1 and 600 m3 ha-1. The 0.0 – 0.20 m
soil layer affect the organic matter fraction. On the other hand, phosphorus (P) content
presented differences between fertilization strategies; thus, it was possible observing
that the waste dose of 450 m3 ha-1 accounted for the highest availability of nutrients. The
application of blood liquid waste as alternative source of organic fertilizers can be
feasible, because it promotes significant increase in forage mass.
Keywords: Cerrado, Organic fertilization, Forage Mass, Sustainability, Urochloa

brizantha.
Introduction
Urochloa brizantha cv. Marandu (Syn. Brachiaria brizantha cv. Marandu), commonly
known as palisade grass, is a forage species broadly used by the Brazilian livestock
sector, because it shows excellent foraging potential for beef and milk production(1,2,3).
However, forage yield in the Brazilian savanna region, also known as Goiás State’s
Cerrado, suffers with challenges related to abiotic factors, mainly with soil issues, since
these soils are featured by low natural fertility, low nutrient contents of nitrogen (N),
phosphorus (P), potassium (K), calcium (Ca), magnesium (Mg) and sulfur (S), as well
as by low ability to retain water due to their low organic matter contents(4,5).
Therefore, it is essential to replenish nutrients through chemical fertilization to alleviate

this situation. However, this nutrient replenishment strategy goes against the
sustainability of an agricultural production system. For this reason, currently, this type
of fertilization should be considered as minimally as possible. However, inorganic
sources are quite expensive; moreover, the global crisis caused by the pandemic
50
scenario, in association with the on-going wars, can impair food security and the
economic feasibility of the production system(6).
The use of organic sources can be an alternative to the aforementioned issues, because it
can provide essential nutrients for plants’ good development, Oliveira et al(7) observing
that blood liquid waste from slaughterhouses present the essential nutrients for plants in
its chemical composition (e.g., P, K, Ca, Mg and S). Besides, these authors also
observed that using this waste type as P source in sunflower culture (Helianthus annuus
L.) led to good plant morphological development.
In addition, it is possible to suggest the following hypothesis: by using liquid blood

waste as an alternative source of N and P in pastures of palisade grass grown in the
Brazilian Cerrado, it is possible to increase the availability of forage mass and improve
the chemical composition of the soil. Therefore, the aim of the present study was to
assess the agronomic performance of palisade grass and chemical properties of soil
cultivated with palisade grass, subjected to growing doses of liquid blood waste.
Study site
The experiment was installed in a site by SANEAGO’s (Saneamento de Goiás) sewage

treatment station (ETE), in São Luís dos Montes Belos County, Goiás State (coordinates
16º 32’ 30” S, 50º 25’ 21” W; and altitude: 535 m). The experiment began in December
2017 and concluded in December 2018. This region is featured by Aw climate,
according to Köppen’s classification, with mean temperature of 23.5 ºC, ranging from
20.7 oC (June) to 25.0 oC (December), and mean annual rainfall of 1,785 mm – 87% of
it is concentrated between October and March, but there are 4 mo of water shortage
every year, on average(8). Temperature and rainfall data recorded during the experiment
are shown in Figure 1.
51
Figure 1: Maximum, medium and minimum temperature, and monthly rainfall rates
from December 2017 to December 2018, in the study site - São Luís de Montes Belos
County
Experimental design
The study site was properly fenced and the grass was cut to the height of 25cm for
treatment application purposes. After it was cut, 16m² (4 x 4 m) plots were set with 1m
hallways between them.
The experiment followed the completely randomized blocks design, with six treatments
and four repetitions. The treatments consisted of doses of 0 m3 ha-1 (control treatment,
without the use of any P and N source), 150 m3 ha-1 (equivalent to 39.60 kg ha-1 of N
and 27.10 kg ha-1 of P2O5), 300 m3 ha-1 (equivalent to 79.30 kg ha-1 of N and 54.10 kg
ha-1 of P2O5), 450 m3 ha-1 (equivalent to 118.90 kg ha-1of N and 81.20 kg ha-1 of P2O5),
and 600 m3 ha-1 (equivalent to 158.60 kg ha-1 of N and 108.20 kg ha-1 of P2O5) of liquid
blood processing residue obtained from cattle slaughterhouses, as a source of N and P.
Additionally, it was used in conjunction with chemical fertilization (CF) at a rate of 50
kg ha-1 of P2O5 and 100 kg ha-1 of N, according to the crop's needs and soil analysis(9).
The CF treatment did not receive any dose of liquid residue.
52
Soil physical composition and fertilization
Palisade grass (Urochloa brizantha cv. Marandu) pasture was set approximately 15
years ago, and it was not subjected to fertilization management. Before implementing
the experiment, soil chemical and physical properties were assessed based on samples
collected from soil layer 0.0 to 0.20 m. Subsequently, a compound sample was collected
and sent to the laboratory for analysis, based on the method described by Raij et al(10).
Soil was classified as Eutrophic Red Latosol(11); its texture was clayey with 360, 250
and 390 g kg-1 sand, silt and clay, respectively; chemical composition was 5.1 active
acidity (pH in CaCl2); 23.00 g kg-1 organic matter (OM); 100 mg dm-3 phosphorus (P in
Mehlich I); 2.80 cmolc dm-3 potential acidity (H+Al); 0.400 cmolc dm-3 of K; 2.50 cmolc
dm-3 of Ca; 0.700 cmolc dm-3 of Mg; 56 % base saturation (V%).
The CF treatment comprised 100 kg ha-1 of N and 50 kg ha-1 of P2O5 deriving from urea
and triple superphosphate, respectively. K2O was not applied because it was not
necessary, according to the soil featuring analysis. P was applied after the plots were set
and N fertilization was split in two applications: the first application was carried out in
December 2017 along with P and the second one was conducted in January 2018.
Organic fertilizer: blood waste
The herein used waste type came from bovine-blood processing carried out by a
company located in São Luís de Montes Belos County, Goiás State. The blood is sent to
this company in tank trucks from several slaughterhouses in the region. After it is
received, plasma and red cells’ physical separation is carried out in high-rotation
centrifuge. Then, both the red cells and plasma are subjected to drying process to be
used in feed fractions for small animals or in products for the pharmaceutical industries.
The liquid waste resulting from this process is treated for its proper disposal. The herein
used waste presented the following composition: Acidity (pH) of 7.41; ammoniacal
nitrogen (NH4+) of 264.30 mg L-1; P2O5 of 180.40 mg L-1. The waste was manually
applied, at once, with the aid of buckets, according to each treatment, on December 15th,
2017.
Forage canopy assessment
The 40-d time base was applied; it means five days more than the time base suggested
by Costa and Queiroz(12) – it was done because defoliation was mechanical, rather than
being done through conventional grazing. Every time plants subjected to this treatment
53
did not reach entrance height within 40 d, plant height was used as basis (30 cm).
Assessments were carried out on January 25th, 2018; March 07th, 2018; July 05th, 2018
and on November 25th, 2018 (40 d after the beginning of the rainy season).
Forage canopy height (CH, cm), tiller population density (TPD, m²), forage dry matter
(DM, Mg ha-1) and forage dry matter yield (FDM, Mg ha-1) (sum of all cuts) were
quantified for forage canopy featuring.
Canopy height was measured in each plot with the aid of a ruler, in five different points;
soil level was measured up to the mean level of the curve of fully expanded superior
leaf blades. TPD was determined by counting the three points in the experimental unit
with the aid of an iron frame (0.25 x 0.25 cm in dimension).
Yield was measured through DM by using a metal frame (1x1 m in dimension),

supported 0.25 m from soil surface. This equipment was randomly placed in the plot
and all forage inside it, at height ≥ 0.25 m, was collected and quantified, a 300 g fresh
sample was separated for dry matter determination in forced air circulation oven at
65 °C until it reached constant weight. Grass leaves (the two ones recently expanded
from the tiller) were collected to find leaf contents of N (g kg-1), P (g kg-1), K (g kg-1),
Ca (g kg-1), Mg (g kg-1), S (g kg-1), Cu (mg kg-1), Fe (mg kg-1), Mn (mg kg-1) and Zn
(mg kg-1). In order to do so, 10 representative plants were randomly collected in the plot
and selected; it totaled 20 leaves. Subsequently, they were washed in running water,
followed by washing in deionized water, dried in forced air circulation oven at 65 °C for
72 h and ground in Willey type mill(13).
Soil chemical composition
At the end of the assessment cycle, in September 2018, compound samples formed by
five simple samples resulting from random points in each plot were prepared with the
aid of metallic type probe from layers 0.00-0.20 and 0.20-0.40 m to observe likely soil
chemical changes caused by the waste application.
Soil was sieved after its collection and identification, and the following features were
analyzed: OM (g kg-1), pH (CaCl2), H+Al (cmolc dm-3), CEC (cmolc dm-3), P (mg dm-3),
K (mg dm-3), Ca (cmolc dm-3), Mg (cmolc dm-3), S (mg dm-3), Na (mg dm-3), B (mg
dm-3), Cu (mg dm-3), Fe (mg dm-3), Mn (mg dm-3) and Zn (mg dm-3), according to the
methodology described by Teixeira et al(14).
54
Information related to pasture was subjected to split-plot model in time:

yijk= μ + Ei + Bj + εij + Ck + Ti*Ck + εijk
wherein,
yijk: observed value;

μ= general constant;
Ti: treatments’ effect (i = 0, 150, 300, 450, 600 m3 ha-1, and CF);
Bj= Block’s effect (j = I, II, II and IV);
Ck: cuts’ effect (k = 1st, 2nd, 3rd and 4th);
εij: waste at plot level;
Ti*Ck: interaction effect;
εijk: experimental waste.
After this procedure was over, Tukey’s average test was applied at 5 % probability
level.
Data related to blood waste doses and chemical fertilization were analyzed through the
randomized block design model:
Yijk = μ + Ti + Bj + εijk; wherein,
Yijk: observed value;

μ= general constant;
Ti: treatments’ effect (i= 0, 150, 300, 450, 600 m3 ha-1, and CF);
Bj: Block’s effect (j= I, II, II and IV);
εijk: random error associated with each observed value.
After the completion of the aforementioned procedure, Tukey’s average test was applied
at 5% probability level, whenever applicable, at 5% significance level.
Waste doses were subjected to first (Yij = β0 + β1*X + εij) and second degree (Yij = β0 +
β1*X + β2*X² + εij) regression analysis; the model presenting 5 % significance effect
and the highest determination coefficient (R² ≥ 70 %) was the chosen one. Variance and
regression analyses were carried out in R software, version 4.2.1.
55
Results
Forage canopy structure
Palisade grass forage CH presented a significant blood waste and cut interaction
(P<0.001); thus, in the first and second cuts, the highest CH values were obtained when
doses of 150 m3 ha-1 and 600 m3 ha-1 were used. The highest CH values under doses 300
m3 ha-1 and 450 m3 ha-1, and chemical fertilization, were only recorded at the first cut.
Then, the first, second and the third cuts after dose 0 m3 ha-1 accounted for the lowest
CH values. The fourth cut did not show difference between fertilization strategies. Mean
height of 21.55 cm was recorded for this fourth cut (Table 1).
If one only takes into account the blood waste doses, the first cut generated a second
degree equation; thus, the use of 144 m3 ha-1 liquid waste led to height of 47.81cm.
Doses were adjusted to the first degree equation at the second and third cuts; thus, based
on the inclination parameters, it was possible inferring that increased offer of liquid
waste increases forage canopy height (Table 1).
It was possible observing the effect of interaction between fertilization strategy and cuts
(P=0.002) in TPD; therefore, CF after the dose of 0 m3 ha-1, at the first cut, led to the
lowest values. The 300, 450 and 600 m3 ha-1 doses had an impact on the increase in
TPD in the second cut, respectively. Dose 600 m3 ha-1 accounted for the highest TPD at
the third cut. The fourth cut did not show difference between fertilization strategies;
mean value of 437 tillers m-2 was recorded for palisade grass canopy on this fourth cut
(Table 1).
Blood waste doses at the first cut have led to a quadratic equation; thus, 759 tillers m-2
were measured when 590 m3 ha-1 organic fertilizer was applied. The second cut reached
a first-degree equation with positive inclination; therefore, increase in organic
fertilization doses had impact on palisade grass TPD increase. Doses did not have any
effect at the third and fourth cuts (Table 1).
DM was affected by the interaction between fertilization strategy and cuts (P<0.001);
thus, the dose of 450 m3 ha-1 blood waste generated the highest forage mass values at
the first cut. Dose 600 m3 ha-1 led to the highest DM values at the fourth cut. Blood
waste doses at the first and fourth cuts were the ones presenting adjustment to the
quadratic equation; therefore, doses 417 m3 ha-1 and 500 m3 ha-1 organic fertilizer led to
DM yield of 5.42 Mg ha-1 and 6.22 Mg ha-1, respectively (Table 1).
Palisade grass forage yield was influenced by fertilization strategies (P<0.001), the
highest forage-yield values were recorded at blood waste doses of 450 m3 ha-1 and 600
56
m3 ha-1. If one only takes into account waste doses; it is possible observing the best
adjustment to the quadratic equation under the dose 583 m3 ha-1 blood waste to obtain
14.77 Mg ha-1 (Table 1).
Nutrients’ content in palisade grass leaf blades
There was blood waste effect on leaf N (P<0.001) and P (P= 0.013) content at dose 600
m3 ha-1, which led to the highest N values. Fertilization also affected K (P= 0.015), S
(P<0.001), Fe (P= 0.001) and Mn (P<0.001) concentration; the highest values recorded
for these elements were recorded at doses 450 m3 ha-1 and 600 m3 ha-1 (Table 2).
The Ca content in the leaf was affected by the fertilization strategies (P=0.002), where
the highest concentrations were observed in the 300 m3 ha-1 and 600 m3 ha-1 doses. Mg
was also influenced by the treatments tested (P=0.019), with the highest concentrations
recorded at the 450 m3 ha-1 dose. Copper (Cu) was not influenced by fertilization
strategies (P=0.05); mean copper value of 9.25 g kg-1 was recorded (Table 2).
N, P, Ca, Mg, S, Fe Mn and Zn contents in leaf blades were affected by blood waste
doses; it was possible observing their best adjustment to first degree equations. So, the
higher the waste dose the higher the leaf concentration of these elements (Table 2).
Soil chemical composition at layer 0.00 -0.20 m
Layer 0.00 -0.20 m did not show any effect of fertilization strategies (P>0.05) on OM,
pH, K, Mg, S, Na, B, Cu and Mn. Thus, the following mean values were recorded:
32.17 g kg-1, 5.05 CaCl2, 127.17 mg dm-3, 0.713 cmolc dm-3, 3.63 mg dm-3, 2.04 mg
dm-3, 0.204 mg dm-3, 1.25 mg dm-3 and 54.58 mg dm-3, respectively (Table 3).
Fertilization strategies influenced CEC (P=0.013), Ca (P<0.001) and Fe (P<0.001);

dose 600 m3 ha-1 led to the highest CEC means. Fertilization also affected H+Al (P=
0.039); dose 0 m3 ha-1 accounted for the lowest mean H+Al value. Phosphorus (P)
contents present difference between fertilization strategies (P=0.001); thus, dose 450 m3
ha-1 recorded the highest availability of this nutrient. Chemical fertilization led to the
lowest Zn values (P=0.006) (Table 3).
Blood waste doses accounted for the best adjustment to second degree equations when it
comes to P, Ca and Fe; therefore, doses 400 m3 ha-1, 500 m3 ha-1 and 575 m3 ha-1
generated contents of 2.32 mg dm-3, 2.37 cmolc dm-3 and 33.46 mg dm-3 of these
elements, respectively (Table 3).
57
Soil chemical composition at layer 0.20 -0.40 m
Soil layer 0.20 - 0.40 m did not show any effect of fertilization strategy (P>0.05) on
OM, pH, P, K, Ca , Mg, S, Na, B, Cu, Mn and Zn. Thus, it was possible reaching mean
values of 22.69 g kg-1, 5.19 in CaCl2, 1.18 mg dm-3, 85.39 mg dm-3, 2.00 cmolc dm-3,
0.708 cmolc dm-3, 3.67 mg dm-3, 2.04 mg dm-3, 0.200 mg dm-3, 1.25 mg dm-3, 36.13 mg
dm-3 and 0.492 mg dm-3 for these elements, respectively (Table 3).
Fertilization strategies influenced CEC (P=0.049) and H+Al (P<0.001); their values
have increased at dose 600 m3 ha-1. The highest Fe contents (P=0.003) were observed at
doses 450 m3 ha-1 and 600 m3 ha-1, respectively (Table 3).
Blood waste doses have influenced H+Al and Fe, since they showed the best adjustment
to first degree equations; therefore, the rate of potential acidity and minerals that can be
toxic in plants at soil layer 0.20 – 0.40m increased, as the organic source also increased
(Table 3).
Discussion
Forage canopy structure
The recommended CH for palisade grass pastures is 30-45 cm, as it is the best height to
maximize the availability of forage mass; higher CH values indicate an undesirable
accumulation of morphological components that can compromise the chemical
composition of the forage canopy, such as pseudostem (stem + sheath) and dead
material(15,16). The dose of 150 m³ ha-1 of organic fertilizer induces the palisade grass
canopy to reach heights that comply with the management recommendation. However,
the use of this dose does not promote the maximum potential availability of forage
mass.
On the other hand, TPD showed the highest values at the highest blood waste doses;
consequently, the highest DM and FDM values were measured under these nutritional
management conditions. Véras et al(17) assessed five Urochloa spp. cultivars (Basilisk,
Marandu, BRS Paiaguás, Piatã, Xaraés), was found moderate correlation between CH
and DM; however, the correlation between DM and TPD was closer because it ranged
from moderate to high. Thus, it is necessary to pay close attention to the pasture’s tiller
dynamics at organic fertilization application, since this feature is determining to forage
mass yield.
58
In the fourth cut, it was observed that regardless of the fertilization strategy used, there
was proportionality in TPD. This occurred because there were no differences in the
management criteria (defoliation frequency and cutting height), which did not alter the
tillering dynamics. However, adopting different management strategies can lead to
fluctuations in the phenotypic plasticity of the forage canopy(18).
Orrico et al(19) grew tufted grass subjected to growing poultry slaughterhouse waste
doses and found the highest tiller and forage mass values at higher organic fertilizer
doses. According to the findings, the high N content in the organic fertilizer boosts
tissue flow in the tillers, and it allows forage canopy to reach the maximum yield
potential. Costa et al(20) assessed Megathyrsus maximus cv. Massai (Syn. Panicum
maximum cv. Massai) pastures and observed that fertilization management based on
using other bio-fertilizer source (deriving from swine farming) increased leaf forage
mass in comparison to mineral fertilization.
In this context, the use of organic fertilizers derived from slaughterhouses is highly
recommended as a primary fertilization strategy, as these fertilizers enhance the
morphological performance of tillers and significantly increase forage production.
However, to achieve these results, it is essential that the fertilizer supplied to the soil
contains the necessary nutrients to optimize plant production(21).
Nutrient contents in palisade grass leaf blades
The growing doses of liquid waste (0 m³ ha-1, 150 m³ ha-1, 300 m³ ha-1, 450 m³ ha-1, 600
m³ ha-1) led to significant increase in N, P, Ca, Mg, S, and Fe fractions in palisade grass
leaf blades. According to Tomazello et al(22) and Rezende et al(23), the adequate supply
of nutrients enhances the accumulation of N, P, Ca, S, and Mg in the aboveground part
of tropical grasses managed in savanna regions. Furthermore, it enhances the nutritional
value of the produced forage. Nitrogen sources (organic or mineral) supply to palisade
grass favors its use efficiency and P, K, Ca and S accumulation, respectively.
There is a specific factor about the micro-nutrients (B, Cu, Fe, Mn, Zn) accumulation,
namely: soils presenting pH value lower than 6.0 show increased availability of micro-
nutrients for plants; on the other hand, if soil acidity increases, one observes undesired
Fe increase in it, and this process can be toxic in plants. Yet, Brazilian Cerrado soils
often present high Fe contents(24,25,26); therefore, it is necessary often assessing soil
acidity levels to avoid complications capable of impairing the maximum agronomic
performance of the forage canopy.
59
Soil chemical composition at layers 0.0 – 0.20 m and 0.20 – 0.40 m
Liquid waste doses and mineral fertilization at layer 0-0.20 m did not influence OM,
Mg, S, Na, B, Cu, Mn and Zn. On the other hand, the highest liquid waste doses led to
increased CEC and Ca contents (Table 3). According to Caovilla et al(27), cation content
increase forms the sum base, as it happens with Ca; this process increases soil CEC.
However, acidic pH soil compromises the availability of other cations. Thus, it is
possible suggesting that the continuous use of liquid waste can change the cation
fraction in the soil. Nevertheless, it is necessary associating it with liming management
to achieve the availability of essential nutrients for plant development.
In order to make changes in soil chemical composition in tropical climate regions,

mainly at its deepest layers (0.20 – 0.40 m), it is necessary to continuously apply
organic fertilizers, because it is not possible reaching the desired increase in OM and P
fractions in the short-term(28). However, cation addition can change the sum of bases in
the soil; thus, it is essential carrying out long-term research to analyze the effect of
blood waste on pasture yield in tropical regions.
Considerations on the use of liquid slaughterhouse waste in primary

production
Despite being considered a potentially polluting material, when used judiciously, liquid
blood residue proves to be a nutrient-rich source, along with an abundance of beneficial
microbial populations for the soil, as observed by Bhunia et al(29). In agriculture, this
factor has a significant impact on increasing primary production. In the specific case of
Marandu palisade grass, the results demonstrated that, in a short period of time, there
was a considerable increase in forage availability, indicating that pastures reached their
maximum productive potential when liquid residue is used as a source of P and N.
Another relevant point to consider when exploring alternative sources of organic

fertilizers is the geopolitical conflicts associated with health crises(6), as these conflicts
have led to substantial increases in chemical fertilizer prices, increasing risks to food
security. Therefore, the partial or complete substitution of chemical fertilizers with
organic alternatives can result in a significant reduction in production costs, making
primary production less burdensome(22,30).
60
To maximize the availability of forage mass from Marandu palisade grass produced in
the Brazilian Cerrado, doses ranging from 450 m³ ha-1 to 600 m³ ha-1 of blood residue
can be employed. However, concerning the soil's chemical composition, only the dose
of 450 m³ ha-1 results in significant increases in the phosphorus content in the 0.00-0.20
m layer.
Acknowledgements
We would like to thank the Coordenação de Aperfeiçoamento de Pessoal de Nível

Superior - Brasil (CAPES) (Financial Code 001) and the Universidade Estadual de
Goiás for their financial support. Notice/Call No. 21/2022, Grant No. 000036041850.
Literature cited:
1. Demski JB, Arcaro Junior I, Gimenes FMA, Toledo LM, Miranda MS, Giacomini
AA, et al. Milk production and ingestive behavior of cows grazing on Marandu and
Mulato II pastures under rotational stocking. Rev Bras Zootec 2019;48:
e20180231.
2. Gurgel ALC, Difante GS, Emerenciano Neto JV, Costa MG, Dantas JLS, Ìtavo LCV,
et al. Supplementation of lamb ewes with different protein sources in deferred
marandu palisadegrass (Brachiaria brizantha cv. marandu) pasture. Arq Bras Med
Vet Zootec 2020;72:1901-1910.
3. Ferrari AC, Leite RG, Fonseca NV, Romanzini EP, Cardoso ADS, Barbero RP, et al.
Performance, nutrient use, and methanogenesis of Nellore cattle on a continuous
grazing system of Urochloa brizantha and fed supplement types varying on protein
and energy sources. Livest Sci 2020;253: 104716.
4. Hunke P, Mueller EN, Schröder B, Zeilhofer P. The Brazilian Cerrado: assessment of

water and soil degradation in catchments under intensive agricultural use.
Ecohydrology 2015;8: 1154-1180.
5. Beck MH, Escosteguy PA, Dick DP. Modifications of phosphorus in Latosol as a

function of humic acids and acidity. Rev Bras Eng Agrí Ambi 2018;22:488-492.
6. Allam Z, Bibri SE, Sharpe SA. The rising impacts of the COVID-19 pandemic and
the Russia-Ukraine war: Energy transition, climate justice, global inequality, and
supply chain disruption. Resources 2022;11:99.
61
7. Oliveira LQ, Taveira JHS, Fernandes PB, Backes C, Costa CM, Santos AJM, et al.
Use of blood residue as alternative source of phosphorus in sunflower (Helianthus
annuus L.) cultivation. Arq Bras Med Vet Zootec 2022;74: 153-159.
8. Alvares CA, Stape JL, Sentelhas PC, Gonçalves JLM, Sparovek G. Köppen's climate
classification map for Brazil. Meteorol Z 2014;22:711-728.
9. Martha Júnior GB, Vilelam L, Sousa DMG. Cerrado: Uso eficiente de corretivos e
fertilizantes em pastagens. Planaltina, DF: Embrapa Cerrados 2007;224.
10. Raij BV, Andrade JC, Cantarella H, Quaggio JA. Análises químicas para avaliação
da fertilidade de solos tropicais. Campinas: IAC; FUNDAG 2001.
11. Santos HG, Jacomine PKT, Anjos LHC, Oliveira VA, Lumbrera JF, Coelho MR, et
al. Sistema brasileiro de classificação de solos. 5ed. Brasília: Embrapa CNPS 2018.
12. Costa JAAH, Queiroz P. Régua de manejo de pastagens - edição revisada.

Comunicado Técnico 135, Campo Grande, 2017.
13. Carmo CAFS, Araújo WS, Bernardi ACC, Saldanha MFC. Métodos de análise de
tecidos vegetais utilizados na Embrapa Solos. Rio de Janeiro: Embrapa Solos 2000;
41.
14. Teixeira PC, Donagemma GK, Fontana A, Teixeira WG. Manual de métodos de
análise de Solo. 3ª ed. Brasília, DF: Embrapa 2017.
15. Euclides VPB, Montagner DB, Macedo MCM, Araujo AR, Difante GS, Barbosa
RA. Grazing intensity affects forage accumulation and persistence of Marandu
palisadegrass in the Brazilian savannah. Grass Forage Sci 2019;74:450-462.
16. Antunes LE, Montagner DB, Euclides VPB, Taira CDAQ, Echeverria JR, Nantes
NN. Intermittent stocking strategies for the management of Marandu palisade
grass in the Brazilian Cerrado biome. Grassl Sci 2021;68:70-77.
17. Véras ELL, Difante GS, Gurgel ALC, Costa CM, Emerenciano Neto JV, Rodrigues
JG, et al. Tillering capacity of Brachiaria cultivars in the Brazilian Semi-arid
region during the dry season. Trop Anim Sci J 2020;43(2):133-140.
18. Silva S, Chiavegato M, Pena K, Silveira M, Barbero L, Júnior S, Rodrigues C,

Limão V, Pereira L. Tillering dynamics of Mulato grass subjected to strategies of
rotational grazing management. J Agric Sci 2017;155:1082 - 1092.
19. Orrico Júnior MAP, Centurion SR, Sunada NS, Vargas Júnior FM. Características
morfogênicas do capim-piatã submetido à adubação com efluentes de abatedouro
avícola. Ciência Rural 2013;43:158-163.
62
20. Costa JE, Soares LE, Sousa VFD, Costa ABG, Emerenciano Neto JV, Oliveira
EMM, et al. Sward structure, morphological components and forage yield of
massai grass in response to residual effect of swine biofertilizer. Acta Sci. Anim
Sci 2022;44:e53792.
21. Pereg L, Morugán-Coronado A, McMillan M, García‐Orenes, F. Restoration of

nitrogen cycling community in grapevine soil by a decade of organic fertilization.
Soil Tillage Res 2018;179:11-19.
22. Tomazello DA, Melo EMF, Santos AJM, Backes C, Teodoro AG. Fernandes PB, et
al. Agronomic performance and soil chemical composition when using poultry
litter as organic fertilizer in Mombasa Guinea grass production. NZ J Agric Res
2023;66: 1-15.
23. Rezende PR, Rodrigues LM, Backes C, Santos AJM, Fernandes PB, Giongo PR, et
al. Productivity and nutrient extraction by Paiaguás palisadegrass submitted to
doses of nitrogen in single cultivation and intercropped with pigeon pea. Arq Bras
Med Vet Zootec 2022;74: 1151-1160.
24. Li KW, Lu HL, Nkoh JN, Hong ZN, Xu RK. Aluminum mobilization as influenced
by soil organic matter during soil and mineral acidification: A constant pH study.
Geoderma 2022;418:115853.
25. Osafo NOA, Jan J, Porcal P, Borovec J. Contrasting catchment soil pH and Fe
concentrations influence DOM distribution and nutrient dynamics in freshwater
systems. Sci Total Environ 2023;858:159988.
26. Zhao WR, Shi RY, Hong ZN, Xu RK. Critical values of soil solution Al3+ activity
and pH for canola and maize cultivation in two acidic soils. J Sci Food Agric
2022;102:6984-6991.
27. Caovilla FA, Sampaio SC, Smanhotto A, Nóbrega LHP, Queiroz MF, Gomes BM.
Características químicas de solo cultivado com soja e irrigado com água residuária
da suinocultura. Rev Bras Eng Agrí Amb 2010;14:692-697.
28. Rigo AZ, Corrêa JC, Mafra ÁL, Hentz P, Grohskopf MA, Gatiboni LC, et al.
Phosphorus fractions in soil with organic and mineral fertilization in integrated
crop-livestock system. Rev Bras Ciênc Solo 2019;43:e0180130.
29. Bhunia S, Bhowmik A, Mallick R, Debsarcar A, Mukherjee J. Application of

recycled slaughterhouse wastes as an organic fertilizer for successive cultivations
of bell pepper and amaranth. Sci Hortic 2021;280:109927.
30. Silva WV, Taveira JHS, Fernandes PB. Silva PC, Costa ABG, Costa Cm, Giongo
PR, Corioletti NSD, Gurgel ALC. Organic and mineral fertilization on the
agronomic performance of sunflower cultivars and soil chemical attributes. Rev
Bras Eng Agrí Amb 2023;12:927-933.
63
Table 1: Palisade grass forage canopy featuring based on different fertilization strategies associated with intervals between cuts
Fertilization Strategy
Cut 0 m³ ha-1 150 m³ ha-1 300 m³ ha-1 450 m³ ha-1 600 m³ ha-1 CF kg ha-1 Equation R²
-------------------------------------------------------------------------------- CH (cm) ---------------------------------------------------------------------------
1st 28.75Bd 57.80Ab 92.45Aa 89.00Aa 87.90Aa 44.85Ac y = 27.22 + 0.287x – 0.001x² 0.966
Ad Acd Bb Bb Aa Bc
2nd 43.75 52.10 68.40 66.50 87.60 55.25 y = 43.25 + 0.068x 0.919
Bc Bc Cbc Cb Ba Cc
3rd 27.75 32.70 36.00 42.00 50.30 29.95 y = 26.87 + 0.036x 0.973
Ca Ca Da Da Ca Da
4th 19.20 21.25 22.37 22.90 23.40 20.15 y = 19.81 -
SEM 2.46
------------------------------------------------------------------------------- TPD (m²) ---------------------------------------------------------------------------
1st 625ABb 625Aab 696Aa 754Aa 675Aa 676Aa y = 410.52 + 1.18x – 0.002x² 0.976
Ab ABb Aa Aa Aa Aa
2nd 610 533 794 814 802 785 y = 577.50 + 0.444x 0.654
ABa Ba Ba Ba Ba Ba
3rd 488 488 526 573 516 489 y = 490.10 -
Ba Ba Ba Ba Ba Ba
4th 421 427 432 435 441 463 y = 421.45 -
SEM 15.13
---------------------------------------------------------------------------- DM (Mg ha-1) ------------------------------------------------------------------------
1st 0.386Ce 2.99Bc 5.63Aab 5.99Aa 5.16Bb 2.14Bd y = 0.2145 + 0.025x – 0.00003x² 0.985
Bd Bc Cc Cb Ca Ab
2nd 1.55 2.60 2.82 3.69 4.49 3.66 y = 1.63 + 0.005x 0.974
Db Cb Da Da Da Cb
3rd 0.00 0.185 1.22 1.65 1.73 1.28 y = -0.028 + 0.003x 0.911
4th 2.64 Ad
3.78 Ac
3.85 Bc
4.71 Bb
6.21 Aa
3.28 Acd
y = 4.97 + 0.005x – 0.000005 0.950
SEM 0.189
---------------------------------------------------------------------------- FDM (Mg ha-1) -----------------------------------------------------------------------
FDM 4.58d 9.56c 13.52b 16.04a 17.69a 9.21c y = 4.56 + 0.035x – 0.00003x² 0.999
SEM 0.936
CH= canopy height; TPD= tiller population density; DM= dry matter; FDM= forage dry matter yield.
CF= chemical fertilization with 80 kg ha-1 P2O5; y= observed value; x= blood waste doses (0 m³ ha-1, 150 m³ ha-1, 300 m³ ha-1, 450 m³ ha-1, 600 m³ ha-1). R²=
determination coefficient. SEM= standard error of the mean.
The means followed by the same lowercase letter (row) and uppercase letter (columns) do not differ from each other at the 5% probability level.
64
Table 2: Nutrients’ content in palisade grass leaf blades under different fertilization strategies
Fertilization Strategy
Item 0 m³ ha-1 150 m³ ha-1 300 m³ ha-1 450 m³ ha-1 600 m³ ha-1 CF kg ha-1 SEM Equation R²
N, g kg-1 17.50c 18.75b 20.00ab 20.00ab 21.5a 20.25ab 0.310 y = 17.70 + 0.006x 0.945
P, g kg-1 1.75 b
1.80 b
1.90 ab
2.10 ab
2.35 a
1.85 ab
0.062 y = 1.68 + 0.001x 0.925
K, g kg-1 26.00 ab
24.70 ab
26.30 ab
27.80 a
27.55 a
23.20 b
0.473 y = 25.23 -
Ca, g kg-1 1.95 b
2.15 b
2.30 a
2.42 ab
2.95 a
1.82 b
0.095 y = 1.82 + 0.001x 0.935
Mg, g kg-1 1.10 b
1.17 ab
1.50 ab
1.60 a
1.57 ab
1.35 ab
0.053 y = 1.11 + 0.001 0.856
S, g kg-1 0.750 c
1.00 b
1.15 ab
1.45 a
1.42 a
0.875 bc
0.062 y = 0.795 + 0.001x 0.931
Cu, mg kg-1 9.00 a
9.25 a
10.75 a
8.25 a
9.00 a
9.25 a
0.590 y = 9.45 -
Fe, mg kg-1 88.75 b
91.75 b
102.00 ab
125.00 a
122.75 a
85.25 b
4.03 y = 85.80 + 0.067x 0.885
Mn, mg kg-1 41.25 c
58.00 bc
72.50 b
115.75 a
125.50 a
43.25 bc
7.36 y = 37.35 + 0.150x 0.955
Zn, mg kg-1 25.75 b
31.50 ab
35.75 a
34.75 ab
33.00 ab
26.00 b
1.14 y = 28.60 + 0.011x 0.509
CF= chemical fertilization with 80 kg ha-1P2O5; y= observed value; x= blood waste doses (0 m³ ha-1, 150 m³ ha-1, 300 m³ ha-1, 450 m³ ha-1, 600 m³ ha-1). N= nitrogen;
P= phosphorus; K= potassium; Ca= calcium; Mg= magnesium; S= sulfur; Cu= copper; Fe= iron; Mn= manganese; Zn= zinc; R²: determination coefficient; SEM:
standard error of the mean.
Means followed by the same lowercase letters in the rows, did not differ from each other at 5% probability level.
65
Table 3: Chemical composition of the soil in the 0.0 - 0.20 m and 0.20 - 0.40 m layers of soil cultivated with palisade grass subjected to
different fertilization strategies
Fertilization strategy
0 m³ 150 m³ ha-1 300 m³ ha-1 450 m³ 600 m³ CF kg
Item -1 SEM Equation R²
ha ha-1 ha-1 ha-1
Layer 0.0-0.20 m
OM, g kg-1 36.00a 28.00a 31.00a 30.00a 34.00a 34.00a 1.00 y = 32.20 -
pH, CaCl2 5.10a 5.10a 5.07a 5.00a 4.95a 5.05a 0.020 y = 5.12 -
CEC, cmolc dm-3 5.19b 5.46b 6.24ab 6.42ab 7.10a 6.24b 0.191 y = 5.13 + 0.003x 0,969
H+Al, cmolc dm-3 2.22b 2.30a 2.82a 2.92a 3.42a 2.27a 0.129 y = 2.13 + 0.002x 0.405
y = 0.721 + 0.008x –
P, mg dm-3 1.00b 1.25b 2.25ab 3.25a 2.00ab 1.50b 0.197 0.706
0.00001x²
K, mg dm-3 153.50a 113.50a 130.00a 124.00a 129.00a 113.00a 5.63 y = 137.70 -
y = 1.87 + 0.002
Ca, cmolc dm-3 1.87d 2.17c 2.42abc 2.47ab 2.57a 2.20bc 0.055 0.989
– 0.000002x²
Mg, cmolc dm-3 0.700a 0.700a 0.675a 0.725a 0.775a 0.700a 0.036 y = 0.680 -
S, mg dm-3 3.75a 3.75a 3.50a 3.75a 3.50a 3.50a 0.157 y = 3.75 -
Na, mg dm-3 1.75a 2.50a 2.25a 1.50a 2.75a 1.50a 0.164 y = 1.95 -
B, mg dm-3 0.200a 0.150a 0.225a 0.200a 0.175a 0.275a 0.017 y = 0.176 -
Cu, mg dm-3 1.10a 1.20a 1.27a 1.47a 1.12 1.35a 0.047 y = 1.17 -
66
y = 20.23 + 0.046x
Fe, mg dm-3 19.50d 27.75bc 30.5abc 31.32ab 34.00a 24.75c 1.10 0.956
- 0.00004x²
Mn, mg dm-3 51.00a 50.50a 61.00a 49.25a 60.25a 55.50a 2.24 y = 50.95 -
Zn, mg dm-3 0.550ab 0.700a 0.750a 0.675a 0.700a 0.400b 0.032 y = 0.620 -
Layer 0.20-0.40 m
OM, g kg-1 22.25a 23.32a 24.25a 21.50a 23.32a 21.50a 0.492 y = 23.33 -
pH, CaCl2 5.22a 5.22a 5.17a 5.17a 5.15a 5.22a 0.023 y = 5.23 -
CEC, cmolc dm-3 4.82ab 5.06ab 5.28ab 5.28ab 5.73a 4.57b 0.115 y = 4.83 + 0.001x 0.233
H+Al, cmolc dm-3 1.92b 2.07b 2.30ab 2.35ab 2.65a 1.87b 0.067 y = 1.91 + 0.001x 0.968
P, mg dm-3 1.10a 1.00a 1.50a 1.25a 1.25a 1.00a 0.077 y = 1.11 -
K, mg dm-3 106.00a 94.00a 74.00a 79.00a 81.32a 78.00a 4.99 y = 99.73 -
Ca, cmolc dm-3 1.97a 2.12a 2.10a 1.90a 2.07a 1.85a 0.058 y = 1.98 -
Mg, cmolc dm-3 0.650a 0.625a 0.700a 0.825a 0.800a 0.650a 0.028 y = 0.620 + 0.001x 0.202
S, mg dm-3 3.50a 3.75a 3.50a 3.75a 3.50a 4.00a 0.115 y = 3.60 -
Na, mg dm-3 2.00a 1.50a 2.25a 2.00a 1.75a 2.75a 0.175 y = 2.21 -
B, mg dm-3 0.250a 0.200a 0.200a 0.250a 0.125a 0.175a 0.015 y = 0.245 -
67
Cu, mg dm-3 1.27a 1.15a 1.67a 1.25a 0.975a 1.20a 0.100 y = 1.36 -
Fe, mg dm-3 19.57bc 21.5b 24.5ab 25.32a 25.75a 18.75c 0.721 y = 20.09 + 0.010x 0.979
Mn, mg dm-3 35.25a 35.25a 38.25a 33.50a 39.75a 34.75a 0.944 y = 34.95 + 0.004x 0.466
Zn, mg dm-3 0.400a 0.425a 0.600a 0.525a 0.525a 0.475a 0.031a y = 0.425 -
CF= chemical fertilization ;with 80 kg ha-1 P2O5; y= observed value; x= blood waste dose (0 m³ ha-1, 150 m³ ha-1, 300 m³ ha-1, 450 m³ ha-1, 600 m³ ha-1). OM= organic
matter; pH in CaCl2= active acidity; CEC= cation exchange capacity; H+Al= potential acidity; P= phosphorus; K= Potassium; Ca= calcium; Mg= magnesium; S=
sulfur; B= Boron; Cu= copper; Fe= iron; Mn= manganese; Zn= zinc; R²= determination coefficient; SEM= standard error of the mean.
Means followed by the same lowercase letters in the rows, did not differ from each other at 5% probability level.
68
Article
Effect of essential oils on the production of methane in the in vitro

fermentation of Koronivia grass
Paulino Sánchez-Santillán a
Luis Antonio Saavedra-Jiménez a
Nicolás Torres-Salado a
Jerónimo Herrera-Pérez a
Marco Antonio Ayala-Monter a*
a
Universidad Autónoma de Guerrero. Facultad de Medicina Veterinaria y Zootecnia No. 2,
Carretera Acapulco-Pinotepa Nacional, kilómetro 197, Cuajinicuilapa, 41940, Guerrero,
México.
* Corresponding author: maamonter@hotmail.com
Abstract:
The objective was to evaluate the increasing use of garlic, sesame, and cinnamon oil in the
production of CH4 in 60 d in vitro regrowth of Koronivia grass. The addition of 0, 2.5, 5.0,
5.0, 7.5, and 10 % garlic, cinnamon, or sesame oil was evaluated in an in vitro fermentation
using a 60-d regrowth of Koronivia grass as substrate. The variables evaluated were
cumulative CH4 production at 12, 24, 36, 36, 48, and 72 h; dry matter degradation (DMD),
and CH4 production kinetics estimators (A= CH4 production potential, b= CH4 production
rate constant, and k= lag time). The CH4 production and the DMD were analyzed with a
completely randomized experimental design and orthogonal contrast. The estimators were
subjected to a descriptive analysis. An increase of garlic oil and cinnamon linearly reduced
CH4 production at 12, 24, 36, 48, and 72 h. The DMD decreased linearly with the use of any
of the three oils (P<0.05). The highest value of A was obtained with 2.5 % garlic oil, and the
highest value of k and b, with 10 % cinnamon oil. In conclusion, the use of garlic and
69
cinnamon oils resulted in a linear decrease of Koronivia grass CH4 and Koronivia grass DMD
under in vitro conditions.
Keywords: Garlic oil, Cinnamon oil, Sesame seed oil, Dry matter degradation, In vitro.
Introduction
Livestock production generates 37 % of global greenhouse gas (GHG) emissions and is

expected to increase to 40 % by 2050; 80.7 % of these GHGs come from the enteric
fermentation of ruminants(1,2). The main GHGs produced by ruminants are enteric and
manure methane (CH4), carbon dioxide (CO2), and nitrous oxide (N2O)(3). CH4 is a GHG that
contributes to the formation of tropospheric ozone; it also has a short life span (9 to 12 yr),
but is 25 times more harmful than CO2, so its reduction helps mitigate the adverse effects of
climate change(1,2).
GHG mitigation strategies are aimed at not affecting animal performance, reducing
environmental impact, and enhancing the productivity and profitability of production
systems(1). Because of this, additives should be able to modify rumen fermentation to improve
energy use efficiency while decreasing rumen methanogenesis(4). Today, approximately
200,000 plant secondary metabolites have been identified as potential modulators of the
rumen microbiota, specifically in the reduction of energy loss via CH4 synthesis(1).
Essential oil (EO) is a complex mixture of lipophilic, plant-specific volatile or aromatic

chemicals; its constituents are terpenoids, phenylpropanoids, monoterpenes, sesquiterpenes,
and alcohols, aldehydes, ethers, esters, ketones, and phenols(1,5). These oils possess
antioxidant properties and induce changes in the ruminal microbiome, resulting in a reduction
of CH4, increase in propionate or ruminal by-pass protein(1,4,6), antimicrobial effect of
bacteria, fungi and protozoa, as well as decreased dry matter (DM) digestibility and ruminal
fermentation(4), inhibition of amino acid deamination, ammonia nitrogen and acetate
reduction(5), and they influence electron pathways affecting the integrity of cell
membranes(1,2). The decrease in enteric CH4 production with the use of EO is due to the
reduction of hydrogen production (alternative sinks), direct inhibition of archaea, and
interruption of the symbiosis between protozoa and archaea(1).
70
Garlic (Allium sativa) oil has a broad spectrum of antibacterial activity against gram-negative
and gram-positive bacteria(7); its bioactive compounds are organic sulfides, saponins,
phenolic compounds, and polysaccharides, allicin, S-allyl cysteine, diallyl disulfide, diallyl
trisulfide, diallyl sulfide, and ajoene(8). Cinnamon (Cinnamomum verum) oil has an
antimicrobial effect due to its transcinnamaldehyde content and antioxidant activity derived
from its phenolic and polyphenolic compounds(9). For its part, sesame (Sesamum indicum)
oil contains oleic and linoleic acid, tocopherol, sesamin, sesamolin, polyphenols,
phytosterols, flavonoids, and lignans, which have anti-inflammatory and antimutagenic
effects(10).
The efficiency of rumen fermentation is leading to the search for natural alternatives to
mitigate GHG emissions without compromising livestock productivity; the concentration of
atmospheric CH4 continues to increase, so strategies are needed to help reduce its production.
The hypothesis was that the addition of garlic, sesame, and cinnamon oils decreases CH4
production during in-vitro ruminal fermentation of Koronivia grass substrate with 60 d of
regrowth. Thus, the objective of this research was to evaluate the use of increasing doses of
garlic, sesame, and cinnamon oil in the in vitro ruminal fermentation of 60-d-old Koronivia
grass as a substrate for methane production and dry matter degradation.
The study was conducted in the animal nutrition laboratory of the Faculty of Veterinary
Medicine and Animal Husbandry No. 2, located in the municipal seat of Cuajinicuilapa,
Guerrero, Mexico.
Oils and substrate
The essential oils utilized were garlic (Yerbatex), sesame (Yerbatex), and cinnamon
(Yerbatex). The proportions of oil evaluated were 0, 2.5, 5.0, 7.5, and 10.0 % of oil. The
Koronivia grass (Brachiaria dictyoneura) was harvested 60 d after regrowth. The grass was
dehydrated at 60 °C for 48 h in an oven (FELISA® FE-293A, Mexico) and ground to 1 mm
size in a Thomas-Wiley Mill (Thomas Scientific®, Swedesboro, NJ, USA). The
bromatological composition of the grass was 22.4 % dry matter (DM), 3.4 % crude protein
(CP), 71.1 % neutral detergent fiber (NDF), 42.1 % acid detergent fiber (ADF), and 8.7 %
ash (Ash).
71
In vitro gas production technique
The culture medium for the in vitro tests consisted of two-thirds reduced buffer-mineral
solution and one-third fresh rumen fluid(11). The reduced buffer-mineral solution contained:
150 mL of mineral solution I [6 g K2HPO4 (Sigma) in 1,000 mL of distilled H2O], 150 mL
of mineral solution II [6 g K2HPO4 (Sigma) in 1,000 mL of distilled H2O], 150 mL of mineral
solution II [6 g KH2PO4 (Sigma) + 6 g (NH4)2SO4 (Merck) + 12 g NaCl (Sigma-Aldrich) +
2.45 g MgSO4 (Sigma) + 1.6 g CaCl-2H2O (Sigma) in 1 000 ml of distilled H2O], 100 mL of
8 % solution of Na2CO3 (Merck), 100 mL of reducing solution [0.1 g L-cysteine (Sigma) +
0.1 g Na2S-9H2O (Meyer) + 2 mL NaOH (2N; Meyer) in 100 mL distilled H2O] and 2 mL
resazurin at 0.1% (Sigma-Aldrich). Fresh rumen fluid was obtained from a bovine with a
rumen cannula grazing on pasture with pangola grass and filtered with a sky blanket to
remove macroparticles of organic matter. The cattle were handled by the internal bioethics
and welfare regulations of the Autonomous University of Guerrero, based on the official
norms NOM-062-ZOO-1999 and NOM-051-ZOO-1995.
Subsequently, the following ratios of oil and ground plainer grass were each placed directly
in a (120 mL) serological vial: 0 % (1 g grass), 2.5 % (0.025 g oil and 0.975 g grass), 5 %
(0.05 g oil and 0.95 g grass), 7.5 % (0.075 g oil and 0.925 g grass), and 10 % (0.1 g oil and
0.9 g grass). 50 mL of culture medium was added to each vial, under a continuous flow of
CO2, to maintain anaerobic conditions. The vials were closed with a neoprene cap and
aluminum ring with a removable center and were considered biodigesters. The biodigesters
were incubated in a double boiler at 39 °C for 72 h.
Methane production
Methane (CH4) production was determined using a Taygon® hose (2.38 mm inner Ø and 45
cm length) with hypodermic needles (20 G x 32 mm) at the ends. The needles were used to
couple a biodigester with a vial trap containing NaOH (2N); this was placed inversely in a
modified test tube that was used to collect the NaOH solution (2N) displaced by the CH4
produced during incubation through the hypodermic needle placed as an outlet valve. CH4
production was measured at 0, 12, 24, 36, 48, and 72 h(12,13). The main reason for using this
technique is that the main gases produced by the final products of in vitro microbial
fermentation are CO2 and CH4, given that the rest of the gases produced in in vitro techniques
are trace gases(14). Likewise, NaOH can capture CO2, as its reaction generates HCO3(15), so
the CH4 production is measured as the displaced milliliters of NaOH solution.
72
Fermentation characteristics
The pH, ammonia nitrogen (N-NH3), and dry matter degradation (DMD) were determined
after 72 h of incubation. A potentiometer (Hanna® HI2211, Italy; calibration pH 7 and 4)
was utilized to estimate the pH of the culture medium. To measure The ammonia nitrogen
(N-NH3) was measured by taking 1 mL of the medium contained in the biodigester and
mixing it with 0.25 mL of 25 % metaphosphoric acid (Meyer®; 4:1 ratio) in a 2 mL
Eppendorf tube (Neptune®, Mexico). The tube sample was centrifuged for 25 min at 3,500
xg, and the supernatant was recovered in 2 mL vials. A volume of 20 μL of this supernatant
was mixed in a volumetric vial with 1 ml of phenol solution [10 mg of Na2(NO) Fe(CN)5.H2O
(Meyer®) + 10 g of phenol crystals (Meyer®) in 1,000 mL of distilled water] and 1 mL of
hypochlorite solution [7.5 g of NaOH (Reasol®) + 21.3 g of Na2HPO4 (Meyer®) + 15 mL of
hypochlorite (5 %; Reasol®) in 1,000 ml of distilled water]. The mixture was incubated for
30 min at 37 °C in a (Shel Lab® 1227, USA) double boiler. Subsequently, 5 mL of distilled
water was added for dilution and vortexed (Genie 2 G-560, USA). The absorbance was
measured at 630 nm in a UV-VIS spectrophotometer (Jenway® 6850, USA), calibrating with
a nitrogen concentration method (r2= 0.9994)(16). The DMD was quantified by filtering the
residual solid sample from the biodigester using ANKOM® bags previously dried to constant
weight. The sample bags were dried at 60 °C for 24 h in an oven. In vitro dry matter
degradation (DMD) was calculated using the formula DMD %= (initial sample - residual
sample / initial sample) * 100(17).
Methane production kinetics
The cumulative CH4 production values were used to estimate the kinetics of CH4 production
using the Gompertz model(18). The estimators A, b and k were estimated by nonlinear
regression analysis, using the PROC NLMIXED procedure of the SAS statistical package(19).
The model used was:
Y= A exp [-b] [exp (-k t)];
Where:
Y= CH4 volume at time t (ml g-1 of DM);
A= total CH4 production potential when t = ∞ (ml g-1 of DM);
b= constant CH4 production rate of the potentially degradable material (ml h-1);
k= time lag (h), microbial efficiency constant factor, defined as the intercept of the time axis
of the tangent line at the point of inflection;
t= incubation time.
73
The cumulative methane production at 12, 24, 36, 48 and 72 h, as well as the in vitro
fermentative characteristics of each oil (garlic, sesame, and cinnamon) were analyzed using
a completely randomized design with the GLM procedure of SAS(19). Mean values were
compared with Tukey's test (P<0.05). The response to the growing increase in oil was
calculated using linear and quadratic orthogonal contrasts. It should be noted that a
descriptive analysis of the CH4 production kinetics estimators was performed.
Results
CH4 production decreased linearly at 12, 24, 36, 36, 48, and 72 h of Koronivia grass
fermentation (P<0.05) as the amaount of added garlic (Table 1) and cinnamon oil increased
(Table 2). Sesame oil did not exhibit a linear or quadratic contrast in CH4 production after
12, 24, 36, 48, and 72 h of grass fermentation (P>0.05) as more of it was added (Table 3).
This indicates that garlic and cinnamon oil reduce methane production in in vitro tests.
However, in the case of garlic oil, the trend in the decrease and difference between inclusion
levels became evident only with 7.5 % or more (Table 1). While, in the case of cinnamon oil,
the effect on the decrease could be observed even with as little as 2.5 % (Table 2).
Table 1: Effect of garlic oil level on CH4 production and in vitro fermentative
characteristics of Koronivia grass at 60 days of regrowth
Inclusion of garlic oil Tukey
Variable MSE Linear Square
0% 2.5 % 5.0 % 7.5 % 10 % test
Me12 11.49a 11.61 a
11.15a 8.64b 9.62ab 0.35 0.0027 0.0013 0.8488
Me24 24.99ab 28.01 a
25.43ab 21.96b 23.31b 0.62 0.0027 0.0058 0.1887
Me36 34.48ab 37.24a 33.73ab 28.81c 31.08bc 0.84 0.0007 0.0007 0.5140
Me48 38.95b 43.73a 37.11bc 34.21c 36.63bc 0.88 <0.0001 <0.0001 0.7042
Me72 43.98b 48.86 a
41.53bc 39.61c 40.33c 0.92 <0.0001 <0.0001 0.2223
pH 6.01c 6.10b 6.11ab 6.14ab 6.17a 0.02 <0.0001 <0.0001 0.0912
DMD 59.48 59.37 58.31 55.31 53.74 0.93 0.1815 0.0396 0.9975
N-NH3 9.75 9.75 14.12 11.83 11.00 0.92 0.5416 0.5451 0.3324
Me12= methane production at 12 h of fermentation (mL g-1 DM), Me24= methane production at 24 h of
fermentation, Me36= methane production at 36 h of fermentation, Me48= methane production after 48 h of
fermentation, Me72= methane production after 72 h of fermentation, pH= hydrogen ion potential, DMD= dry
matter degradation percentage, N-NH3= mg dL-1 of ammonia nitrogen, MSE= mean standard error.
a,b,c
Average values with different letters in the same row are different (P<0.05).
74
Table 2: Effect of cinnamon oil level on CH4 production and in vitro fermentative
Inclusion of cinnamon oil Tukey
Variable MSE Linear Square
0% 2.5 % 5.0 % 7.5 % 10 % test
Me12 11.66a 10.25ab 9.11bc 8.28c 8.14c 0.37 <0.0001 <0.0001 0.0374
Me24 25.32a 23.91ab 22.79bc 20.88c 23.68ab 0.42 0.0004 0.0010 0.0009
Me36 34.65a 31.77b 30.15bc 27.73c 31.45b 0.64 <0.0001 0.0001 0.0001
Me48 38.64a 36.56ab 34.71bc 33.13c 36.27ab 0.54 0.0004 0.0009 0.0004
Me72 43.31a 39.29b 38.92b 38.53b 40.71b 0.51 0.0007 0.0066 0.0001
pH 6.01c 6.11b 6.20a 6.16ab 6.22a 0.02 <0.0001 <0.0001 0.0035
DMD 59.48a 58.36 a
56.88 ab
54.58b 55.49b 0.53 0.0007 <0.0001 0.1621
N-NH3 9.75a 7.25a 8.50a 8.50a 8.91a 0.33 0.2040 0.8484 0.0983
a,b,c
Table 3: Effect of sesame oil level on CH4 production and in vitro fermentative
Inclusion of sesame oil Tukey
Variable EEM Lineal Cuadratic
0% 2.5 % 5.0 % 7.5 % 10 % test
Me12 11.66 10.59 10.51 10.80 9.99 0.22 0.1939 0.0524 0.6139
Me24 25.32 25.28 23.84 24.48 24.42 0.30 0.5145 0.2516 0.4369
Me36 34.65 32.11 32.60 33.12 32.93 0.31 0.0737 0.1977 0.0461
Me48 38.64 37.57 37.86 38.52 37.74 0.21 0.4146 0.5729 0.5973
Me72 43.31 42.70 43.12 42.49 43.29 0.24 0.8175 0.9001 0.4485
pH 6.01c 6.13 b
6.14b 6.17ab 6.22a 0.02 <0.0001 <0.0001 0.0085
DMS 59.48a 57.88ab 56.12b 53.33c 53.29c 0.68 <0.0001 <0.0001 0.2876
N-NH3 9.75 9.75 8.91 9.75 8.91 0.35 0.8964 0.5684 1.000
a,b,c
Dry matter degradation (DMD) decreased linearly (P<0.05) as the inclusion of garlic (Table
1), cinnamon (Table 2), or sesame (Table 3) oil increased. This decrease was reflected in the
pH value of the culture media; the pH augmented linearly (P<0.05) as the inclusion of garlic
(Table 1), cinnamon (Table 2), and sesame (Table 3) oil increased.
75
The ammonia nitrogen content (N-NH3) did not exhibit (P>0.05) linear or quadratic effects,
or differences between levels of inclusion of garlic oil (Table 1), cinnamon oil (Table 2), or
sesame oil (Table 3), as their inclusion in the fermentation of Koronivia grass increased.
The kinetics of CH4 fermentation using garlic oil showed similar values in A and k when 5
and 7.5 %, respectively, were added, while in b they were lower with the addition of 7.5 and
10 %, compared to the values obtained without any added oil (control). Also, in relation to
the control, the inclusion of 2.5 % of sesame oil resulted in lower values in the estimators A,
k, and b. In contrast, in estimator A, all cinnamon oil inclusion levels exhibited lower values
than the control; while in estimator b, the values decreased with the addition of 7.5 %, and in
estimator k, with 5 and 7.5 % (Table 4).
Table 4: Average estimators of in vitro CH4 production kinetics of plainer grass with 60
days of regrowth supplemented with increasing levels of garlic, sesame or cinnamon oil
A k b
Oil % of inclusion -1
(ml g of DM) (h) (ml h-1)
Control 0.0 42.54 3.55 0.077
2.5 47.50 3.52 0.075
5.0 42.53 3.47 0.075
Garlic oil
7.5 42.55 3.37 0.068
10.0 43.77 3.35 0.067
2.5 35.62 3.23 0.071
5.0 44.72 3.91 0.076
Sesame oil
7.5 41.16 3.52 0.078
10.0 43.45 3.42 0.071
2.5 36.61 3.69 0.077
5.0 39.66 3.49 0.074
Cinnamon oil
7.5 34.75 3.34 0.064
10.0 38.98 4.17 0.082
A= total methane production potential, b= constant methane production rate, k= time lag.
Discussion
The goal of ruminant microbiologists and nutritionists is to manipulate rumen microbial

ecosystems to improve feed intake efficiency(7). Additives used as CH4 inhibitors act directly
in the methanogenesis pathway, interrupting the process. Oils in the rumen environment
exhibit toxic characteristics on methanogens and protozoa, hydrogenation of unsaturated
76
fatty acids (alternative sink for hydrogen), and changes in propionic production leading to
reduced CH4 production(20).
The decrease in accumulated CH4 production at different times measured by garlic and
cinnamon oils are assumed to contain terpenoids and phenylpropanoids that interact in the
cell membrane, as the hydrophobic nature of their cyclic hydrocarbons allows them to
accumulate in the lipid bilayer, causing conformational changes in the membrane structure
that result in loss of cell membrane stability(21).
Delgadillo-Ruiz et al(5) utilized nonlinear models for their estimates and reported yields of
183, 99, and 141 mM L-1 of CH4 when 0.1, 0.3, and 0.6 mL of cinnamon oil were added
using 41.5 % alfalfa, 41.5 % wheat straw, and 17 % of a corn grain-based concentrate as
substrate; these values differ from those obtained in the present study (Table 2) because they
do not show a tendency to decrease CH4 as the addition of cinnamon oil increased. Cobellis
et al(3) reported 3.67 mL CH4 g-1 of DM in a 24-h in vitro fermentation using alfalfa hay as
substrate and adding 1.125 mL L-1 of cinnamon oil culture medium; these values are lower
than those of the present study, even concerning the control treatment (Table 2). This is a
consequence of the methodology used for measuring the CH4, substrate, inoculum source,
etc.(13), all of which influence CH4 production.
Concentrations of up to 10 % were estimated in the present in vitro study; however, NRC(22)

mentions that the added oils should not exceed 7 % of the dry matter of the diet, because
higher contents of oil may hinder an adequate dry matter intake. For this reason, in vivo tests
should be carried out to assess the effect of cinnamon oil on the reduction of greenhouse
gases, as reductions were observed with the addition of at least 2.5 % of this oil, as well as
with a minimum addition of 5 % of garlic oil.
The addition of garlic oil did not exhibit differences in dry matter degradation (DMD)
between oil inclusion levels; its tendency to reduce DMD value was observed with the
addition of 5 % or more. In the case of sesame and cinnamon oil, differences (P<0.05) and a
tendency to reduce DMD were observed with the addition of as little as 5 %. The decrease in
DMD can be assumed to be a consequence of hydrogen accumulation that affected fiber
degradation(20), and it may be inferred that the oils reduced protein and starch degradation in
response to inhibition of the bacteria used in the inoculum(23). Also, unsaturated fatty acids
are toxic to fiber-hydrolyzing bacteria; these acids adhere to the cell wall(24), thereby reducing
the ability of the bacteria to attach to the grass and hydrolyze it.
In vitro fermentation of bermudagrass (Cynodon dactylon) produced a linear decrease in dry

matter degradation with the increasing addition of thyme oil (50, 250 and 500 mL g-1)(25), a
similar situation to that reported in the present study with the three oils. Likewise, Cobellis
77
et al(3) reported lower values of DMD than the present study, as they assessed 55 % of DMD
in an in vitro fermentation where they used alfalfa hay as substrate and added 1.125 mL L-1
of cinnamon oil culture medium.
The pH values in the present study are ascribed to the DMD, since volatile fatty acids, which
decrease the pH, are a product of its degradation; however, when the DMD decreased as the
concentration of the different oils evaluated increased, the production of volatile fatty acids
diminished and did not affect the pH value. Busquet et al(7) reported a quadratic effect on the
pH value of the culture media, with a tendency to increase as more garlic oil was added to a
diet containing 50:50 forage:concentrate, a behavior similar to that reported in the present
study with the three oils.
The concentration of N-NH3 in the present study is because oils do not inhibit the metabolism
of ammonia nitrogen-producing bacteria(23). Researchers(3) reported 13.5 mg dL-1 of
ammonia nitrogen in an in vitro fermentation of alfalfa with 1.125 mL L-1 of cinnamon oil;
these values are higher than those obtained in the present study because alfalfa has a higher
protein content than the Koronivia grass. Another study reported(7) that the N-NH3 content
exhibited no differences concerning the treatment that did not contain garlic oil, a situation
similar to that of the present study with the three oils.
The effects of these oils tend to be influenced by their components, which make it difficult
to analyze their effect on ruminant nutrition. Therefore, further studies are required to identify
the metabolites contained in each oil to establish their real effect on the fermentation of
forages as the main producers of methane, given the fermentation stoichiometry.
The modified Gompertz equation is a common model for CH4 production by degradation of
a simple organic substrate(26). The literature includes several studies that utilized this model
to estimate CH4 production. He et al(27) applied a modified Gompertz model and a first-order
kinetic model to evaluate CH4 production during the in vitro fermentation of wheat straw
using bull and heifer fluid as inoculum; their results showed lower values in A (22 ml CH4
g-1) and k ( 0.945 h), as well as higher values in b (0.105 mL h-1). Another study(28) evaluated
the CH4 potential and the CH4 production rate of stalk bark, stalk pith, and corn stubble leaves
from batch anaerobic digestion, reporting higher values than those estimated in the present
study in A (204.8 ml CH4 g-1) and lower values in k (0.1553 h). Zhang et al(26) reported higher
values than the present study, as they published values of 94.38 mL CH4 g-1 for A, 12.38 h
for k, and 2.46 ml h-1 for b in the fermentation of cow manure with corn stubble. With the
differences in the estimators reported by other authors(26,27,28) used for comparison and those
of the present study, it is assumed that whether essential oils with anti-metagenomic
properties are added or not depends on the conditions under which the experiments were
78
performed and the substrates used, since they directly influence the kinetics of methane
production.
Therefore, the modeling of CH4 production under the conditions of the present study was
important, because these serve for the design, construction and application of chemical or
biochemical processes. Furthermore, they describe the characteristics of the process and
allow its subsequent optimization(29).
The addition of garlic or cinnamon oil to the in vitro fermentation of Koronivia grass reduces
methane production and dry matter degradation. Sesame oil does not exhibit anti-
methanogenic activity under the conditions of the present study, but it reduces the in vitro
degradation of dry matter.
Acknowledgments
The authors are grateful to the academic team of the "Sustainable Production of Ruminants
in the Tropics" for financing this project, and to the student Adrián Medina Calvo for his
support in the work done in the laboratory as part of his professional practices of the
Veterinary Medicine and Animal Husbandry degree of the Autonomous University of
Guerrero.
Conflict of interest
The authors declare that there is no conflict of interest in this manuscript.
Literature cited:
1. Jiménez-Ocampo R, Montoya-Flores MD, Pámanes-Carrasco G, Herrera-Torres E,
Arango J, Estarrón-Espinosa M, et al. Impact of orange essential oil on enteric
methane emissions of heifers fed bermudagrass hay. Front Vet Sci 2022;9:863910.
79
2. Becker F, Spengler K, Reinicke F, Heider-van Diepen C. Impact of essential oils on

methane emissions, milk yield, and feed efficiency and resulting influence on the carbon
footprint of dairy production systems. Environ Sci Pollut Res 2023;30(17):48824-
48836.
3. Cobellis G, Trabalza-Marinucci M, Marcotullio MC, Yu Z. Evaluation of different

essential oils in modulating methane and ammonia production, rumen fermentation, and
rumen bacteria in vitro. Anim Feed Sci Technol 2016;215:25-36.
4. Günal M, Pinski B, AbuGhazaleh AA. Evaluating the effects of essential oils on methane
production and fermentation under in vitro conditions. Ital J Anim Sci 2017;16(3):500-
506.
5. Delgadillo-Ruiz L, Bañuelos-Valenzuela R, Gallegos-Flores P, Echavarría-Cháirez F,

Meza-López C, Gaytán-Saldaña N. Modificación de la fermentación ruminal in vitro
para mitigación de metano mediante la adición de aceites esenciales de plantas y
compuestos terpenoides. Abanico Vet 2021;11:2020-2050.
6. Belanche A, Newbold CJ, Morgavi DP, Bach A, Zweifel B, Yáñez-Ruiz DR. A Meta-
analysis describing the effects of the essential oils blend agolin ruminant on
performance, rumen fermentation and methane emissions in dairy cows. Animals
2020;10(4):620.
7. Busquet M, Calsamiglia S, Ferret A, Carro MD, Kamel C. Effect of garlic oil and four of
its compounds on rumen microbial fermentation. J Dairy Sci 2005;88(12):4393-4404.
8. Bar M, Binduga UE, Szychowski KA. Methods of isolation of active substances from
garlic (Allium sativum L.) and its impact on the composition and biological properties
of garlic extracts. Antioxidants 2022;11(7):1345.
9. Wong YC, Ahmad-Mudzaqqir MY, Wan-Nurdiyana WA. Extraction of essential oil from
cinnamon (Cinnamomum Zeylanicum). Orient J Chem 2014;30(1):37-47.
10. Atefi M, Entezari MH, Vahedi H, Hassanzadeh A. The effects of sesame oil on metabolic
biomarkers: a systematic review and meta-analysis of clinical trials. J Diabetes Metab
Disord 2022;21(1):1065-1080.
11. Hernández-Morales J, Sánchez-Santillán P, Torres-Salado N, Herrera-Pérez J, Rojas-

García AR, Reyes-Vázquez I, et al. Composición química y degradaciones in vitro de
vainas y hojas de leguminosas arbóreas del trópico seco de México. Rev Mex Cienc
Pecu 2018;9(1):105-120.
80
12. Herrera-Pérez J, Velez-Regino LG, Sánchez-Santillán P, Torres-Salado N, Rojas-García

AR, Maldonado-Peralta M. Fermentación in vitro de consorcios bacterianos
celulolíticos ruminales de búfalos de agua en sustratos fibrosos. Rev MVZ Córdoba
2018;23(3):6860-6870.
13. Torres-Salado N, Sánchez-Santillán P, Rojas-García RA, Almaraz-Buendía I, Herrera-

Pérez J, Reyes-Vázquez I, et al. In vitro gas production and fermentative characteristics
of ruminal cellulolytic bacterial consortia of water buffalo (Bubalus bubalis) and Suizo-
Cebu cow. Agrociencia 2019;53(2):145-159.
14. Amanzougarene Z, Fondevila M. Fitting of the in vitro gas production technique to the
study of high concentrate diets. Animals 2020;10(10):1935.
15. Ghaffari S, Gutierrez MF, Seidel-Morgenstern A, Lorenz H, Schulze P. Sodium

hydroxide-based CO2 direct air capture for soda ash production-fundamentals for
process engineering. Ind Eng Chem Res 2023;62(19):7566-7579.
16. McCullough H. The determination of ammonia in whole blood by a direct colorimetric

method. Clin Chim Acta 1967;17(2):297-304.
17. Sánchez-Santillán P, Meneses-Mayo M, Miranda-Romero L, Santellano-Estrada E,

Alarcón-Zúñiga B. Fribrinolytic activity and gas production by Pleurotus ostreatus-IE8
and Fomes fomentarius - EUM1 in bagasse cane. Rev MVZ Córdoba 2015;4907-4916.
18. Lavrenčič A, Stefanon B, Susmel P. An evaluation of the Gompertz model in

degradability studies of forage chemical components. Anim Sci 1997;64(3):423-431.
19. SAS Institute Inc. Statistical Analysis System, SAS, User’s Guide [Internet]. Cary, NC:
SAS Inst. 2011.
20. Honan M, Feng X, Tricarico JM, Kebreab E, Honan M, Feng X, et al. Feed additives as
a strategic approach to reduce enteric methane production in cattle: modes of action,
effectiveness and safety. Anim Prod Sci 2022;62:1303-1317.
21. Calsamiglia S, Busquet M, Cardozo PW, Castillejos L, Ferret A. Invited review: essential
oils as modifiers of rumen microbial fermentation. J Dairy Sci 2007;90(6):2580-2595.
22. Nutrient requirements of dairy cattle. National Academies of Sciences. Eighth Rev Ed.
https://nap.nationalacademies.org/catalog/25806/nutrient-requirements-of-dairy-cattle-
eighth-revised-edition.
23. Polin LAR, Muro AR, Díaz LHG. Aceites esenciales modificadores de perfiles de
fermentación ruminal y mitigación de metano en rumiantes. Revisión. Rev Mex Cienc
Pecu 2014;5(1):25-48.
81
24. Castillo-Lopez E, Domínguez-Ordóñez MG. Factors affecting the ruminal microbial

composition and methods to determine microbial protein yield. Review. Rev Mex Cienc
Pecu 2019;10(1):120-48.
25. Benetel G, Silva T dos S, Fagundes GM, Welter KC, Melo FA, Lobo AAG, et al.
Essential oils as in vitro ruminal fermentation manipulators to mitigate methane
emission by beef cattle grazing tropical grasses. Molecules 2022;27(7):2227.
26. Zhang H, An D, Cao Y, Tian Y, He J. Modeling the methane production kinetics of

anaerobic co-digestion of agricultural wastes using sigmoidal functions. Energies
2021;14(2):258.
27. He Y, Wang H, Yu Z, Niu W, Qiu Q, Su H, et al. Effects of the gender differences in

cattle rumen fermentation on anaerobic fermentation of wheat straw. J Clean Prod
2018;205:845-853.
28. Xu H, Li Y, Hua D, Mu H, Zhao Y, Chen G. Methane production from the anaerobic

digestion of substrates from corn stover: Differences between the stem bark, stem pith,
and leaves. Sci Total Environ 2019;694:133641.
29. Pečar D, Pohleven F, Goršek A. Kinetics of methane production during anaerobic

fermentation of chicken manure with sawdust and fungi pre-treated wheat straw. Waste
Management 2020;102:170-178.
82
Article
Effect of the administration of intraruminal selenium boluses in goat kids

on biomarkers of oxidative stress in plasma
Gabriela Rodríguez Patiño a
Víctor Manuel Díaz Sánchez a
J. Efrén Ramírez Bribiesca b
Arturo Aguirre Gómez a
Alma Luisa Revilla Vázquez a
Patricia Ramírez Noguera a
Jorge Luis Tórtora Pérez a
Raquel López Arellano a*
a
Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán.
Unidad de Investigación Multidisciplinaria, Carretera Cuautitlán-Teoloyucan, Km 2.5, San
Sebastián, Xhala, 54714, Estado de México, México.
b
Colegio de Postgraduados, Campus Montecillo. Programa de Ganadería, Estado de México,
México.
*Corresponding author: lopezar@unam.mx
Abstract:
This study aimed to evaluate the effect of Se administered through intraruminal boluses in
goat kids and correlate it with the levels of the mineral and the biomarkers of oxidative stress
in the blood. Fifteen goat kids of 8 to 9 wk of age of the Alpine breed with an average weight
of 13.7 kg were used and divided into three groups: Selenium group (a sodium selenite bolus
was administered orally, with an equivalent content of 90 mg of Se); Se-SMZ group (a bolus
83
of sodium selenite was administered orally, with a content equivalent to 90 mg of Se and 4 g

of sulfamethazine a); Placebo group (a placebo bolus was administered orally). Plasma Se
levels were carried out through the technique of atomic absorption spectrophotometry. The
concentration of TBARS and GSH were estimated through spectrophotometry. The
established significance was P<0.05. After the administration of the selenium and SE- SMZ
Se boluses, the goat kids increased the levels of Se in plasma starting 3 h after dosing, with
a significant difference (P<0.05) between the Se vs Se-SMZ until 3 and 24 h. The groups of
bolus-dosed animals had variability in plasma TBARS levels without showing a constant
trend (P>0.05). GSH levels did not show significant differences between the groups. In
conclusion, the boluses with Selenium and Se-SMZ increased plasma Se levels. There was
wide variability in plasma TBARS levels and GSH levels did not show relevant significant
differences between treatments. Boluses were a good alternative to supplement Se to
ruminants.
Keywords: Goat, Intraruminal boluses, Selenium, Oxidative Stress.
Introduction
Selenium (Se) deficiency in ruminants is a common problem in various grazing areas

worldwide. The content of Se varies with the type of soil. Consequently, forages could have
low amounts of this mineral(1). Se deficiency causes diseases such as nutritional muscular
dystrophy, anemia, mastitis, placental retention and infertility(2-4). Nutritional muscular
dystrophy has been reported as one of the leading causes of death in kids from 28 to 90 d of
age in the Mexican plateau(5). Se supplementation prevents deficiency disorders in animals(6).
Selenium can be administered with inorganic compounds such as selenite (Na2SeO3) and
sodium selenate (Na2SeO4) or organic forms such as selenomethionine (C5H11NO2Se) and
selenocysteine (C3H7NO2Se), widely available in yeast cultures(7,8). The NRC(9) recommends
the amount of 0.2 mg of Se per kilo of dry matter in small ruminants. However, animal needs
can be met through injectable solutions or extended-release forms, such as intraruminal
boluses(10-12). Intraruminal boluses have the advantage of continuously releasing of the
required dose of Se for long periods; they are administered orally, remaining in the reticulo-
rumen when the size and density are adequate(13,14). The adequate dosage of Se is reflected
in the body with the increase in Se levels in the blood(15).
84
Selenium deficiencies can cause an increase in free radicals, generating an imbalance known
as oxidative stress (OE). The excessive formation of reactive oxygen species (ROS) and the
inhibited antioxidant system causes damage to molecules such as phospholipids, proteins and
DNA(16). Antioxidants prevent ROS formation, intercepting the formation of reactive species,
eliminating molecules damaged by apoptosis, capturing reactive metabolites, and converting
them to less or non-toxic products(17,18). ROS can cause lipoperoxidation, DNA mutations,
and protein inactivation, causing disorders in cell metabolism and contributing to the
appearance of diseases in animals(19). Lipoperoxidation damages cell membranes, receptors,
and enzymes, increasing permeability and causing cell death. Lipoperoxidation products,
such as unsaturated aldehydes, inactivate proteins, leading to DNA adducts and
mutagenesis(20,21).
There are different forms against ROS, such as low molecular weight oxidant scavengers
(ascorbic acid, tocopherols, urates, thiols), enzymes such as superoxide dismutase (SOD),
glutathione peroxidase (GSH-Px), catalase (CAT), pyridoxines, reductases of methionine
sulfoxide (MetSO), disulfide reductases, sulfiredoxins, proteasomes, lysosomes, DNA repair
enzymes, phospholipases and lastly, non-enzymatic defenses like reduced glutathione
(GSH)(21,22). The selenoproteins are distributed in the body, catalyzing oxidation-reduction
reactions(23) and protecting against oxidative damage. Oxidative stress in the body can be
measured in the blood, through the concentration and activity of antioxidants that circulate
in this tissue(22,24), or with the measurement of the products formed by the oxidation of
molecules, for example, aldehydes like the thiobarbituric acid reactive substances
(TBARS)(20).
Oxidative stress biomarkers indicate the oxidative balance in the body(25). The deficiency or
administration of Se to animals modifies the concentration of biomarkers such as GSH and
TBARS(26). When Se levels are low and oxidative stress levels increase, GSH levels rise to
prevent cellular liperoxidation(19,27). Finally, old animals increase their erythrocyte levels
GSH to control OE as a result of age, unlike young animals(28). On the other hand, it has been
observed that when there is an increase in aldehyde concentrations, it is due to the decrease
in antioxidant activity(29). Kohen et al (30) observed a positive correlation between the increase
in TBARS, lipoperoxidation and cellular damage in the organism. Elsheikh et al(31)
supplemented Se in goats, measured concentrations of TBARS such as malondialdehyde
(MDA) and observed that supplementation reduces the levels of this aldehyde, improving the
activity of antioxidants. This review hypothesized that an association may exist between the
levels of oxidative stress biomarkers in the blood of goats with and without Se supplement.
The objective of this study was to evaluate the effect of Se administered through intraruminal
boluses in goats and to correlate it with the levels of the mineral and biomarkers of oxidative
stress in blood.
85
Preparation of intraruminal boluses
The manufacture of the Se and placebo boluses was carried out by granulation by fusion(14).
Sodium selenite was used as a source of selenium, and sodium sulfamethazine was used as a
source for sulfamethazine, a lipid excipient to control the release of the active principles and
a densifier excipient to achieve adequate density. Boluses of sodium selenite at 12 g weight,
1.4 cm wide, 5 cm long and 0.95 thickness measurements, boluses Se-SMZ at 20 g weight,
2.1 cm wide, 5.2 cm long and 1.3 thickness measurements and boluses placebo at 12 g
weight,1.3 cm wide, 4.5 cm long and 1.2 thickness measurements.
Animals and treatments
Fifteen (15) goat kids from 8 to 9 wk old from the goat production module of the Facultad
de Estudios Superiores Cuautitlán (FESC) of Alpine breed with an average weight of 13.7
kg were used. The goat kids were isolated for adaptation in the pens of the FESC
experimentation unit; after one month of adaptation the kids were randomly divided into
three groups: Selenium group (n= 5), a sodium selenite bolus was administered per animal
orally, with a content equivalent to 90 mg of Se: group Se-SMZ (n= 5). A bolus with sodium
selenite and sodium sulfamethazine was administered per animal, with a content equivalent
to 90 mg of Se and 4 g of sulfamethazine: Placebo group (n= 5); placebo bolus was
administered per animal orally, without any active ingredient. The experiment was carried
out with the approval of the Internal Committee for the Care and Use of Experimental
Animals CICUAE FESC C11_02.
Sampling
Blood samples were collected by puncturing the jugular vein using sterile BD Vacutainer®
needles 20G- X 38mm and 6 mL vacuum tubes with Heparin Vacutainer® BD; the samples
were collected on d-0 (before bolus administration), 1, 3, 5 and 24 h, the days 2, 4, 8, 11, 18,
25 and 32 after bolus dosification. The samples taken were stored at 4 ºC, once in the
laboratory, the samples were centrifuged at 2,500 rpm for 15 min. The plasma obtained was
separated in microtubes and stored at -20 ºC until its analysis.
Quantification of Se in plasma
For the quantification of Se in plasma, 0.5 g of each sample was weighed into a microwave
Teflon beaker, and acid digestion was carried out: 5 mL of Milli Q water, 2.5 mL of nitric
acid (55 %) and .01 mL of H2O2 at 30 %, left for 30 min at room temperature and digestion
86
was carried out in a MARS microwave oven-EMC digestion. The digested samples were
transferred into 25 mL flasks and were brought to capacity with 7M HCl. The samples were
evaluated in a Varian® hydride generator atomic absorption spectrophotometer and
compared with the reference curve.
Quantification of TBARS
One hundred (100) µL of plasma were taken, 100 µL of 2.5 % perchloric acid were added
and it was left at room temperature for 10 min; they were centrifuged for 15 min at 1,200
rpm at 4 °C, 100 µL of the supernatant were mixed with 100 µL of thiobarbituric acid
0.67 %; they were incubated at 90 °C for 30 min. The samples were read on a UVvisCary100
Varian® spectrophotometer at a wavelength of 532 nm.
Quantification of reduced glutathione GSH in erythrocytes
A methodology was implemented to evaluate the content of GSH using the Ellman
reagent(32). An aliquot of 400 µL was taken from each sample, 400 µL of 5 % sulfosalicylic
acid were added to them, they were left at room temperature for 30 min at 4 ºC, they were
centrifuged at 13,500 rpm 4 ºC for 15 min. An aliquot of 200 µL was taken of each of the
supernatants and placed in a polystyrene Medium Bindding costar® microplate, 100 µL of
the reaction mixture (0.52 mM DTNB and 0.15 mM EDTA) were added and left at room
temperature for 5 min. The microplate reader (96 wells) by mrcScientific Instruments® was
used to read samples at 405 nm.
The data were analyzed as a completely randomized design with a 3 × 12 factorial

arrangement, using a repeated measures analysis over time. The independent variables were
treatment and sampling time, and the dependent variables were blood selenium
concentration, TBARS levels, and GSH levels. The analysis of results was carried out with
the statistical software Statgraphics Centurion XV, version 15.2.05. Statistical significance
considered for all comparisons of P<0.05. The following model was used:
Yijk =μ + Ti + Sj + (T × S)ij + ξijk.

Where:
Yijk= variable response,
μ= general mean,
Ti= effect of treatment (Intraruminal boluses treatment),
Sj= effect of sampling time,
(T× S)ij= effect of T × S interaction at i, j levels,
87
ξij= random error.
Results
In the study, the 0-hour measurement includes the average of all the animals. After
administering boluses of Selenium and Se-SMZ orally to the goat kids, the hematic Se levels
increased from 3 h after dosing. This caused a significant difference (P<0.05) between the
Selenium group and the Se-SMZ group until 3 and 24 h. Placebo group had a mean of 0.18
µg Se in plasma before 24 h. After this time, Se levels was variable decreased up to 32 d
(Figure 1).
All groups had variability in plasma TBARS levels without showing a constant trend among
groups. Mainly, the Placebo group had a lower content of plasma TBARS at 1 h after dosing.
However, at 24 h after dosing, the range of plasma TBARS increased vs selenium group and
Se-SMZ (P<0.05). Se-SMZ group had the highest TBARS level at 2, 4, 8 and 11d vs
Selenium and Placebo groups, then all groups decreased plasma TBARS levels up to 32 d
without significant difference (P>0.05) (Figure 2).
GSH levels did not show relevant significant differences between groups. The placebo group
had the lowest (6.92 nmol) and the highest (18.97 nmol) GSH content at 2 d and 1 h,
respectively. Selenium group had a range of 9.57 nmol (25 d) and 16.96 nmol (4 d). Se-SMZ
group had a range of 12.42 nmol (1h) and 17.57 (9 h) (Figure 3).
Discussion
Boluses containing Se and Se-SMZ increased blood plasma Se levels for up to 24 h, followed
by a gradual decrease over the next 32 d with no significant difference observed between the
three study groups (P>0.05). The placebo group had levels less than 0.1 ng/g Se in plasma at
4, 11 and 25 d. Some authors suggest that the adequate level of Se in goat blood is 0.11-0.12
ng/g(33,34). However, Field Pavlata et al(35) reported levels of 0.07-0.01 ng/g without
observing signs of deficiency. Se levels of 0.02-0.03 ppm are considered inadequate since
they cause nutritional muscular dystrophy(33). The animals in this study showed no signs of
Se deficiency during the clinical examination. After taking Se supplements, no signs of
toxicity were observed in the got kids. Plasma Se values are lower than those in erythrocytes
but show greater variability over time due to immediate tissue distribution(35,36). According
to the study by Field Stefanowicz et al(37), the amount of selenium in the plasma is commonly
used as a reliable indicator of its levels in the body. Although, the selenium content in the
whole blood is also measured, it should be noted that the risk of hemolysis can lead to false
readings in the plasma. This is because selenium is present in red blood cells. Therefore, it is
important to exercise caution while collecting samples from animals(38). On the other hand,
88
boluses are an alternative to supplement Se to ruminants. In this study, the bolus remained
active in kids for up to 32 d, reaching maximum levels of 0.8 ng/g of Se in plasma. Other
studies in sheep indicate that boluses with Se maintained an active release for up to 3 mo
with hematic Se levels of 148 and 350 ng/g Se, respectively(39,40). The difference perhaps was
due to the types of materials that were used in the manufacture of intraruminal boluses since
the density of the boluses influences the permanence of the bolus in the reticulo-rumen
avoiding regurgitation. There is little information associated with the release of Se, the
thickness and the types of materials used to design the boluses.
TBARS concentration is a method used to estimate oxidative stress. In this study, there was
wide variability in plasma TBARS levels without showing a trend between treatments. All
groups decreased TBARS levels up to 32 d without significant difference (P>0.05). Elsheikh
et al(31), supplemented Se in goats and measured oxidative stress biomarkers. They observed
that TBARS concentration was reduced, and antioxidant activity improved in the animals.
On the other hand, Chung et al(41) supplemented Se in goats, indicating a lack of significant
differences in the concentrations of TBARS in the intestine, serum, liver and muscle, between
the supplemented groups and the control data similar to the present study. Various factors
can increase lipoperoxidation in goats, such as peripartum, lactation, diet, antioxidant
supplementation(19,34). The presence of pathologies, exposure to toxins or administration of
drugs, increase the levels of TBARS in the animal organism(42). It is essential to mention that
reactive oxygen species are formed in a normal physiological state, a consequence of the
metabolic process(24,30,43), where the variations depend on the metabolism of each organism,
a significant increase in TBARS is associated with a deficiency in the antioxidant system.
Shi et al(34) report a higher concentration of TBARS in selenium deficient animals than
animals supplemented with different sources of Se. In this study, the experimental units did
not present pathologies associated with stress, and an apparent effect was not observed in
animals supplemented with Se and the concentrations of TBARS.
GSH levels also did not show relevant significant differences between treatments. Celi(19)
mentions that in Se deficiency, the synthesis of GSH increases, a physiological process where
the requirement of cysteine is increased until it is exhausted, once depleted, the GSH
decreases.
A decrease in GSH in the blood has been reported in diseases(44-46). Reduction of GSH levels
in the blood is also associated with increased GSH-Px activity and utilization in the GST-
catalyzed reaction(46). Gresakova et al(47) supplemented Se in small ruminants with a history
of deficiency, observing a correlation between Se concentration and GSH-Px activity; the
decrease in the activity of this enzyme can lead to oxidative stress. The lack of variation in
the estimation of GSH, perhaps due to an increase in the levels of oxidative stress, due to the
low levels of Se in plasma, triggering a more significant cellular peroxidation, tends to
89
increase the levels of GSH(48). For example, in old and Se-deficient animals the erythrocyte
GSH increases(28).
Selenium boluses and Se-SMZ increased plasma Se levels. There was wide variability in
plasma TBARS levels, showing no trend between treatments. There were no pathologies
associated with stress, and an apparent effect on supplemented Se and TBARS concentrations
was not observed. GSH levels also did not show relevant significant differences between
treatments. The boluses during nine weeks were an excellent alternative to increase Se to
ruminants.
Acknowledgements
The authors thank the CONACyT for the doctoral scholarship number 349865 and the
financial support obtained through the program PAPIIT IG200923 of DGAPA – UNAM.
Literature cited:
1. Mehdi Y, Dufrasne I. Selenium in cattle: A review. Molecules 2016;21.
doi:10.3390/molecules21040545.
2. Hoque MN, Das ZC, Rahman ANMA, Hoque MM. Effect of administration of vitamin E,
selenium and antimicrobial therapy on incidence of mastitis, productive and
reproductive performances in dairy cows. Int J Vet Sci Med 2016;4:63–70.
doi:10.1016/j.ijvsm.2016.11.001.
3. Qazi IH, Angel C, Yang H, Zoidis E, Pan B, Wu Z, et al. Role of selenium and
selenoproteins in male reproductive function: A review of past and present evidences.
Antioxidants 2019;8. doi:10.3390/antiox8080268.
4. Rodriguez AM, Schild CO, Cantón GJ, Riet-Correa F, Armendano JI, Caffarena RD, et al.
White muscle disease in three selenium deficient beef and dairy calves in Argentina and
Uruguay. Cienc Rural 2018;48. doi:10.1590/0103-8478cr20170733.
5. Ramírez-Bribiesca JE, Tórtora JL, Huerta M, Aguirre A, Hernández LM. Diagnosis of

selenium status in grazing dairy goats on the Mexican plateau. Small Ruminant Res
2001;41(1):81–85. doi:10.1016/S0921-4488(01)00188-2.
6. Hefnawy AEG, Tórtora-Pérez JL. The importance of selenium and the effects of its
deficiency in animal health. Small Ruminant Res 2010;89:185–192.
doi:10.1016/j.smallrumres.2009.12.042.
90
7. Niwińska B, Andrzejewski M. Effects of selenium supplement forms on the diet–cow–calf

transfer of selenium in Simmental cattle. Czech J Anim Sci 2017;62:201–210.
doi:10.17221/86/2016-CJAS.
8. Panev A, Hauptmanová K, Pavlata L, Pechová A, Filípek J, Dvorák R. Effect of

supplementation of various selenium forms and doses on selected parameters of ruminal
fluid and blood in sheep. Czech J Anim Sci 2013;58:37–46. doi:10.17221/6524-cjas.
9. Academies NRC of Tn. Nutrients requirements of small sheep, goats, cervids and new
world camelids. Washington DC: The National Academies Press; 2007.
10. Bayril T, Yildiz AS, Akdemir F, Yalcin C, Köse M, Yilmaz O. The technical and financial
effects of parenteral supplementation with selenium and vitamin E duting late pregnancy
and the early lactation period on the productivity of dairy cattle. Asian-Australian J
Anim Sci 2015;28:1133–1139. doi:10.5713/ajas.14.0960.
11. Díaz-Sánchez VM, Rodríguez-Patiño G, Álvarez-Ávila G, Ramírez-Bribiesca JE, Silva-

Mendoza R, Revilla-Vazquez AL, et al. Evaluation of intraruminal boluses dosed with
sulfamethazine and selenium in goat kids naturally infected with Eimeria spp. J Appl
Anim Res 2020;48:244–251. doi:10.1080/09712119.2020.1772269.
12. Kamada H. Effects of selenium-rich yeast supplementation on the plasma progesterone

levels of postpartum dairy cows. Asian-Australasian J Anim Sci 2017;30:347–354.
doi:10.5713/ajas.16.0372.
13. León-Cruz M, Ramírez-Bribiesca E, López-Arellano R, Miranda-Jiménez L, Rodríguez-

Patiño G, Díaz-Sánchez VM, et al. Controlled-release intraruminal boluses. Rev Mex
Cienc Pecu 2020;11(2):498–516. doi:https://doi.org/10.22319/rmcp.v11i2.5349.
14. Revilla-Vázquez A, Ramírez-Bribiesca E, López-Arellano R, Hernández-Calva LM,

Tórtora-Pérez J, García-García E, et al. Supplement of selenium with intraruminal bolus
of sodium selenite in sheep. Agrociencia 2008;42:629–635.
15. Kruzhel B, Vovk S, Małgorzata B, Nowakowska E, Sergei P. Selenium in the diet of

ruminants. Acta Sci Pol Zootech 2014;13:5–16.
16. Konigsberg M. Radicales libres y estrés oxidativo: aplicaciones médicas. 1a ed. México,
DF: Manual Moderno; 2008.
17. Long H, Ting H, Shabnam F, Linbao J, Tianyi L, Xi M. Antioxidants maintain cellular

redox homeostasis by elimination of reactive oxigen species. Cell Physiol Biochem
2017;44:532-553.
91
18. Galano A. Free radicals induced oxidative stress at a molecular level: the current status,
challenges and pespectives of computational chemistry based protocols. J Mex Chem
Soc 2015;59.
19. Celi P. The role of oxidative stress in small ruminants’ health and production. Rev Bras
Zootec 2010;39:348–363. doi:10.1590/S1516-35982010001300038.
20. Grotto D, Santa-Maria L, Valentini J, Paniz C, Schmitt G, Garcia SC,et al. Importance
of the lipid peroxidation biomarkers and methodological aspects for malondialdehyde
quantification. Quim Nova 2009;32:169–174. doi:10.1590/S0100-
40422009000100032.
21. Rahmanto AS, Davies MJ. Selenium-containing amino acids as direct and indirect
antioxidants. IUBMB Life 2012;64:863–871. doi:10.1002/iub.1084.
22. Nazifi S, Saeb M, Ghafari N, Razeghian I, Razavi SM, Vosoughi F, et al. Reference
values of oxidative stress parameters in adult native iranian goats. Bulg J Vet Med
2009;12:119–124.
23. Haeinlein GFW, Aanke M. Mineral and trace element research in goats: a review. Small
Rumianant Res 2011;95:2-19.
24. Birben E, Sahiner UM, Sackesen C, Erzurum S, Kalayci O. Oxidative stress and
antioxidant defense. World Allergy Organ J 2012;5:9–19.
doi:10.1097/WOX.0b013e3182439613.
25. Ramírez-Bribiesca JE, Tortora JL, Huerta M, Hernández LM, López R, Crosby MM.
Effect of selenium-vitamin E injection in selenium-deficient dairy goats and kids on the
Mexican plateau. Arq Bras Med Vet Zootec 2005;57:77–84. doi:10.1590/s0102-
09352005000100011.
26. Tapiero H, Townsend DM, Tew KD. The antioxidant role of selenium and seleno-
compounds. Biomed Pharmacother 2003;57:134–144. doi:10.1016/S0753-
3322(03)00035-0.
27. Sierra H, Cordova M, Chen CSJ, Rajahyaksha M. Confocal imaging-guided laser ablation
of basal cell carcinomas: An ex vivo study. J Invest Dermatol 2015.
doi:10.1038/jid.2014.371.
28. Tekeli H, Kiral F, Bildik A, Yilmaz M, Kaçamakli Z. Effect of aging on enzymatic and
non-enzymatic antioxidant status in Saanen goats. Vet Zootech 2015;71:67–71.
29. Kizil O, Ozdemir H, Karahan M, Kizil M. Oxidative stress and alterations of antioxidant
status in goats naturally infected with Mycoplasma agalactiae. Rev Med Vet (Toulouse)
2007;158:326–330.
92
30. Kohen R, Nyska A. Oxidation of biological systems: Oxidative stress phenomena,

antioxidants, redox, reactions, and method for their quantification. Toxicol Pathol
2002;30:620–650. doi:10.1080/0192623029016672.
31. Elsheikh AH, Al-Hassan MJ, Mohamed HE, Abudabos AM. Effect of injectable sodium
selenite on the level of stress biomarkers in male aardi goats. Indian J Anim Res
2014;48:239. doi:10.5958/j.0976-0555.48.3.051.
32. Eyer P, Podhradský D. Evaluation of the micromethod for determination of glutathione

using enzymatic cycling and Ellman’s reagent. Anal Biochem 1986;153:57–66.
doi:10.1016/0003-2697(86)90061-8.
33. Ramírez-Bribiesca JE, Tórtora JL, Hernández LM, Huerta M. Main causes of mortalities
in dairy goat kids from the Mexican plateau. Small Ruminant Res 2001a;41:77–80.
doi:10.1016/S0921-4488(01)00191-2.
34. Shi L, Xun W, Yue W, Zhang C, Ren Y, Shi L, et al. Effect of sodium selenite, Se-yeast
and nano-elemental selenium on growth performance, Se concentration and antioxidant
status in growing male goats. Small Ruminant Res 2011;96:49–52.
35. Pavlata L, Mišurová L, Pechová A, Dvořák R. Comparison of organic and inorganic

forms of selenium in the mother and kid relationship in goats. Czech J Anim Sci
2012;57:361–369.
36. Ensley S. Evaluating mineral status in ruminant livestock. Vet Clin North Am - Food
Anim Pract 2020;36:525–546. doi:10.1016/j.cvfa.2020.08.009.
37. Stefanowicz FA, Talwar D, O’Reilly DSJ, Dickinson N, Atkinson J, Hursthouse AS, et
al. Erythrocyte selenium concentration as a marker of selenium status. Clin Nutr
2013;32:837–842. doi:10.1016/j.clnu.2013.01.005.
38. Qin S, Gao J, Huang K. Effects of different selenium sources on tissue selenium
concentrations, blood GSH-Px activities and plasma interleukin levels in finishing
lambs. Biol Trace Elem Res 2007;116:91–102. doi:10.1007/s12011-007-9019-x.
39. Gutiérrez-Olvera C, Spross-Suárez A, Rosiles-Martínez R, Ducoing-Watty A, Ortiz

Hernández A. Blood and fecal selenium in sheep with the use of inorganic intraruminal
boluses. Vet Méx 2005;36:313–324.
40. Blanco MÁ, Spross AK, Rosiles R. Evaluación de comprimidos intrarruminales de

selenio por concentración sanguínea y lanar de corderas semiestabuladas. Vet Mex
2000;31:121–127.
93
41. Chung JY, Kim JH, Ko YH, Jang IS. Effects of dietary supplemented inorganic and
organic selenium on antioxidant defense systems in the intestine, serum, liver and
muscle of Korean native goats. Asian-Australasian J Anim Sci 2007;20:52–59.
doi:10.5713/ajas.2007.52.
42. Celi P. Biomarkers of oxidative stress in ruminant medicine. Immunopharmacol

Immunotoxicol 2011;33:233–240. doi:10.3109/08923973.2010.514917.
43. Hawkes WC, Alkan Z. Regulation of redox signaling by selenoproteins. Biol Trace Elem
Res 2010;134:235–251. doi:10.1007/s12011-010-8656-7.
44. Ballatori N, Krance SM, Notenboom S, Shi S, Tieu K, Hammond CL. Glutathione
dysregulation and the etiology and progression of human diseases. Biol Chem
2009;390:191–214. doi:10.1515/BC.2009.033.
45. Liu SM, Eady SJ. Glutathione: Its implications for animal health, meat quality, and health
benefits of consumers. Aust J Agric Res 2005;56:775–780. doi:10.1071/AR05053.
46. Wu G, Fang YZ, Yang S, Lupton JR, Turner ND. Glutathione metabolism and its
implication for health. J Nutr 2004;134:489–492.
47. Gresakova L, Cobanova K, Faix S. Selenium retention in lambs fed diets supplemented
with selenium from inorganic or organic sources. Small Ruminant Res 2013;111:76–82.
48. Richie JP, Das A, Calcagnotto AM, Aliaga CA, El-Bayoumy K. Age related changes in
selenium and glutathione levels in different lobes of the rat prostate. Exp Gerontol
2012;47:223–228. doi:10.1038/jid.2014.371.
94
Figure 1: Selenium concentrations in plasma during 1 to 24 hours (bars on the left) and 2 to 32 days (bars on the right)
95
Figure 2: Plasma TBARS levels during 1 to 24 hours (bars on the left) 2 to 32 days (bars on the right)
96
Figure 3: Estimates of reduced GSH in plasma during 1 to 24 hours (bars on the left) 2 to 32 days (bars on the right)
97
Article
Prevalence and intensity of varroosis and nosemosis of honey bees (Apis

mellifera) in six regions of the state of Jalisco, Mexico
Ana K. Ramos-Cuellar a
Álvaro De la Mora b
Francisca Contreras-Escareño c
Nuria Morfin d
José M. Tapia-González e
José O. Macías-Macías e
Tatiana Petukhova f*
Adriana Correa-Benítez a
Ernesto Guzman-Novoa b
a
Universidad Nacional Autónoma de México. FMVZ, Departamento de Medicina y
Zootecnia de Abejas, Cd. Universitaria, Ciudad de México, 04510, México.
b
University of Guelph. School of Environmental Sciences, Guelph, ON, Canadá.
c
Universidad de Guadalajara. CUCSur, Depto. Prod. Agríc. Autlán, Jalisco, México.
d
University of British Columbia. Dept. Biochem. Mol. Biol., Vancouver, BC, Canadá.
e
Universidad de Guadalajara. CUSur, Depto. Cienc. Natur., Cd. Guzmán, Jal., México.
f
University of Guelph. Department of Population Medicine, Guelph, ON, Canadá.
*Corresponding author: tpetukho@uoguelph.ca
98
Abstract:
Jalisco is one of the main honey bee producing states in Mexico. However, information on
the parasitoses that affect the productivity of honey bee (Apis mellifera) colonies in the state
is limited and addresses only a few regions. The objective of this study was to determine the
prevalence and intensity of two parasitic diseases of Apis mellifera —varroosis (Varroa
destructor) and nosemosis (Vairimorpha spp.)— in six regions of Jalisco. Bees from 365
colonies collected during the spring were analyzed. Varroosis was the most frequent
parasitosis (90 %), and nosemosis was the least frequent (15 %). The infestation or infection
levels of these parasitoses were generally low: <5 % (mites per 100 bees) for varroosis, and
<310,000 spores/bee for nosemosis. The regions with the highest prevalence and intensity of
V. destructor were the Highlands, the Center, and the South, while infections by Vairimorpha
ceranae —the only species of the fungus found— were significantly higher in the
Southeastern and Southern regions. It is advisable to carry out epidemiological studies at
other times of the year in order to detect possible seasonal effects of parasitoses for the
purpose of designing strategies for their control.
Keywords: Apis mellifera, Varroa destructor, Vairimorpha ceranae, Jalisco, Mexico.
Introduction
Beekeeping in Mexico is an activity with a high ecological, social and economic impact.
Western honey bees (Apis mellifera) provide an important environmental service by
pollinating native flora, which helps maintain ecosystems, and pollinating economically
important crops(1). In addition, beekeeping is an important source of employment and income
for rural areas and of foreign currency for the country through the export of honey(2). Mexico
is one of the leaders in the production and export of honey in the world, and Jalisco is one of
the main honey producing states in the country. Jalisco reached the third place in honey
production in 2021 with 6,073 t, with an inventory of over 145 thousand hives (3).
Honey bee diseases cause losses estimated at approximately US$6 million per year in
Mexico(4). It is therefore important to know their prevalence and distribution in order to
control them. Among the diseases and parasitoses affecting honey bees, varroosis caused by
the ecto-parasitic mite Varroa destructor is the most common. This parasite is considered to
be the health issue that causes most damage to the beekeeping industry worldwide(5-7). The
mite feeds on the hemolymph and fat tissue of the bee; it inhibits its immune system, shortens
99
its life, and is a vector of viruses(7,8-11). Varroa destructor was first reported in 1992 in
Veracruz, Mexico(12), and is currently distributed across the country(13). Another important
parasitosis is nosemosis, which is caused by two species of microsporidia fungi: Vairimorpha
apis and V. ceranae. These fungi infect the epithelial cells of the bee ventricle, causing
digestive disorders that weaken and shorten the life of infected insects and reduce honey
production(14,15). Vairimorpha apis has existed for many years in Mexico, but V. ceranae was
detected in 2010(16), although evidence of its presence since 1995 was later obtained in the
state of Mexico(17).
Regarding the sanitary status of honey bee colonies in the state of Jalisco, the prevalence and
degree of infestation of the mite V. destructor were recently reported in two regions of the
state(18). The average prevalence was 88 % and the infestation level was 5.2 % (number of
mites in 100 bees). In addition to the above, in Jalisco there is information on the presence
and intensity of infections by Vairimorpha spp. fungi in municipalities in the south and
southeast of the state, but not in other regions. 83.7 % of the positive samples showed light
infections(19).
For beekeeping purposes, the state of Jalisco has been divided into six different regions that
vary in topography and climate, and include the Highlands, Central, Northern, Sierra Amula,
Southern and Southeastern regions. More than half of the state's producers and hives are
located in the South and Southeast regions(20).
Since the existing information on the presence of parasitoses affecting honey bees in the state
of Jalisco is partial and available only for some regions, it was considered relevant to generate
updated information on the level of infestation or infection of two of the main parasitoses
affecting honey bees in Mexico(13) and on whether there is any relationship between them
and the different regions of the state. Therefore, the objective of this study was to determine
the prevalence and level of varroosis and nosemosis infestation or infection in honey bee
samples from six regions of the state of Jalisco, Mexico.
Sampling
Brood and adult bee samples were collected from colonies located in 30 municipalities within
the six beekeeping regions of the state of Jalisco (Table 1) at the beginning of spring, and
during March, April and May 2018. Two or three apiaries were visited in each municipality,
and five colonies were randomly selected from each apiary. A total of 365 colonies were
sampled, from each of which the following samples were collected: 1) a sample of
approximately 300 adult bees collected from the brood nest in a 250 ml pet container with
100
70% ethanol for diagnosis and determination of V. destructor infestation levels in adult bees;
2) a comb sample (10x10 cm) containing capped brood with pigmented-eye pupae, which
was transported in a cooler with refrigerants for diagnosis and determination of V. destructor
infestation levels in the brood; 3) a sample of approximately 70-80 adult bees in a 250 ml pet
container with 70% ethanol, obtained from the entrance of each hive, for the diagnosis and
determination of Vairimorpha spp. infection levels.
Table 1: Regions, municipalities, and number of honey bee samples collected

Region Municipality No. Samples
Atotonilco 11
Lagos de Moreno 10
Higlands
Tepatitlán 15
Zapotlanejo 15
Cocula 15
Jamay 13
Center
Tlajomulco 15
Tonalá 15
Autlán 10
Cuautitlán 10
Sierra Amula La Huerta 10
Mascota 15
Tonaya 10
Colotlán 5
Encarnación de Díaz 15
Huejúcar 5
North
Santa María 5
Teocaltiche 15
Yahualica 15
Gómez Farias 8
San Gabriel 10
Sayula 15
South Tapalpa 16
Tolimán 5
Zapotiltic 15
Zapotlán el Grande 12
Concepción de Buenos Aires 15
Pihuamo 15
Southwest
Tamazula 15
Tecalitlán 15
101
Sample processing
Tests for varroosis in brood, varroosis in adult bees, and nosemosis were performed at the
Bee Research Center (Centro de Investigaciones en Abejas, CIABE) located at the Southern
University Center (Centro Universitario del Sur, CUSur) of the University of Guadalajara, in
Zapotlan el Grande, Jalisco, Mexico. DNA analysis of spores from Vairimorpha spp. positive
samples was also performed in order to differentiate between V. apis and V. ceranae. These
analyses were performed at the Honeybee Research Centre of the School of Environmental
Sciences, University of Guelph, Guelph, Ontario, Canada.
Diagnosis and quantification of Varroa destructor in adult bees and brood
For adult bees, the ethanol wash technique was used(21). The container of each sample was
shaken for 3 min to separate the mites from the bees, and the contents were poured into a
strainer with 8-frame/inch wire mesh. A plastic container covered with a white cotton cloth
was placed under the strainer. The bees were retained on the wire mesh, and the mites, on the
white cloth. Subsequently, the mites and bees were counted to determine the percentage of
adult infestation (number of mites in every 100 bees). In order to determine mite infestation
in the brood, the procedure was performed by direct observation under a stereoscopic
microscope. In each comb sample, 200 cells were uncapped to look for the presence of V.
destructor in order to count the number of cells with mites present and thus determine the
percentage of infested cells.
Diagnosis and quantification of Vairimorpha spp.
Infection by Vairimorpha spp. was diagnosed and quantified by observation and counting of
parasite spores(22). Briefly, the abdomens of 60 bees per sample were macerated with 60 ml
of H2O in a mortar, and a drop of the macerate was placed on a slide to observe the parasite
spores under an optical microscope (Olympus CX31; CDMX, Mexico) at 400 X. In positive
samples, the intensity of the infection was determined by counting the spores in a Neubauer
chamber.
Nosemosis-positive samples were also subjected to molecular diagnosis in order to

differentiate between V. apis and V. ceranae. Spore DNA extraction and PCR procedures
were performed according to a standard protocol(23). For PCR amplification, a set of three
specific primers was used in a triplex PCR consisting of co-amplification of the 16S rRNA
gene from V. apis and V. ceranae, with the honey bee ribosomal protein S5 (RpS5) gene as
a control for the reaction.
102
PCR reactions were performed on an Arktik thermocycler (Thermo Scientific; Missisauga,

ON, Canada). Each reaction contained 1.5 µL of 10x pH PCR buffer (New England BioLabs;
Pickering, ON Canada), 0.5 µL of 10 nM dNTPs (Bio Basic Inc; Markham, ON Canada), 1
µl of each 10 µM oligonucleotide, 2 µL of DNA, 0.2 µL of Taq polymerase 5 U/µl (Applied
Biological Materials Inc.), and 8.8 µL of nuclease-free H2O (Invitrogen; Burlington, ON,
Canada). The primer sequences used, as well as the amplification cycles were those described
by Hamiduzzaman et al(23).
PCR products were separated by electrophoresis on 1.1% agarose gels and stained with
ethidium bromide. The amplified bands were captured with a digital camera inside a UV
Transilluminator (Benchtop-ItM Imaging System; Upland, CA, EUA).
Statistical analyses
To determine whether there were differences between regions for the prevalence of
parasitoses in the studied colonies, the data were analyzed using tests of equality of
proportions and the Benjamini-Hochberg correction. Before analyzing and comparing such
continuous variables as the intensity of infestations or infections, the data were subjected to
Shapiro-Wilk and Bartlett tests for the purpose of analyzing the assumptions of normality
and homoscedasticity, respectively. The data did not have a normal distribution and were not
homoscedastic; therefore, they were analyzed with nonparametric statistical tests. In order to
compare the intensity of varroosis and nosemosis between regions, the data were subjected
to Kruskal-Wallis tests. When the differences were significant, pairwise comparisons of
treatments were made using Dunn's test and the Benjamini-Hochberg correction. All
statistical analyses were performed with the R 3.3.1 software (Foundation for Statistical
Computing, Vienna, Austria).
Results
The most prevalent parasitosis in Jalisco was varroosis, which was detected in 90 % of the
sampled colonies, while nosemosis was detected only in 15 % of them (Table 2). Of the two
Vairimorpha species infecting honey bees, only V. ceranae was detected (Figure 1), while V.
apis was not. Table 2 shows the intensity of the diagnosed etiological agents.
103
Table 2: Prevalence and average intensity of parasitosis (infestation or infection) from

parasites affecting honey bee colonies in the state of Jalisco, Mexico
Parasites N Prevalence (%) Intensity ± SE
Varroa destructor/brood 365 90.1 4.50 ± 0.341
Varroa destructor/adults 365 90.1 4.15 ± 0.191
Vairimorpha ceranae 365 14.5 161,046 ± 38,0552
SE= standard error.

1
Number of mites in 100 brood cells or in 100 adult bees.
2
Number of spores per bee.
Figure 1: Photograph of an agarose gel showing bands of 218 base pairs of a Vairimorpha
ceranae ribosomal RNA gene fragment in columns 1 to 5 and 7 to 10. A positive control
(PC) is used in the RT-PCR reaction
In the results by region, the prevalence of V. destructor in both brood and adult bees was
significantly higher in the Highlands, Center, and South than in the North (P< 0.05; Tables
3 and 4). In addition, the intensity of V. destructor infestations in brood also varied among
regions. The most intense parasitism of the mite in the brood was found in colonies in the
Southern and Highlands regions with 7.1 ± 1.0 % and 5.6 ± 0.8 %, respectively. These
infestation levels were significantly higher than those found in the colonies of the other
regions, except for the Central region (2= 43.0, sd= 5, P<0.01; Table 3). In adult bees, there
were also differences between regions. The most intense parasitism by V. destructor was
again found in colonies of the Southern and Highlands regions, with 4.6 ± 0.4 % and 5.9 ±
0.5 %, respectively. The mite infestation intensities of adult bees in colonies in these two
regions and the Central region were significantly higher than those of bees from the Northern
104
region, at only 2.7 ± 0.4 %, but did not differ from the infestation intensities found in colonies
of the other regions (2= 34.3, sd= 5, P<0.01; Table 4).
Table 3: Prevalence and average intensity of Varroa destructor parasitosis in the brood of
honey bee colonies in different regions of the state of Jalisco, Mexico
Region N Prevalence (%) Intensity ± SE1
Highlands 51 88.2a 5.60 ± 0.83a
Center 58 81.0a 4.15 ± 0.53ab
Sierra Amula 55 56.4b 2.31 ± 0.61c
North 60 65.0b 3.84 ± 0.81bc
South 81 86.4a 7.07 ± 1.01a
Southeast 60 66.7b 3.09 ± 0.60c

SE= standard error.
1
Number of mites in 100 brood cells.
abc
Different letters indicate significant differences (P<0.05).
Table 4: Prevalence and average intensity of Varroa destructor parasitosis in adult workers
of honey bee colonies in different regions of the state of Jalisco, Mexico
Highlands 51 98.0a 5.89 ± 0.55a
Center 58 98.3a 4.50 ± 0.49ab
Sierra Amula 55 90.9a 3.60 ± 0.42bc
North 60 75.0b 2.70 ± 0.43c
South 81 92.6a 4.61 ± 0.42ab
Southeast 60 86.7ab 3.72 ± 0.45bc

SE= standard error.
1
Number of mites in 100 adult bees.
abc
Different letters indicate significant differences (P< 0.05).
105
For nosemosis, the prevalence of parasitosis caused by V. ceranae was relatively low, ranging
from 7 to 18 %, with no significant differences between regions (P>0.05, Table 5). The
intensity of infection caused by this parasite was relatively low and ranged between 39,375
± 10,625 to 309,091 ± 166,960 spores/bee in the positive colonies of the different regions
studied, among which there were significant differences for the level of infection (2= 11.1,
df= 5, P< 0.05).
Table 5: Prevalence and mean intensity of nosemosis (Vairimorpha ceranae) in adult

workers of honey bee colonies in different regions of the state of Jalisco, Mexico
Highlands 51 17.6 66,667 ± 11,024bc
Center 58 12.1 107,143 ± 22,961ab
Sierra Amula 55 18.2 130,000 ± 21,016a
North 60 6.7 39,375 ± 10,625c
South 81 17.3 189,286 ± 63,800a
Southeast 60 18.3 309,091 ± 166,960a

SE= standard error.
1
Number of spores per bee of the samples that tested positive.
abc
Different letters indicate significant differences (P<0.05).
Discussion
Varroosis was the most prevalent parasitosis, as it was diagnosed in 90 % of the colonies
sampled in Jalisco; however, the average levels of infestation by V. destructor were low, with
less than 5 % parasitism in both brood and adult bees. These results are in agreement with a
previous study carried out in the state, which found a prevalence of 88 % and an infestation
level of 5 % of the parasite in colonies located in the southern and southeastern regions of
Jalisco(18). This study, however, was broader, as it included regions of central and northern
Jalisco that were not studied in the aforementioned work.
In other regions of Mexico, results similar to those of this study have been observed. For
example, in the north of the country, in the state of Zacatecas, a varroosis prevalence of
88 % and an infestation level of 5 % in autumn and of 3.5 % in spring were reported(24).
Although the level of infestation was reported in different seasons, the results are not far from
those found in this study. In the central region of the country, in the State of Mexico, a 100%
106
prevalence of varroosis was found in five municipalities in the eastern zone, with the highest
infestation rate of 7.9 %, and the lowest, of 3.5 %(25). Alternatively, in southeastern Mexico,
specifically in the state of Yucatán, a varroosis prevalence of 62.9 % was found in honey bee
colonies with an infestation level of only 1.7 %(26). Both percentages are lower than the ones
reported in this study and in other Mexican states, possibly due to the fact that the
aforementioned studies were carried out in the central and northern states of the country
where the climate is temperate to cold, as opposed to Yucatan, where the climate is tropical.
The environment, together with the Africanization of honey bee colonies, is known to be one
of the most influential factors in V. destructor infestations(27). In Yucatan, the degree of
Africanization of bees is significantly higher than in other regions of the country(28). In
general, honey bee colonies located in temperate climates tend to be more susceptible to the
mite because they tend to have bees with predominantly European ancestry, in addition to
the stress caused by the winter weather conditions that affect the survival of colonies, because
during part of the winter, queen bees stop laying eggs or drastically reduce their laying rate
and, consequently, the adult bee population(29). In contrast, in tropical regions, honey bee
colonies are less affected by varroa mite infestations, largely because these regions are
dominated by African ancestry, which is strongly associated with characteristics that confer
honey bees a higher degree of resistance to the parasite compared to predominantly European
bees(24,30-32).
Although the prevalence of varroosis is high in Jalisco and other regions of the country, this
is an expected result because the behavior of the bees and their current management favor
the dispersion of V. destructor between colonies. Bees (worker bees and drones) frequently
enter other colonies, carrying mites with them(33). Also, the robbing behavior (robbing honey
from other colonies) of the bees favors the dispersion of the mite(7). In addition, the short
distance between hives in the apiaries favors the mite dispersion(34).
The average level of V. destructor infestation found in the colonies in Jalisco was generally
low, less than 5 %, as recommended by the Mexican standard for varroosis control(35).
However, in some regions, such as the South and Highlands, infestation levels were higher
than 5 %, while in the North they were lower than 4 %. This could be partly explained by the
density of bee hives in the various regions, as in the south, the largest number of bee hives in
the state is concentrated in a relatively small territorial extension compared to the other
regions, while in the north, there is a lower concentration of bee hives in a larger territorial
extension(20).
Among the implications of these results, in certain regions such as the South and Highlands,
the increased parasitism by V. destructor may affect colony development and honey
production, as demonstrated by Medina-Flores et al(36) and Emsen et al(37), who found that
colonies with more than 5 % infestation by V. destructor produced significantly less honey
than colonies with lower levels of parasitism. Arechavaleta-Velasco and Guzman-Novoa(38)
107
also found that colonies with 2 % infestation by V. destructor produced 65 % more honey
when treated, compared to colonies with 7 % infestation that were not treated. Therefore, it
is recommended that beekeepers in regions where high levels of varroosis (>5%) were found
monitor and use mite control measures in their colonies more frequently, keeping the number
of treatments to a minimum in order not to promote parasite resistance to acaricides.
Nosemosis was the least prevalent honey bee disease in the state of Jalisco, as it was
diagnosed in only 15% of the sampled colonies; in all positive samples only V. ceranae was
detected, and in no case V. apis. It is possible that V. ceranae has displaced V. apis, as seems
to have occurred in other countries(39,40); but it is also possible that V. ceranae has historically
been the only species of Vairimorpha present in Jalisco, which is difficult to prove, since this
is the first study that has identified the species of Vairimorpha infecting bees in Jalisco.
Further studies are necessary to support these hypotheses. The intensity of the infection with
V. ceranae was relatively low, as all positive samples were classified as having very light
levels of infection (< 310,000 spores/bee)(41).
The present study detected no significant differences in the prevalence of V. ceranae between
regions; however, there were significant differences in the intensity of infections, as colonies
in the Southeast, South and Sierra Amula regions exhibited higher levels of infection than
colonies in the rest of the regions. These results can be explained, at least partially, by the
prevailing type of climate, as these regions are more humid, which favors the presence and
development of microsporidia(14).
The prevalence and intensity of the nosemosis infections observed in this study were lower
than those previously found in Yucatan, with a frequency of 74 % and an infection intensity
of 1’480,000 spores/bee(26). In Nayarit, the prevalence of nosemosis was also higher than in
this study (55.4 % in winter and 33 % in summer), but the intensity of the infection was
lower, with an average of 145,000 spores/bee in winter and 47,000 spores/bee in summer(42).
The low prevalence of nosemosis found in this study coincides with that of a study carried
out in Zacatecas, as the presence of Vairimorpha spp. was detected in only 4.7 % of the
sampled colonies(43). This could be due to the fact that the climate of the areas of Zacatecas
where the samples were taken is similar to that of the highlands of the state of Jalisco, where
most of the samples of this study were collected.
In the only previous study that tested for nosemosis in bees in southern and southeastern
Jalisco, nosemosis-positive colonies were found to have light or less than light levels of
infection(19), similarly to the results presented herein. This coincidence between these two
studies may be due to the fact that in most regions of the state of Jalisco there are no
environmental conditions that favor the multiplication of the etiological agents of the disease,
at least in spring, when the samples of both studies were collected. The intensity of the
nosemosis infection of honey bees is usually seasonal. In countries with temperate and cold
108
climates and at latitudes above 30º, the intensity of V. apis or V. ceranae infections peaks in
the spring and early summer, but decreases in other seasons(14,15). In contrast, in the Mexican
highlands, V. ceranae infections are more intense in summer and autumn, and less intense in
winter and spring(17). Therefore, colonies should be sampled in the summer and fall in order
to determine if the intensity of V. ceranae infection is higher than in spring. These studies
would allow to determine whether nosemosis is a serious problem for the beekeeping industry
in the state of Jalisco and, if it is, during what seasons of the year it constitutes a serious issue.
The most prevalent honey bee parasitosis in the state of Jalisco was varroosis, which was
detected in 90 % of the colonies, while the least prevalent parasitosis was nosemosis, detected
in 15 % of the sampled colonies. In addition, of the two Vairimorpha species analyzed in the
samples, only V. ceranae was detected. The levels of infestation or infection in the case of
these parasitoses were generally low: the level of varroosis was <5%, while nosemosis
infections were classified as very light infections (<310,000 spores/bee). The regions with
the highest prevalence and intensity of V. destructor infestations in both brood and adult bees
were the highlands and the central and southern regions. For the prevalence of nosemosis, no
significant differences were found between colonies of different regions, but the levels of
infection were highest in the Southeast, South and Sierra Amula regions. Further studies are
recommended, with samplings in different seasons of the year and for several years, to
determine under what conditions and during which seasons the studied parasitoses may be
more harmful to the beekeeping industry, as well as to design adequate control strategies.
The authors would like to express their gratitude to the 42 beekeepers who kindly facilitated
the collection of samples from their colonies. To Salvador Hernández and Magali Rodríguez,
who provided information on the participating beekeepers. To Sara Dino, Ulises Nuño,
Shaira Alvarado, and Miriam Rangel, who helped in the collection of the samples. This study
was partially financed by the CUSur research funds awarded to J.T. and by the Pinchin Fund
awarded by the University of Guelph to E.G. The authors declare that they have no conflict
of interest.
Literature cited:
1. Paudel YP, Mackereth R, Hanley R, Qin W. Honey bees (Apis mellifera L.) and pollination
issues: Current status, impacts, and potential drivers of decline. J Agric Sci
2015;7(6):93. https://doi:10.5539/jas.v7n6p93.
109
2. Magaña MMA, Tavera-Cortés ME, Salazar-Barrientos LL, Sanginés-García JR.

Productividad de la apicultura en México y su impacto sobre la rentabilidad.
REMEXCA 2016;7(5):1103-1115.
3. Servicio de Información Agroalimentaria y Pesquera. Panorama Agroalimentario, edición

2022. México. 2022: Secretaría de Agricultura y Desarrollo Rural; 2022.
https://www.gob.mx/siap/acciones-y-programas/panorama-agroalimentario-258035.
4. Guzman-Novoa E, Correa-Benítez A. Patología, Diagnóstico y Control de las Principales

Enfermedades y Plagas de las Abejas Melíferas. 2da ed. CDMC, México: Imagen
Editorial Yire; 2015.
5. Kevan PG, Hannan MA, Ostiguy N, Guzman-Novoa E. A summary of the Varroa-virus

disease complex in honey bees. Am Bee J 2006;146:694-697.
6. Guzman-Novoa E, Eccles L, Calvete Y, McGowan J, Kelly PG, Correa-Benítez A. Varroa

destructor is the main culprit for the death and reduced populations of overwintered
honey bee (Apis mellifera) colonies in Ontario, Canada. Apidologie 2010;41(4):443-
450. https://doi.org/10.1051/apido/2009076.
7. Rosenkranz P, Aumeier P, Ziegelmann B. Biology and control of Varroa destructor. J

invertebr Pathol 2010;103:S96-S119.
8. Koleoglu G, Goodwin PH, Reyes-Quintana M, Hamiduzzaman MM, Guzman-Novoa, E.

Effect of Varroa destructor, wounding and varroa homogenate on gene expression in
brood and adult honey bees. PloS ONE 2017;12(1):e0169669.
https://doi.org/10.1371/journal.pone.0169669.
9. Koleoglu G, Goodwin PH, Reyes-Quintana M, Hamiduzzaman MM, Guzman-Novoa, E.

Varroa destructor parasitism reduces hemocyte concentrations and prophenol oxidase
gene expression in bees from two populations. Parasitol Res 2018;117(4):1175-1183.
https://doi.org/10.1007/s00436-018-5796-8.
10. Ramsey SD, Ochoa R, Bauchan G, Gulbronson C, Mowery JD, Cohen A, et al. Varroa
destructor feeds primarily on honey bee fat body tissue and not hemolymph. PNAS
2019;116(5):1792-1801. https://doi.org/10.1073/pnas.1818371116.
11. Reyes-Quintana M, Espinosa-Montaño LG, Prieto-Merlos D, Koleoglu G, Petukhova T,

Correa-Benítez A, et al. Impact of Varroa destructor and deformed wing virus on
emergence, cellular immunity, wing integrity and survivorship of Africanized honey
bees in Mexico. J Invertebr Pathol 2019;164:43-48.
https://doi.org/10.1016/j.jip.2019.04.009.
110
12. Chihu-Amparan D, Rojas-Avalos L, Rodríguez-Dehaibes S. Presencia en Veracruz,

México del ácaro Varroa jacobsoni, causante de la varroasis de la abeja melífera (Apis
mellifera L.). Tec Pecu Méx 1992;30:2.
13. Correa-Benítez A, Anguiano-Baez R, Heneidi-Zeckua A, Dávalos-Flores JL, Peña-Haaz

NT, Pérez-Martínez EE, et al. Prevalence of adult honey bee (Apis mellifera L.) pests
and pathogens in the five beekeeping regions of Mexico. Animals 2023;13:1734.
https://doi.org/10.3390/ani13111734.
14. Goblirsch M. Nosema ceranae disease of the honey bee (Apis mellifera). Apidologie
2018;49(1):131-150. https://doi.org/10.1007/s13592-017-0535-1.
15. Emsen B, De la Mora A, Lacey B, Eccles L, Kelly PG, Medina-Flores CA, et al.
Seasonality of Nosema ceranae infections and their relationship with honey bee
populations, food stores, and survivorship in a North American region. Vet Sci
2020;7(3):131. https://doi.org/10.3390/vetsci7030131.
16. Guzman-Novoa E, Correa-Benítez A, Espinosa-Montaño LG, Guzman-Novoa GG.

Colonización, impacto y control de las abejas melíferas africanizadas en México. Vet
Mex 2011;42(2):149-178.
17. Guerrero-Molina C, Correa-Benítez A, Hamiduzzaman MM, Guzman-Novoa E. Nosema

ceranae is an old resident of honey bee (Apis mellifera) colonies in Mexico, causing
infection levels of one million spores per bee or higher during summer and fall. J
Invertebr Pathol 2016;141:38-40. https://doi.org/10.1016/j.jip.2016.11.001.
18. Tapia-González JM, Alcazar-Oceguera G, Macías-Macías JO, Contreras-Escareño F,

Tapia-Rivera JC, Petukhova T, et al. Varroosis en abejas melíferas en diferentes
condiciones ambientales y regionales de Jalisco, México. Ecosist Rec Agropec
2019;6(17):243-251. https://doi.org/10.19136/era.a6n17.2018.
19. Tapia-González JM, Alcazar-Oceguera G, Macías-Macías JO, Contreras-Escareño F,

Tapia-Rivera JC, Chavoya-Moreno FJ, et al. Nosemosis en abejas melíferas y su
relación con factores ambientales en Jalisco, México. Rev Mex Cienc Pecu
2017;8(3):325-330. https://doi.org/10.22319/rmcp.v8i3.4510.
20. Contreras-Escareño F, Pérez-Armendáriz B, Echazarreta CM, Cavazos-Arroyo J,

Macías-Macías JO, Tapia-González JM. Características y situación actual de la
apicultura en las regiones Sur y Sureste de Jalisco, México. Rev Mex Cienc Pecu
2013;4(3):387-398.
21. Dietemann V, Nazzi F, Martin SJ, Anderson DL, Locke B, Delaplane, KS, et al. Standard
methods for varroa research. J Apic Res 2013;52:1-54.
https://doi.org/10.3896/IBRA.1.52.1.09.
111
22. Cantwell GE. Standard methods for counting Nosema spores. Am Bee J 1970;110:222–
223.
23. Hamiduzzaman MM, Guzman-Novoa E, Goodwin PH. A multiplex PCR assay to

diagnose and quantify Nosema infections in honey bees (Apis mellifera). J Invertebr
Pathol 2010;105(2):151-155. https://doi.org/10.1016/j.jip.2010.06.001.
24. Medina-Flores CA, Guzman-Novoa E, Hamiduzzaman M, Aréchiga-Flores CF, López-

Carlos MA. Africanized honey bees (Apis mellifera) have low infestation levels of the
mite Varroa destructor in different ecological regions in Mexico. Genet Mol Res
2014;13(3):7282-7293.
25. Martínez-Cesáreo M, Rosas-Córdoba J, Prieto-Merlos D, Carmona-Gasca A, Peña-Parra

B, Ávila-Ramos F. Presencia de Varroa destructor, Nosema apis y Acarapis woodi en
abejas (Apis mellifera) de la región oriente del Estado de México. Abanico Vet
2016;6(2):30-38. https://doi.org/10.21929/abavet2016.62.3.
26. Martínez-Puc JF, Medina-Medina LA, Catzín-Ventura GA. Frecuencia de Varroa

destructor, Nosema apis y Acarapis woodi en colonias manejadas y enjambres silvestres
de abejas (Apis mellifera) en Mérida, Yucatán, México. Rev Mex Cienc Pecu
2011;2(1):25-38.
27. Moretto G, Gonçalves LS, De Jong D, Bichuette MZ. The effects of climate and bee race
on Varroa jacobsoni Oud infestations in Brazil. Apidologie 1991;22(3):197-203.
https://doi.org/10.1051/apido:19910303.
28. Domínguez-Ayala R, Moo-Valle H, May-Itzá WDJ, Medina-Peralta S, Quezada-Euán

JJG. Stock composition of northern neotropical honey bees: mitotype and morphotype
diversity in Mexico (Hymenoptera: Apidae). Apidologie 2016;47(5): 642-652.
29. Doeke MA, Frazier M, Grozinger CM. Overwintering honey bees: biology and
management. Curr Opin Insect Sci 2015;10:185-193.
https://doi.org/10.1016/j.cois.2015.05.014.
30. Guzman-Novoa E, Vandame R, Arechavaleta ME. Susceptibility of European and

Africanized honey bees (Apis mellifera L.) to Varroa jacobsoni Oud. in Mexico.
Apidologie 1999;30(2-3):173-182. https://doi.org/10.1051/apido:19990207.
31. Medina LM, Martin SJ. A comparative study of Varroa jacobsoni reproduction in worker
cells of honey bees (Apis mellifera) in England and Africanized bees in Yucatan,
Mexico. Exp Appl Acarol 1999;23(8):659-667.
https://doi.org/10.1023/A:1006275525463.
112
32. Martin SJ, Medina LM. Africanized honeybees have unique tolerance to varroa mites.
Trends Parasitol 2004;20(3):112-114. https://doi.org/10.1016/j.pt.2004.01.001.
33. Goodwin RM, Taylor MA, Mcbrydie HM, Cox HM. Drift of Varroa destructor-infested
worker honey bees to neighboring colonies. J Apic Res 2006;45(3):155.
https://doi.org/10.1080/00218839.2006.11101335.
34. Nolan MP, Delaplane KS. Distance between honey bee Apis mellifera colonies regulates
populations of Varroa destructor at a landscape scale. Apidologie 2017;48(1):8-16.
https://doi.org/10.1007/s13592-016-0443-9.
35. Norma Oficial Mexicana NOM-001-ZOO-1994, Campaña Nacional contra la Varroasis

de las Abejas. Diario Oficial de la Federación, México, D. F., 28 de abril de 1994.
36. Medina-Flores CA, Guzman-Novoa E, Aréchiga-Flores CF, Aguilera-Soto JI, Gutiérrez-

Piña FJ. Efecto del nivel de infestación de Varroa destructor sobre la producción de
miel de colonias de Apis mellifera en el altiplano semiárido de México. Rev Mex Cienc
Pecu 2011;2(3):313-317.
37. Emsen B, Guzman-Novoa E, Kelly PG. Honey production of honey bee (Hymenoptera:
Apidae) colonies with high and low Varroa destructor (Acari: Varroidae) infestation
rates in eastern Canada. Can Entomol 2014;146(2):236-240.
https://doi.org/10.4039/tce.2013.68.
38. Arechavaleta-Velasco ME, Guzman-Novoa E. Producción de miel de colonias de abejas

(Apis mellifera L.) tratadas y no tratadas con fluvalinato contra Varroa jacobsoni
Oudemans en Valle de Bravo, Estado de México. Vet Mex 2000;381-384.
39. Emsen B, Guzman-Novoa E, Hamiduzzaman MM, Eccles L, Lacey B, Ruiz-Pérez RA,

et al. Higher prevalence and levels of Nosema ceranae than Nosema apis infections in
Canadian honey bee colonies. Parasitol Res 2016;115(1):175-181.
https://doi.org/10.1007/s00436-015-4733-3.
40. Martín‐Hernández R, Bartolomé C, Chejanovsky N, Le Conte Y, Dalmon A, Dussaubat

C, et al. Nosema ceranae in Apis mellifera: a 12 years postdetection perspective. Environ
Microbiol 2018;20(4):1302-1329. https://doi.org/10.1111/1462-2920.14103.
41. Jaycox ER. Estimation of the severity of Nosema infection. University of Illinois, Bull
1980.
42. Loeza-Concha H, Salgado-Moreno S, Avila-Ramos F, Escalera-Valente F, Lemus-Flores

C, Domínguez-Rebolledo A, et al. Seasonal variation in the prevalence of Varroa,
Nosema and Acarapis in hives from which queen bee mating nuclei are produced. J Apic
Res 2020;59(4):558-563. https://doi.org/10.1080/00218839.2020.1717060.
113
43. Medina-Flores CA, Guzman-Novoa E, Espinoza-Montaño LG, Uribe-Rubio JL,

Gutierrez-Luna R, Gutierrez-Piña FJ. Frequency of varroosis and nosemosis in honey
bee (Apis melífera) colonies in the state of Zacatecas, Mexico. Rev Chapingo Serie
Cienc Forest Amb 2014;20(3):159-167. https://doi.org/10.5154/r.rchscfa.2013.08.028.
114
Article
Relationship between body development and reproductive response of

heifers to estrus synchronization protocols in the small-scale dairy system
Eliab Estrada-Cortés a
Fernando Villaseñor-González a
Héctor Raymundo Vera-Ávila b
Héctor Jiménez-Severiano c
Eugenio Villagómez-Amezcua Manjarrez d
Mario Alfredo Espinosa-Martínez c*
a
Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Campo
Experimental Centro Altos de Jalisco. México.
b
Universidad Autónoma de Querétaro. Facultad de Ciencias Naturales. México.
c
INIFAP. Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento
Animal, Km. 1 Carr. Ajuchitlán-Colón, 76280, Querétaro, México.
d
INIFAP. Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad.
México
*Corresponding author: espinosa.mario@inifap.gob.mx
Abstract:
The objectives were to determine the reproductive response of Holstein heifers in small-scale
dairy herds to estrus synchronization protocols based on prostaglandins (PG), estradiol
benzoate (EB), and progesterone (P4). Heifers at least 13 mo old (n= 138) were randomly
included in one of two synchronization protocols: PG) administration of 500 g cloprostenol
i.m. at d 0 and d 14; and PGPE) similar to PG but with an additional application of 100 mg
115
P4 + 2 mg EB on d 7. The estrus rate of the PG group was similar to that of the PGPE group
(84.3 vs 79.4 %; P>0.1). Heifers in PGPE had a higher percentage of estrus between 37-84 h
post-treatment vs the PG group (94.2 vs 82.5 %; P=0.05). The conception rate of the PGPE
group was higher than that of the PG group (94.4 vs 83.1 %; P=0.05). In the PG group, body
development at weaning was lower in heifers that did not show estrus vs those that did
(P<0.05). Nonetheless, in the PGPE group, birth weight was lower in heifers that showed
estrus than those that did not (P<0.05). In conclusion, heifers in the small-scale dairy system
have a good reproductive response to prostaglandin-based estrus synchronization
(cloprostenol). The inclusion of EB + P4 into the hormonal synchronization protocol with
PG improves conception rate but has a minimal effect on the distribution of the beginning of
estrus expression after treatment.
Keywords: Estrus synchronization, Heifers, Small-scale dairy herds.
Introduction
Artificial insemination (AI) is one of the most effective reproductive technologies for
accelerating genetic progress in cattle herds. First-service conception rates in heifers using
AI fluctuate between 45 and 75 %(1,2,3). To obtain the best results, it is necessary to have an
efficient detection of estrus or schemes of synchronization of estrus or ovulation that allow
insemination in periods of greater fertility. However, failures to detect estrus are one of the
most recurrent problems, even with the use of technologies for its detection(4,5,6). Evidence
suggests that about 30 % of estrus recorded in dairy herds are not actually estrus(7), and
accuracy can only reach 50 %(5). Therefore, AI in the intensive system is commonly
performed in conjunction with hormonal presynchronization and synchronization programs
and fixed-time artificial insemination(8,9).
In the small-scale dairy system, problems of reproductive inefficiency and suboptimal body
development of heifers during their rearing period have been identified, increasing the age at
first calving(10,11). The inadequate reproductive management and, in particular, the problem
of estrus detection in this system, is exacerbated by the fact that the producers themselves are
responsible for carrying out all herd management activities, in addition to agricultural
tasks(12), which complicates the incorporation of intensive protocols for reproductive
116
management similar to those implemented in specialized herds(8,9). In addition, producers in

the small-scale dairy system prefer to inseminate only animals in standing estrus because
they associate it with higher fertility.
The prostaglandin (PG)-based estrus synchronization protocol is an alternative for heifers in

the small-scale dairy system because it is easy to implement. Nevertheless, the manifestation
of estrus is distributed between 2 and 5 d after the end of the treatments due to the variable
age or size of the dominant follicle at the time of PG application(13,14,15). The hormonal
induction of the restart of a new wave of follicular development during synchronization
protocols allows animals to have follicles with a few days of dominance at the time of
service(16,17), which has been associated with a higher conception rate at service(18). In
addition, the use of estradiol benzoate (EB) + progesterone (P4) to induce a new wave of
follicular development has been associated with better synchrony in the occurrence of estrus
after synchronization with PG in beef cattle(19). Reducing the dispersion of estrus
manifestation could decrease the time spent performing estrus detection and AI when
scheduling groups of animals for service.
On the other hand, the suboptimal body development of calves during rearing not only
contributes to the increase in ages at first calving but can also affect the future productive
performance of replacements. For example, an increase of 100 g per day in daily weight gain
between one and fourteen months of age can translate into an increase in milk, fat, and protein
(345 L, 6.1 kg, and 7.5 kg, respectively) at 250 d in milk from their first lactation(20). Recent
studies support that different events (including body development) that occur in the pre- and
postnatal life of animals can influence the health and future productive performance of
mammals(21-25), which is known as developmental programming. Animals at early ages in the
small-scale system are commonly exposed to events that can influence their productivity;
however, their effects on reproductive performance have not been explored in this system.
The objectives of the present study were to determine the reproductive response of Holstein
heifers in small-scale dairy herds to prostaglandin-based estrus synchronization protocols
and to determine whether the inclusion of estradiol benzoate and progesterone in the protocol
improves synchrony in estrus manifestation and conception rate. Additionally, it was
evaluated whether there is an association between the early body development of heifers and
their reproductive response to synchronization.
117
116
The study was conducted in Los Altos de Jalisco region, Mexico. This region maintains a
subhumid temperate climate, with an average annual temperature of 17.8 ºC and an average
annual rainfall of 817 mm(26). It was included 138 Holstein heifers kept in milk production
units (n= 11), with an average of 70 cows in production, characteristic of the family or small-
scale system of the Los Altos de Jalisco region(27). The criteria considered for heifers to start
their estrus synchronization protocols were to have a minimum body weight of 290 kg and
be at least 13 mo old, considering the minimum necessary values recommended in the family
system(28). Although it was not determined whether the heifers were cycling at the time of
service, it was assumed that they already had this condition since it has been described that
puberty in Holstein heifers can begin as early as 6 mo of age, with an average of 8.2
months(29), an age considerably lower than the minimum age established in this study to
receive the service (13 mo).
Body weight was estimated by measuring the thoracic perimeter with the help of a specialized
tape measure for female Holstein cattle (Coburn; Whitewater, WI, USA), while the height at
the withers was obtained using a tape measure (Teletape, Ketchum, Ontario, Canada). When
the heifers were inseminated, their body condition was recorded on a scale of 1 to 5, where
1 corresponds to an animal in a state of wasting and a value of 5 corresponds to an obese
animal(30).
Groups of at least 6 heifers were included per production unit and randomly selected for
incorporation into one of two estrus synchronization protocols. In the protocol called PG (n=
70), a dose of prostaglandins (500 g of Cloprostenol, Inducel®) was applied intramuscularly
on d 0 and a second dose on d 14. In the protocol called PGPE (n= 68), a dose of
prostaglandins (500 g of Cloprostenol) was applied on d 0, a dose of 2 mg of estradiol
benzoate (Syntex, Zoetis, Kalamazoo, MI, USA) plus 100 mg of progesterone (Horproges,
Guadalajara, Jalisco, Mexico) on d 7, and a second dose of prostaglandins on d 14. The doses
of EB + P4 were chosen according to those used in previous studies in beef heifers(31,32).
None of the heifers in the study had any prior hormone treatment.
A visual estrus detection system was implemented. This system consisted of observation for
periods of 60 min in the morning and 60 min in the afternoon, for five consecutive days from
the second application of cloprostenol. The beginning of estrus was defined when the heifers
allowed the mounting for the first time and remained immobile. Artificial insemination was
performed 12 h after the onset of estrus and by a single technician in all cases. The semen
used came from the same bull to reduce the variation in fertility due to the bull effect. When
estrus was not observed in the heifers, they were inseminated five days after the second
118
116
application of cloprostenol, which was implemented at the request of the cooperating

producers.
The size of the potentially ovulatory follicle was evaluated by transrectal ultrasonography
(UMS900 Universal Imaging, New York, USA) on the day of heifer insemination. At 45 d
after insemination, the diagnosis of gestation was made through the rectal palpation technique
and with the help of ultrasound.
In heifers that had information on their growth indicators, it was retrospectively determined
whether there were differences between those that showed estrus and those that did not within
each synchronization protocol. The indicators considered were weight and height at birth,
weaning, and at 2 mo, weight gain at weaning and from birth to the service. In addition, body
condition at service was considered.
The analyses were performed using the SAS statistical program(33), and all analyses with a
value of P≤0.05 were considered statistically significant. The variables estrus detection rate,
conception rate, and the percentage of heifers that showed estrus between 37 and 84 h after
the second application of cloprostenol were analyzed by logistic regression adjusted to a
binomial distribution using the GLIMMIX procedure.
The variables age, body weight, and body condition at service, as well as the diameter of the
ovulatory follicle and the onset of estrus (time elapsed between the last application of
Cloprostenol and the onset of standing estrus), were analyzed by ANOVA using the GLM
procedure, considering the production unit as a block, within the statistical model. The
variables age at service and body condition at service were transformed through their natural
logarithm before their analysis. The retrospective analysis within each synchronization group
(PG and PGPE) for the different growth indicators (weight, height, and weight gain) was
performed by ANOVA and the GLM procedure, also considering the production unit as a
block in the statistical model.
Results
Table 1 shows the results on age, body development, and reproductive response of heifers to
the first service according to the synchronization protocol. No significant differences were
observed between heifer groups for age, weight, and body condition at the time of the first
service (P>0.05). No significant differences were observed between heifer groups in estrus
rate, total conception rate, and ovulatory follicle diameter (P>0.05). Nonetheless, a
statistically significant effect on conception rate was found in heifers that showed estrus
119
116
(P=0.05). The heifer group of the PGPE treatment had a higher conception rate (94.44 %;
51/54) compared to the group of the PG treatment (83.05 %; 49/59).
Table 1: Reproductive response of heifers to the first service according to the estrus
synchronization protocol
Synchronization protocol
Variable PG PGPE P
N 70 68 -
Age at first service, days 462.97+5.3 459.8+6.0 NS
Weight at service, kg 359.4+4.2 355.2+4.3 NS
Body condition at service 3.31+0.05 3.32+0.05 NS
Estrus rate, % 84.29 (59/70) 79.41 (54/68) NS
Total conception rate, % 82.61 (57/69) 85.29 (58/68) NS
Conception (only cows in estrus), % 83.05 (49/59) 94.44 (51/54) 0.05
Preovulatory follicle diameter, mm 11.09+0.30 11.00+0.29 NS
Continuous variables are shown as the average ± standard error. PG= administration of one dose of PGF2
on day 0 and another on day 14; PGPE= administration of one dose of PGF2, progesterone plus estradiol
benzoate, and PGF2 on days 0, 7, and 14, respectively.
NS=Not significant (P>0.05).
Figure 1 shows the distribution of time in which heifers manifested estrus after the
synchronization protocols were completed. As can be seen, the period in which a higher
percentage of estrus manifestation was recorded was between 37 and 84 h, regardless of the
synchronization protocol. Based on this information, a statistical analysis was performed to
identify which treatment group showed a higher percentage of heifers in estrus between 37
and 84 h. A significant difference (P=0.05) was observed, in which the group of heifers of
the PGPE treatment had a higher percentage of animals showing estrus (94.2 %; 49/52)
compared to the group of PG treatment (82.5 %; 47/57).
120
116
Figure 1: Distribution of standing estrus manifestation over the next 5 days (shown in 12-h
periods) after estrus synchronization protocols were completed
PG= administration of one dose of PGF2 on day 0 and another on day 14; PGPE= administration of one
dose of PGF2, progesterone plus estradiol benzoate, and PGF2 on days 0, 7, and 14, respectively.
(P=0.05).
Table 2 shows the growth indicators between birth and the time of first service of the heifer
groups according to the estrus synchronization protocol and estrous response to it. As can be
seen, heifers that did not show estrus in the PG group had a lower weight and height at 2 mo
of age (P<0.05) and tended to have a lower weight (P<0.1) and daily weight gain at weaning
(P<0.1) compared to the group that showed estrus. On the other hand, heifers that showed
estrus in the PGPE group had lower birth weight (P<0.05) than the group that did not show
estrus, but no differences were observed in the development at weaning.
121
116
Table 2: Indicators of heifer growth according to estrus synchronization protocol and

estrous response to treatment
Synchronization protocol
PG PGPE
They did not They They did not They
Indicator show estrus showed show estrus showed
estrus estrus
N 4 22 3 22
a
Birth weight, kg 39.67+1.18 40.76+0.44 43.78+1.51 40.35+0.51b
Birth height, cm 82.12+1.65 81.66+0.64 82.69+3.62 80.69+1.23
a b
Weight 2 months, kg 62.06+4.44 76.70+1.64 81.74+8.12 70.43+2.77
c d
Height 2 months, cm 89.51+1.79 93.69+0.66 96.00+3.23 91.00+1.10
c d
Weaning weight, kg 75.13+5.46 87.13+2.02 93.79+9.66 78.93+3.29
Weaning height, cm 92.55+2.63 95.00+0.97 97.40+3.24 92.54+1.10
DWG weaning, kg/d 0.503+0.07c 0.663+0.03d 0.652+0.10 0.550+0.03
DWG birth-service, kg/d 0.707+0.04 0.718+0.02 0.717+0.03 0.709+0.01
Values shown as average ± standard error. PG= administration of one dose of PGF2 on day 0 and another
on day 14; PGPE= administration of one dose of PGF2, progesterone plus estradiol benzoate, and PGF2
on days 0, 7, and 14, respectively. DWG= daily weight gain.
abc
Different literal between groups for each synchronization protocol indicates statistical difference
(abP<0.05) or trend (cdP<0.10).
Discussion
The present study was focused on determining whether, in small-scale dairy herds, heifers
respond favorably to prostaglandin-based estrus synchronization protocols and determining
whether the inclusion of estradiol benzoate and progesterone in the protocol improves
synchrony in estrus manifestation and conception rate. The results indicated that heifers in
this production system show a good response to synchronization with prostaglandins. On the
other hand, adding these hormones to the conventional protocol improved the conception
rate, but the distribution of estrus manifestation once the synchronization protocol ended was
only slightly reduced.
In addition, the present study evaluated whether there was an association between body
development from birth to the service of heifers and their reproductive response to
synchronization. The observed results suggest the existence of a relationship between heifer
body development and estrus manifestation after synchronization; however, these did not
show a clear trend.
122
116
Regardless of the protocol variant used, the estrus and conception rates observed in the
present study were outstanding (by 14 and 20 %, respectively) compared to the results
observed in Holstein heifers synchronized with prostaglandins of the specialized system(34,35).
In specialized production units, the high density of animals limits estrus detection
efficiency(4). Nevertheless, in the cooperating dairy herds there were small groups of heifers
in which an external work team helped detect estrus during the study. Although the
metabolism of heifers is not as high as in lactating cows, it has been suggested that animals
with greater potential for milk production, such as those present in the specialized system,
show a reduced intensity and duration of estrus, which makes it difficult to detect(36). The
combination of these factors could explain why the estrus rate was outstanding in the present
study.
On the other hand, a reduction in fertility at service has been observed as the age of heifers
increases (> 16 mo) at the time of insemination(37) or a wide variability in fertility due to the
bull used(38). In the present study, the heifers were between 13 and 15 mo old at the time of
service, semen from a bull with proven fertility in the area was used, and there was a good
estrus detection rate, which is associated with better fertility at service(4). These factors could
explain why the conception rate observed was outstanding in the present study compared to
the specialized production system.
This study also evaluated the response obtained by adding estradiol benzoate and
progesterone to the conventional prostaglandin-based estrus synchronization protocol. The
above with the purpose of reducing the dispersion in the expression of estrus and improving
the conception rate. Regardless of the treatment used, most heifers initiated standing estrus
between 37 and 84 h after the end of the synchronization protocol. On the other hand, the
inclusion of estradiol benzoate and progesterone in the hormonal synchronization protocol
improved the conception rate at service and increased, albeit slightly, the percentage of estrus
manifestation between 37 and 84 h after the end of synchronization (Figure 1). Previous
studies have described that the induction of a new wave of follicular development during
hormonal synchronization protocols improves fertility at service(16,17,18) and reduces the
distribution of estrus occurrence after synchronization(19).
The conception and estrus rates observed in the PGPE treatment are probably associated with
the fact that the application of estradiol benzoate and progesterone induced a new wave of
follicular development and, consequently, the development of ovarian follicles in closer
stages and in full dominance at the time of ovulation. It is known that the combination of
estrogen and progesterone reduces serum gonadotropin concentrations, which causes
regression of the dominant follicle in turn (with maximum size, but in some cases already
aged) and induces a new wave of follicular development during hormonal
synchronization(16,17). The presence of dominant follicles in fullness favors the expression of
genes, as well as cellular signals that confer greater competence to the follicles so that the
116
123
released oocytes are successfully fertilized and continue their embryonic development
process(39,40). It is important to note that the results regarding conception and estrus
presentation rates were not associated with age, weight, body condition at service, or the size
of the ovulatory follicle since they were similar between treatments (Table 1).
This study also evaluated whether early body development of replacements could affect the
reproductive response of heifers to estrus synchronization. The results support an association
between body development at an early age in heifers and the manifestation of estrus in
response to synchronization. Heifers that did not show estrus in the PG group had lower body
development until two months of age. In previous studies, it has been observed that low
weight gain in the preweaning stage impacts age at first service or conception(41,42). On the
other hand, heifers that showed estrus in the PGPE group had lower birth weight; however,
their body development until service was similar between animals that showed estrus or not.
It has been indicated that postnatal compensatory growth in low birth weight calves allows
them to cope with adverse events such as weaning and probably compensate for their future
productive performance(43,44).
It should be noted that weight, body condition (Table 1), and daily weight gain from birth to
service (Table 2) were similar among the heifers in each treatment studied. It is possible that
the estrous response observed in the present study and associated with early body
development is due to effects known as developmental programming. This phenomenon
refers to the fact that the productive performance of animals can be programmed during the
pre- and early postnatal life due to environmental effects that modulate gene expression
through epigenetic marks in chromatin(22,23,25). Negative effects of suboptimal body
development during early life on the reproductive performance of heifers have been
previously described(41,42). Nonetheless, the number of observations and the lack of
consistency in the results of the present study limit their interpretation. Further studies are
required to explore these possible effects on heifers in the small-scale dairy system.
In conclusion, heifers in the small-scale dairy system have a good reproductive response to
prostaglandin-based estrus synchronization (cloprostenol). The inclusion of estradiol and
progesterone in the prostaglandin hormone synchronization protocol improves the
conception rate but has a minimal effect on the distribution of the onset of estrus expression
after treatment. Although an association was detected between the early body development
of heifers and their estrous response, no conclusive effects were observed.
116
124
Acknowledgments
The study was financed with fiscal funds allocated to the project SIGI 23335132549 entitled
“Nutritional supplementation in critical periods of calf rearing, to improve their productive
performance in family/semitechnified milk production systems” of the National Institute of
Forestry, Agricultural, and Livestock Research.
The authors declare that they have no financial or personal conflict of interest associated with
this study.
Literature cited:
1. Chebel RC, Guagnini FS, Santos JEP, Fetrow JP, Limar JR. Sex-sorted semen for dairy
heifers: effects on reproductive and lactational performances. J Dairy Sci
2010;93(6):2496-2507.
2. DeJarnette JM, McCleary CR, Leach MA, Moreno JF, Nebel RL, Marshall CE. Effects
of 2.1 and 3.5 × 106 sex-sorted sperm dosages on conception rates of Holstein cows and
heifers. J Dairy Sci 2010;93(9):4079-4085.
3. Healy AA, House JK, Thomson PC. Artificial insemination field data on the use of sexed
and conventional semen in nulliparous Holstein heifers. J Dairy Sci 2013;96(3):1905-
1914.
4. Reith S, Hoy S. Review: behavioral signs of estrus and the potential of fully automated
systems for detection of estrus in dairy cattle. Animal 2018;12(2):398-407.
5. Roelofs J, López-Gatius F, Hunter RHF, van Eerdenburg FJC, Hanzen Ch. When is a
cow in estrus? Clinical and practical aspects. Theriogenology 2010;74(3):327-344.
6. Williams J, Ntallaris T, Routly JE, Jones DN, Cameron J, Holman-Coates A, Smith RF,
Humblot P, Dobson H. Association of production diseases with motor activity-sensing
devices and milk progesterone concentrations in dairy cows. Theriogenology
2018;118:57-62.
7. Holman A, Thompson J, Routly JE, Cameron J, Jones DN, Grove-White D, Smith RF,
Dobson H. Comparison of oestrus detection methods in dairy cattle. Vet Rec
2011;169(2):47.
125
116
8. Sahu SK, Parkinson TJ, Laven RA. Conception rates to fixed-time artificial
insemination of two oestrus synchronization programmes in dairy heifers. NZ Vet J
2015;63(3):158-161.
9. Stevenson JS. Synchronization and artificial insemination strategies in dairy herds. Vet
Clin: Food Anim Pract 2016;32(2):349-364.
10. Häubi SCU, Gutiérrez LJL. Evaluación de unidades familiares de producción lechera en
Aguascalientes: estrategias para incrementar su producción y rentabilidad. Avances en
Investigación Agropecuaria 2015;19(2):7-34.
11. Mariscal-Aguayo V, Pacheco-Cervantes A, Estrella-Quintero H, Huerta-Bravo M,

Rangel-Santos R, Núnez-Domínguez R. Indicadores reproductivos de vacas lecheras en
agroempresas con diferente nivel tecnológico en Los Altos de Jalisco. Agricultura,
Sociedad y Desarrollo 2016;13(3):493-507.
12. Estrada CE, Espinosa MMA, Barretero HR, Rodríguez HE, Escobar RMC. Manejo del
ganado bovino adulto en establos familiares/semitecnificados de producción de leche.
Folleto para productores Núm. 1. INIFAP - Campo Experimental Centro Altos de
Jalisco. Tepatitlán de Morelos, Jalisco, México. 2014.
13. Macmillan KL, Henderson HV. Analysis of the variation in the interval from an injection
of PGF2a to oestrus as a method of studying patterns of follicle development during
dioestrus in dairy cows. Anim Reprod Sci 1984;6(4):245-254.
14. Lucy MC, McDougall S, Nation DP. The use of hormonal treatments to improve the
reproductive performance of lactating dairy cows in feedlot or pasture-based
management systems. Anim Reprod Sci 2004;82-83:495-512.
15. Stevenson JS. Impact of reproductive technologies on dairy food production in the dairy
industry. GC Lamb, N DiLorenzo editors. Current and future reproductive technologies
and world food production, Advances in experimental medicine and biology. Springer
Science Business Media New York. 2014.
16. Bo GA, Adams GP, Pierson RA, Mapletoft RJ. Exogenous control of follicular wave
emergence in cattle. Theriogenology 1995;43(1):31-40.
17. Wiltbank MC, Sartori R, Herlihy MM, Vasconcelos JL, Nascimento AB, Souza AH,
Ayres H, Cunha AP, Keskin A, Guenther JN, Gumen A. Managing the dominant follicle
in lactating dairy cows. Theriogenology 2011;76(9):1568-82.
116126
18. Monteiro Jr PLJ, Borsato M, Silva FLM, Prata AB, Wiltbank MC, Sartori R. Increasing
estradiol benzoate, pretreatment with gonadotropin-releasing hormone, and
impediments for successful estradiol-based fixed-time artificial insemination protocols
in dairy cattle. J Dairy Sci 2015;98(6):3826–3839.
19. Colazo MG, Mapletoft J. A review of current timed-AI (TAI) programs for beef and
dairy cattle. Can Vet J 2014;55(8):772-780.
20. Chuck GM, Mansell PD, Stevenson MA, Izzo MM. Early-life events associated with
first-lactation performance in pasture-based dairy herds. J Dairy Sci 2018;101(4):3488-
3500.
21. Gelsinger SL, Heinrichs AJ, Jones CM. A meta-analysis of the effects of preweaned calf
nutrition and growth on first-lactation performance. J Dairy Sci 2016;99(8):6206-6214.
22. Laporta J, Ferreira FC, Ouellet V, Dado-Senn B, Almeida AK, De Vries A, Dahl GE.
Late-gestation heat stress impairs daughter and granddaughter lifetime performance. J
Dairy Sci 2020;103(8):7555-7568.
23. Estrada-Cortés E, Ortiz W, Rabaglino MB, Block J, Rae O, Jannaman EA, Xiao Y,
Hansen PJ. Choline acts during preimplantation development of the bovine embryo to
program postnatal growth and alter muscle DNA methylation. FASEB J
2021;35(10):e21926.
24. Barker DJ, Thornburg KL. The obstetric origins of health for a lifetime. Clin Obstet
Gynecol 2013;56(3):511-519.
25. Gardner DS, Ozanne SE, Sinclair KD. Effect of the early-life nutritional environment
on fecundity and fertility of mammals. Philos Trans R Soc Lond B Biol Sci
2009;364(1534):3419–3427.
26. Instituto de Información Estadística y Geográfica de Jalisco. Altos Sur Diagnóstico de

la Región. Gobierno de Jalisco. 2019.
27. Montiel-Olguín LJ, Estrada-Cortés E, Espinosa-Martínez MA, Mellado BM,

Hernández-Vélez JO, Martínez-Trejo G, et al. Risk factors associated with reproductive
performance in small-scale dairy farms in México. Trop Anim Health Prod
2019;51(1):229-236.
28. Espinosa MMA, Estrada CE, Barretero HR, Rodríguez HE, Escobar RMC. Crianza de
becerras para sistemas familiares/semitecnificados de producción de leche. Ajuchitlán,
Colón, Querétaro, México. Folleto para productores. INIFAP. 2014.
127
116
29. Bruinjé TC, Rosadiuk JP, Mosiemipur F, Sauerwein H, Steele MA, Ambrose DJ.
Differing planes of pre- and postweaning phase nutrition in Holstein heifers: II. Effects
of circulating leptin, luteinizing hormone, and age at puberty. J Dairy Sci
2021;104(1):1153-1163.
30. Edmonson AJ, Lean J, Weaver LF, Farver T, Webster G. A body condition scoring chart
for Holstein Dairy Cows. J Dairy Sci 1989;72(1):68-78.
31. Martínez MF, Kastelic JP, Adams GP, Janzen E, McCartney DH, Mapletoft RJ. Estrus
synchronization and pregnancy rates in beef cattle given CIDR-B, prostaglandin and
estradiol, or GnRH. Can Vet J 2000;41(10):786-790.
32. Martínez MF, Kastelic JP, Mapletoft RJ. The use of estradiol and/or GnRH in a two-
dose PGF protocol for breeding management of beef heifers. Theriogenology
2004;62(1-2):363-372.
33. SAS Institute. 2011. Statistical Analysis Software SAS/STAT. Base SAS 9.3.
Procedures Guide Statistical Procedures. Cary, N.C., USA:SAS Institute Inc., ISBN:
978-1-60764-896-3.
34. McDougall S, Rhodes FM, Compton CWR. Evaluation of three synchrony programs for
pasture-based dairy heifers. Theriogenology 2013;79(5):882-889.
35. Waldmann A, Kurykin J, Jaakma Ü, Kaart T, Aidnik M, Jalakas M, Majas L, Padrik P.

The effects of ovarian function on estrus synchronization with PGF in dairy cows.
Theriogenology 2006;66(5):1364-1374.
36. Wiltbank M, Lopez H, Sartori R, Sangsritavong S, Gümen A. Changes in reproductive

physiology of lactating dairy cows due to elevated steroid metabolism. Theriogenology
2006;65(1):17-29.
37. Brickell JS, Bourne N, McGowan MM, Wathes DC. Effect of growth and development
during the rearing period on the subsequent fertility of nulliparous Holstein-Friesian
heifers. Theriogenology 2009;72(3):408–416.
38. Bormann JM, Totir LR, Kachman SD, Fernando RL, Wilson DE. Pregnancy rate and
first-service conception rate in Angus heifers. J Anim Sci 2006;84(8):2022–2025.
39. Girard A, Dufort I, Douville G, Sirard MA. Global gene expression in granulosa cells
of growing, plateau and atretic dominant follicles in cattle. Reprod Biol Endocrinol
2015;13:17.
40. Zielak-Steciwko AE, Evans AC. Genomic portrait of ovarian follicle growth regulation
in cattle. Reprod Biol 2016;16(3):197-202.
128
116
41. Curtis G, McGregor-Argo C, Jones D, Grove-White D. The impact of early life nutrition
and housing on growth and reproduction in dairy cattle. Plos One 2018;13(2):e0191687.
42. Rincker LE, Vandehaar MJ, Wolf CA, Liesman JS, Chapin LT, Weber Nielsen MS.
Effect of intensified feeding of heifer calves on growth, pubertal age, calving age, milk
yield and economics. J Dairy Sci 2011;94(7):3554-3567.
43. Svensson C, Liberg P. The effect of group size on health and growth rate of Swedish
dairy calves housed in pens with automatic milk-feeders. Prev Vet Med 2006;73(1):43-
53.
44. Lundborg GK, Oltenacu PA, Maizon DO, Svensson EC, Liberg PG. Dam-related effects
on heart girth at birth, morbidity, and growth rate from birth to 90 days of age in Swedish
dairy calves. Prev Vet Med 2003;60(2):175-90.
129
116
Article
The effect of age, sex and postmortem aging on meat quality traits and
biochemical profile of different muscles from Brangus cattle
Julieta Fernández Madero a,b *
Laura Pouzo a,c
Darío Pighín d,e
Jorge Alejandro Navarro f
Fernando Ailán g
César Federico Guzmán h
Enrique Paván a,c
a
Universidad Nacional de Mar del Plata. Facultad de Ciencias Agrarias. Balcarce, Buenos
Aires, (7620), Argentina.
b
Universidad Católica de Salta. Facultad Ciencias Agrarias y Veterinarias. Salta, Argentina.
c
Instituto Nacional de Tecnología Agropecuarias, EEA Balcarce, Balcarce, Argentina.
d
Instituto Nacional de Tecnología Agropecuarias. Instituto Tecnología de Alimentos -
CNIA - Castelar. Buenos Aires, Argentina.
e
Consejo Nacional de Investigaciones Científicas y Técnicas - CONICET. Argentina.
f
Universidad Nacional de Salta. Salta, Argentina.
g
Universidad Nacional de Tucumán. Tucumán, Argentina.
h
Instituto Nacional de Tecnología Agropecuarias, EEA Cuenca del Salado, Argentina.
* Corresponding author: jfernandez@ucasal.edu.ar
130
Abstract:
Carcass quality traits and the Longissimus thoracis (LT) and semitendinosus (ST) muscles,
aged for 2 or 14 d, from sixty castrated (CM) and non-castrated (NCM) Brangus males,
slaughtered at 16 (M16) or 20 (M20) mo of age (391 and 434 kg live weight; 3.81 and 4.25
mm backfat thickness respectively), were evaluated. The carcasses of castrated and younger
animals weighed less than those of non-castrated and older ones (P<0.001). Castration
produced more subcutaneous fat and lower rib eye areas (P<0.05). Temperature and pH
decline was faster in younger animals, and final pH was lower in castrated (P< 0.05). While
the Warner Bratzler Shear Force (WBSF) of LT was 9 % lower in castrated, and 7 % higher
in younger animals (P<0.05); it decreased with a longer aging period (P<0.001). The WBSF
of LT was positively associated with total collagen content (r= 0.54; P<0.01) and negatively
with myofibrillary fragmentation index (r= -0.39; P<0.05). The WBSF of ST was not affected
by animal castration or slaughter age (P>0.05), but decreased with a longer aging period
(P<0.001), and was positively associated with total collagen content (r= 0.61; P<0.05). Both
muscles from castrated slaughtered at younger ages had the higher L* values. It is concluded
that castration and age at slaughter on Brangus males produced differences on WBSF values
only on LT muscle where collagen is not the main determinant of shear force.
Keywords: Beef, Brangus, Collagen content, Color, Myofibrillar fragmentation index, Shear
force, Temperature decline.
Introduction
Non-castrated males are an interesting alternative for beef producers to obtain leaner or
heavier carcasses(1,2). Testosterone is the main hormone produced in uncastrated males.
Among its functions include the development of male organs, secondary sexual
characteristics, and promoter of muscle development. This anabolic property directly
influences the daily weight gain and feed efficiency, producing a carcass with a higher yield
of retail product with less fat and more red meat than castrates(3). Differences in favor of bulls
are generally more pronounced with increasing slaughter weight(1). However, lean carcasses
with low fat thicknesses could result in a fast temperature decline, leading to tougher cuts(4).
The lower tenderness of meat from non-castrated than from castrated males was associated
with its higher content of connective tissue and lower endogenous protease activity
responsible for postmortem tenderization(2,5). On the other hand, as animals get older, meat
131
collagen solubility decreases(6) and myoglobin concentration increases(7). Therefore, tougher

and darker meat cuts could be expected with increasing animal age(1).
It has been proposed that the effect of castration and animal age at slaughter on meat color
and tenderness varies with muscle type(5,8). In addition, the response to postmortem aging
also varies with type of muscle(5,9). Rodriguez et al(5) found no effect of castration on Warner
Bratzler Shear Force (WBSF) in muscles with high amount of connective tissue (Psoas
major, semitendinosus (ST)); however; they observed effect of castration in WBSF in the
Longissimus muscle. Tenderness would be determined mainly by the high collagen content
and solubility in semitendinosus muscle, and by higher postmortem proteolysis activity in
muscles like Longissimus thoracis (LT)(9). Therefore, the effects of castration and age at
slaughter on meat color and tenderness varies with the type of muscle considered(5,10) as well
as with the postmortem aging period(11).
Only a few studies have evaluated the effects of castration or slaughter age on animal
performance and carcass characteristics of Brangus cattle(12,13), but none of them evaluated
the interaction of these effects have on the meat quality of different muscles. Therefore, the
aim of the present study was to evaluate the effect of castration and slaughter age of Brangus
males on carcass quality and biochemical profile of two muscles of different characteristics,
the LT and the ST.
The trial was carried out following the Good Manufacturing Practices and welfare standards
for animal handling recommended by the Argentine National Institute for Agricultural
Technology (INTA). The trial was approved by the institutional ethical and technical
committee of the Catholic University of Salta (RR N° 694/12). The study was conducted in
General Güemes, Salta province, Argentina (24°42'40.8"S, 64°57'48.8"W, 670 m altitude).
Animals and treatments
Sixty (60) Brangus calves of similar age (7 mo) and weight (178 ± 13 kg) were randomly
selected from the same cow-calf herd and assigned to one of the four treatment combinations
defined by the sex category (CM, castrated males, and NCM, non-castrated males) and age
at slaughter (M16, males slaughtered at 16 mo of age, and M20, males slaughtered at 20 mo
of age). Each combination involved 15 animals. At 7 mo of age those animals assigned to
CM were surgically castrated. Animals were reared on a paddock of alfalfa and supplemented
with a mix of whole corn grain (25 % DM), whole plant sorghum silage (72.5 % DM) and
vitamin-mineral core with monensin (2.5% DM) fed at 1.5 % of live weight until they were
enclosed in a pen. The rearing period was 3 mo for M16 and 7 mo for 20. For M16 the live
132
weight of entry to the pens was 192 ± 3 kg and for M20 293 ± 9 kg. During enclosing the
concentrate diet consisted of cracked corn grain (57.25 % DM), whole plant corn silage
(26 % DM), sunflower or cotton pellets (13.5 % DM), granulated urea (0.75 % DM) and a
mineral vitamin supplement with monensin (2.5 % DM). Live weight was determined every
28 d. The average daily gain and feed efficiency observed during the enclosing period was
0.96 ± 0.11 kg/d and 8.5 ± 0.9 kg/kg for the CM and 1.11 ± 0.12 kg/d and 7.6 ± 1.1 kg/kg for
the NCM, irrespective of the slaughter age.
Carcass measurement and sample collection
The day before slaughter, animals were weighed individually to record their full live weight
(LW) and shipped to the slaughterhouse located 350 km from the experimental farm (driving
time of 5 h), where they were kept in lairage for 12 h prior to slaughter, with free access to
water and feed withdrawal.
Carcasses were electrically stimulated (21 V 0.25 A) at two independent stimulation times
of 20 and 30 sec); then, hot carcass weight (HCW) was recorded. Dressing percentage was
calculated by dividing the HCW by the pre-shipping full LW of the animal x 100. The muscle
pH and temperature were recorded between 12th and 13th ribs Longissimus thoracis et
lumborum of the left carcass side at 2, 5, 8, 14 and 26 h postmortem using a Testo 205
phmeter. To estimate the decline of pH and temperature, and carcass cooling rates, the
pH/temperature window concept implemented in Meat Standards Australia (MSA) was used.
This concept includes the measurement of temperature when the pH value = 6 (Temp@pH6)
and measurement of pH when the temperature value = 12 °C (pH@Temp12).
After 48 h of chilling, the ultimate pH (pHu) was measured at the 12th rib of the left side of
the carcasses. Back fat thickness (BFT) was measured at between 12th and 13th ribs using a
digital caliper (Starrett 125). The LT rib eye area (REA) was recorded on the 12th rib, and
then analyzed by Image APS-Asses Ink software (University of Manitoba, Winnipeg,
Manitoba, Canada, 2002). The LT and ST muscles were sampled from the left side of the
carcasses. The 8 - 12th rib section was obtained from the left side of each carcass by cutting
perpendicularly to the long axis of the LT muscle in the joints of the 7th–8th and 12th–13th
dorsal ribs. The whole ST muscle from the left side of each carcass was also obtained during
carcass fabrication at 48 h postmortem.
Sample preparation and postmortem treatments
Four 1.5-cm and two 2.5-cm thick steaks were obtained from caudal to cranial from each
muscle sample. The 1.5-cm thick steaks were immediately vacuum-packaged and stored at
−20 °C for subsequent determination of sarcomere length (SL), total lipid content,
133
myofibrillary fragmentation index (MFI), glycolytic potential and total and soluble collagen
content. The 2.5-cm thick steaks were randomly assigned to one of two aging periods (2 and
14 d) in vacuum at 4 °C. After the aging period, meat samples were stored at −20 °C until
WBSF and color evaluation.
Meat quality evaluation
Color
Instrumental color measurements were taken after 30 min of blooming. Readings were
performed with a Minolta CR-310 (Minolta Corp, Ramsey, N.J.) using a 50-mm diameter
measuring area, a 10° standard observer and a D65 illuminant. The system used was the CIE
Lab, which provides three color components: L* (lightness, 0= black, 100= white), a* (red
index, -a*= green, +a*= red) and b* (yellow index, -b= blue, +b= yellow). Values were
recorded in three locations of the exposed area to obtain a representative reading.
Total lipid content

Total lipid content (g of lipids/100 g of fresh tissue) was determined using an automatic
extraction system (Ankom xt10, Ankon, Macedon NY, USA) and petroleum ether as
solvent(14).
Warner Bratzler Shear Force

The WBSF analysis was conducted following the guidelines of AMSA, 1995(15). Steaks were
thawed at 4 °C for 12 h and cooked on preheated open-heart electric grill (Farberware, Bronx,
New York) at an internal temperature of 71 °C. Steaks were cooled at 4 °C for 1 h; then six
1.27-cm diameter cores were removed from each steak parallel to the muscle fiber
orientation. Meat cores were cut perpendicularly to the long axis of muscle sample using a
WBSF testing machine (G-R Manufacturing, Manhattan, KS, US) equipped with a digital
dynamometer.
Total and soluble collagen content

Total collagen content was estimated by determining hydroxyproline using the procedure
described by Bergman and Loxley(16). Insoluble collagen content was determined using a
procedure adapted from Hill(17). Soluble content was estimated as the difference between total
and insoluble collagen content.
Sarcomere length
Three grams of muscle tissue was homogenized in 20 ml of solution 0.25 M sucrose at 4 ºC
for 15 sec with a disperser (CAT x 120, Germany)(18). Sarcomere length was determined
using a diffraction laser (CVI Melles Gliot. Series 7822 FH-1)(18).
134
Glycolytic potential
Glycolytic potential was calculated from muscle glycogen and lactate concentration, where
GP = 2 (glucose 6-phosphate + Glycogen + glucose) + lactate(19).
Glycogen content
Muscle glycogen content was extracted from muscles by acid hydrolysis(20). Briefly, about
500 mg of muscle samples were homogenized (Ultraturrax, Fisher Scientific) for 30 sec in 5
mL 2 N HCl, and then, submitted to hydrolysis at 100 ± 1 °C for 2 h. Glucose released was
measured spectrophotometrically (505 nm; Spectrophotometer Thermo Fisher Scientific
USA) in the neutralized homogenates (2 N NaOH) with the GOD/ POD Trinder Color test
(GT Wiener Lab, Rosario, Argentina). Available glycogen content was expressed as mmol
of glucose per gram of wet tissue. The quantified glucose included free glucose and glucose
from glycogen hydrolysis(20).
Lactate content
Muscle lactate was determined spectrophotometrically (550 nm; spectrophotometer-Thermo
Fisher Scientific. USA), following the procedure described by Neath et al(21) and using a
commercial kit (Randox kit LAC; Randox Laboratories Ltd, Crumlin, Co. Antrim, UK).
Myofibrillary fragmentation index

Protein concentration was determined by calculating MFI according to the protocol described
by Hopkins et al(22), using a microplate Spectrophotometer equipped with an Epoch-type
reader (Biotek, USA).
Statistical analysis was performed using the mixed procedure of the Statistical Analysis
System R (Version 3.6.1). Data were analyzed separately for each muscle (LT, ST). Color
and WBSF data were tested as a split-plot design, where effects of sex and age at slaughter
were considered in the main plot and postmortem aging period effect was considered as a
sub-plot. All possible interactions between individual factors were computed in the model.
Data of variables in which the effect of the aging period was not included (pH and
temperature decline, animal live weight and carcass characteristics, sarcomere length,
intramuscular fat (IMF), total and soluble collagen, glycogen, MFI) were analyzed under a
completely randomized design with a 2 x 2 factorial arrangement (two categories and two
slaughter ages). For the variables of carcass characteristics (pH and temperature decline,
dressing percentage, ribeye area and backfat thickness) the LW was considered as a covariate.
Least square means were computed for main and interactive effects and separated statistically
using F-protected (P<0.05) t-tests. To evaluate the degree of association between the
135
different physicochemical variables that explain color and tenderness, Pearson correlations
were used (P≤0.05).
Results
General characteristics
Table 1 shows the effect of age and category on LW and carcass characteristics. A significant
interaction between sex category and slaughter age (S x SA) was observed for LW (P<0.001).
At older age (M20), LW increased by about 4 % in CM and 9 % in NCM. Hot carcass weight
was lower in CM than in NCM, and in M16 than in M20 (P<0.001). Regardless of slaughter
age, BFT was 30 % higher (P<0.01) in CM than in NCM, and REA was 11% lower
(P<0.001). The ultimate pH was lower in CM than in NCM (P<0.05; 5.46 and 5.53,
respectively).
The pH and temperature decline of the LT muscle was influenced by the interaction between
slaughter age and time of measurement (S x TM; P<0.001; Table 2). Temperature of M16
and M20 decreased as the postmortem time of measurement progressed, but at different
speeds. Although the initial and final temperatures (2 and 26 h postmortem) of LT were
similar for M16 and M20, the LT temperatures at 5, 8 and 14 h postmortem were lower for
M16 than for M20. In addition, muscle temperature was higher in CM than in NCM,
irrespective of the postmortem time (P<0.001; 12.06 and 11.13 °C, respectively). Muscle pH
was 2.2 % higher in M16 than in M20 only at 2 h postmortem, with no differences being
observed in the remaining postmortem measurement times (P>0.05).
136
Table 1: Effect of sex category and slaughter age on live weight and carcass characteristics of Brangus cattle
M16 M20 Significance
SEM
CM NCM CM NCM S SA S x SA
Animal live weight and Carcass characteristics
Live weight, kg 393.84 c 404.70 b 410.76 b 443.97 a 4.07 *** *** ***
Hot Carcass weight, kg 218.67 c 228.33 b 235.53 b 252.93 a 3.19 *** *** ns
Dressing percentage (HCW/LW x 100) 56.32 56.66 57.14 56.45 0.54 ns ns ns
a b a b
Backfat thickness, mm 4.55 3.07 4.55 3.95 0.50 ** ns ns
2 a b a b
Ribeye area, cm 57.30 63.29 59.16 67.50 1.70 ** ns ns
Temp@pH6 17.51 16.73 19.58 19.59 1.46 ns ns ns
pH@Temp12 5.74 5.81 5.75 5.80 0.07 ns ns ns
a b a b
pHu 5.42 5.57 5.45 5.61 0.02 * ns ns
M16= males slaughtered at 16 mo of age; M20= males slaughtered at 20 mo of age; NCM= non-castrated males; CM= castrated males; SEM= standard error of
the mean; S= sex category; SA= slaughter age; S x SA= interaction between sex category and slaughter age; Temp@pH6= muscle temperature when the pH is 6;
pH@Temp12= pH value when muscle temperature is 12 °C; pHu= ultimate pH at 24 h postmortem;
abc
LS-means with different superscripts within a row are different (P<0.05). *: P<0.05; **: P<0.01; ***: P<0.001; ns= P>0.1
137
Table 2: Evolution of temperature and pH measured in the Longissimus thoracis muscle during the first 26 h postmortem in Brangus
cattle non-castrated and castrated males slaughtered at 16 months or at 20 months of age
Slaughter age M16 M20
Sex category CM NCM CM NCM SEM Significance
TM
pH 2 6.28 a 6.35 a 6.18 b 6.18 b 0.02 SA **; TM ***; SA x TM: ***
5 5.81 5.84 5.97 5.91
8 5.69 5.67 5.78 5.72
14 5.56 5.54 5.62 5.65
26 5.43 5.45 5.55 5.61
Temperature 2 23.23 A 22.43 B 23.65 A 23.10 B 0.12 S: ***; SA: ***; TM: ***; SA x TM: **
5 15.38 Aa 14.15 Ba 17.49 Ab 16.39 Bb
8 8.96 Aa 6.88 Ba 13.86 Ab 12.24 Bb
14 3.97 Aa 2.43 Ba 8.25 Ab 7.45 Bb
26 3.74 A 3.69 B 2.79 A 2.59 B
M16= males slaughtered at 16 mo; M20= males slaughtered at 20 mo; NCM= non-castrated males; CM= castrated males; TM= time of measurement; SEM=
standard error of the mean; S= sex category; SA= slaughter age. *: P<0.05; **: P<0.01; ***: P<0.001. ns= P>0.05 not significant effects (P>0.1) are not
described.
Different capital letters indicate differences between S and SA.
Different letters indicate differences between SA and PA
138
Warner Bratzler Shear Force, glycolysis variables, and meat color

The WBSF of the LT muscle was affected by the two main effects evaluated (P<0.05), but
by none of their interactions (P>0.05; Table 3). The WBSF was 9 % lower in CM than in
NCM, 7 % higher in M16 than in M20, and 36 % higher with 2 d than 14 d of postmortem
aging. In contrast, the WBSF of ST was affected only by the aging period, decreasing by
12 % from 2 to 14 d.
139
Table 3: Effect of sex category and slaughter age on Longissimus thoracis (LT) and semitendinosus (ST) muscle characteristics (color
and WBSF) of Brangus cattle
Slaughter age M16 M20
Sex category CM NCM CM NCM
PA 2 days 14 days 2 days 14 days 2 days 14 days 2 days 14 days SEM Significance
LT WBSF (N) 42.43wx 30.91yz 44.32w 32.67yz 37.59xy 27.48z 43.40wx 31.91yz 1.00 S*, SA*, PA***
Color
L* 43.45Aa 42.68Aab 42.25ABa 41.52ABab 40.52Bb 41.95Bab 41.73ABb 42.24ABab 0.19 SA*, S x SA*, SA x PA*
a* 22.52 21.85 21.72 22.35 21.58 22.82 21.22 21.91 0.14
a
b* 15.71 14.73ab 14.86a 14.73ab 14.25b 15.09ab 14.36b 14.45ab 0.10 SA*, SA x PA*
ST WBSF (N) 42.15wx 36.99y 44.75w 38.17xy 43.43w 38.42xy 43.06w 40.76wxy 1.06 PA***
Color
L* 49.17A 45.29A 47.87A 45.03A 46.48B 42.20B 48.53A 43.56A 0.35 SA**, PA***, S x SA*
a* 14.17c 18.30a 14.06c 18.35a 18.05a 17.67c 15.41a 17.24c 0.28 PA***, SA x PA***
b* 20.29b 19.53b 20.03b 19.49b 22.19a 18.33c 21.16a 18.43c 0.21 PA***, SA x PA***
M16= males slaughtered at 16 mo; M20= males slaughtered at 20 mo; NCM= non-castrated males; CM= castrated males; PA= postmortem aging period; SEM=
standard error of the mean; WBSF= Warner Bratzler Shear Force; L* (lightness), a* (red index) and b* (yellow index); S= sex category; SA= slaughter age. *:
P<0.05; **: P<0.01; ***: P<0.001; ns= P>0.05.
not significant effects (P>0.1) are not described.
wxy
LS-means with different superscripts within a row are statistically different (P<0.05).
Different capital letters indicate differences between S and SA.
Different letters indicate differences between SA and PA
140
Neither the LT muscle intramuscular fat (IMF) nor the sarcomere length (SL) or the
myofibrillar fragmentation index (MFI) was affected by the treatments (P>0.05, Table 4).
The LT total collagen (TC) content was lower (P<0.01) but the proportion of soluble collagen
(SC) content was higher (P<0.001) in CM than in NCM. In the LT muscle, the proportion of
SC was reduced (39 %) with increasing slaughter age (P<0.001). The LT muscle glycogen
concentration was 5 % higher in the M20 than in M16 (P<0.05). The WBSF of LT was
positively associated with total collagen content (r= 0.54; P<0.01) and negatively with
myofibrillary fragmentation index (r= -0.39; P<0.05).
As in the LT, the TC content of the ST muscle was lower (P<0.05) in CM than in NCM. The
ST muscle from the CM had greater sarcomere length than that from the NCM (P<0.001).
The IMF of the ST muscle was higher in M16 than in M20 (P<0.05), but no effects were
observed between sex categories (P>0.05). The WBSF of ST was positively associated with
total collagen content (r= 0.61; P<0.05).
The lightness (L*) of the LT muscle was affected (P<0.05; Table 2) by the S x SA interaction
or by slaughter age x postmortem aging period (SA x PA) interaction. The highest L* in LT
was observed in CM-M16, and the lowest one in CM-M20, with the L* of the NCM being
intermediate and similar between M16 and M20. In addition, the L* and b* of the LT were
higher for the M16 steaks aged for 2 d than for those from M20 aged also for 2 d, whereas
steaks from M16 and M20 aged for 14 d had intermediate values, with no differences from
those of M20 aged for 2 d (P<0.05; Table 3).
In contrast, the L* of the ST muscles was lower in CM-M20 (P<0.05). In turn, the a* and b*
of the ST muscle were affected by the interaction between slaughter age and aging period.
The a* of the ST muscle was higher for M16 aged for 14 d than for M20 aged for 2 d, being
intermediate for M20 aged for 14 d, whereas the ST muscle from M16 aged for 2 d had the
lowest a* (P<0.001, Table 2). The b* of the ST muscle was highest for M20 meat aged for 2
d and lowest for M20 meat aged for 14 d (P<0.001), being intermediate for M16 meat aged
2 and 14 d.
141
Table 4: Effect of sex category and slaughter age on meat quality characteristics of the longissimus thoracis and semitendinosus
muscles of Brangus cattle
M16 M20 SE Significance
Muscle CM NCM CM NCM M S SA S X SA
Sarcomere lenght, µm 2.00 2.07 1.96 2.01 0.02 ns ns ns
-1
Intramuscular fat (g of lipids fresh tissue) 2.82 2.22 2.49 1.94 0.17 ns ns ns
−1 b a ab a
Total collagen (mg fresh tissue) 2.13 2.82 2.36 2.92 0.12 ** ns ns
LT Soluble collagen (total collagen ratio found as soluble
20.68 a 14.18b 14.57b 7.40 c 1.19
collagen, %) *** *** ns
−1 ab b ab a
Glycogen (g fresh tissue, µmol glucose) 103.35 89.26 111.04 115.82 4.34 ns * ns
Myofibrillar fragmentation index 82.08 78.83 87.74 82.66 2.48 ns ns ns
Sarcomere lenght, µm 2.26 a 2.13 b 2.19 ab 2.07 b 0.05 *** ns ns

Intramuscular fat (g of lipids-1 fresh tissue) 3.80 ab 4.04 a 3.03 ab 2.43 b 0,50 ns * ns
Total collagen (mg−1 fresh tissue) 4.09 b 4.90 a 4.75 a 5.01 a 0.22 * ns ns
ST Soluble collagen (total collagen ratio found as soluble
6.59 5.24 5.35 5.45 0.33
collagen, %) ns ns ns
Glycogen (g−1 fresh tissue, µmol glucose) 97.97 112.14 92.04 94.98 3.14 ns ns ns
Myofibrillar fragmentation index 81.21 71.34 89.03 84.53 2.57 ns ns ns
M16= males slaughtered at 16 mo; M20= males slaughtered at 20 mo; CM= castrated males; NCM= non-castrated males; SEM= standard error of the mean; S=
sex category; SA= slaughter age; S x SA= interaction between sex category and slaughter age; LT: Longissimus thoracis; ST: semitendinosus.
abc
LS-means with different superscripts within a row are statistically different (P<0.05). *: P<0.05; **: P<0.01; ***: P<0.001; ns: P>0.1
142
Discussion
The trial revealed an expected outcome as non-castrated animals exhibited greater increases
in both live weight and hot carcass weight than castrated at older ages(23). This can be
attributed to the higher levels of testosterone observed in non-castrated animals, which were
also reflected in their larger ribeye areas. The absence of variations in dressing percentage,
adjusted by live weight, between treatments can be attributed to the lack of disparities in
backfat thickness across different ages. Additionally, the differences observed between
castrated and non-castrated animals in BFT were not significant enough to account for any
significant variation in dressing percentage. These findings are consistent with the
conclusions drawn by other researchers who have conducted similar studies(23,24).
The study revealed that the variations in ribeye area and backfat thickness between different
sex categories had an impact on the decline of LT muscle temperature(25). However, despite
lower temperatures observed in non-castrated animals, no differences in sarcomere length
were found between sex categories in the LT muscle. Furthermore, although there were
differences in sarcomere length in the ST muscle between sex categories, the temp@pH 6
remained above 12 °C for both sex categories, which was suggested as the minimum
threshold to avoid shortening and meat toughening(4,26), in agreement with previous
records(2).
The castration of Brangus males led to a reduction of the WBSF for the LT steaks, as reported
by other authors(2,5,27). This result was in line with the lower TC content as well as the higher
SC content observed in the LT muscle of CM than in that of NCM. This different content of
TC and SC could be attributed to a lower testosterone level in castrated than in non-castrated
cattle(8).
Aging the muscles for 14 d instead of 2 d resulted in a higher improvement in WBSF for the
LT muscle(5). It is known that the LT muscle is highly influenced by myofibril degradation(28).
The association between MFI and TC with WBSF suggests that, at 2 d, the differences in
WBSF in LT muscle were associated with differences in proteolytic activity; however, at 14
d, the existing correlation with TC would indicate that the differences in proteolytic activity
would no longer have an effect i.e., proteolysis could have been completed, so differences in
WBSF would be due to differences in connective content(5,29).
In present study, castration and slaughter age treatments did not affect WBSF values for ST
steaks(5). This could be due to the high TC content of this muscle as compared to other
muscles and the positive correlation found between TC content and WBSF of ST muscle. It
has been proposed(5,9) that collagen content would be the major factor affecting meat
tenderness and that it might mask any potential improvement due to other effects.
143
In the present study, in agreement with findings reported by other authors(1,7), the higher L*
in both muscles observed in younger castrated animals were related to the lower pH and
temperature decline of the former(28), and probably to the increasing myoglobin content with
age and testosterone(29). On the other hand, the absence of variation in color variables of aged
LT muscle in older animals might be attributed to the increased color parameter values due
to postmortem aging, which could reduce differences among animal treatments(30). In the case
of unaged samples of ST muscle, the higher levels of yellowness and redness observed in
older animals(29) can be attributed to the accumulation of myoglobin pigments as age
progresses(31,32). Additionally, this phenomenon may also be influenced by the higher pH
values observed in M20(31). Nevertheless, at 14 d, as a consequence of the postmortem aging
and the decreased color stability(33), these differences were not observed, except for the b* in
M16, which were only 5 % higher than in M20. The latter could be associated with a higher
metmyoglobin content in the M16 aged meat(30).
Since bulls are more susceptible to pre-slaughter stress than steers, their probabilities to
produce meat with higher pHu and dark meat are also higher(34). In the current study, the pHu
of bulls was slightly higher than that of steers, but no dark meat was observed; the pHu was
within the optimal range(31) (5.4-5.7).
Irrespective of the age at slaughter, the slaughtering of non-castrated males resulted in an

increase in hot carcass weight and ribeye areas. However, backfat thickness decreased
compared to castrated males. Regardless of the manipulation of castration or age at slaughter,
the dressing percentage remained unaffected. The effects of castration and slaughter age of
Brangus males on the meat quality characteristics differ in the different muscles evaluated.
Muscles with high amount of connective tissue as ST did not generate differences in WBSF
irrespective of the treatments. In contrast, muscles with low amount of connective tissue as
LT was affected by castration and age of slaughter associated to pHu, myofibrillar
fragmentation index, total collagen and soluble collagen content. Castration produced lighter
colors in both muscles associated to pHu and myoglobin content.
This work is part of the Doctoral Dissertation of the senior author at the Graduate Program
in Agricultural Sciences, Faculty of Agricultural Sciences, National University of Mar del
Plata, Argentina. This research was funded by Nacional Institute of Agricultural Technology
(INTA), Argentina and Research Council from Catholic University of Salta, Argentina
(UCASAL) (RR N° 694/2012, 1294/2015). Support for this research project was also
144
provided by Bermejo SA and San Pablo Alberdi SA, Salta Province, Argentina. We certify
that there is no conflict of interest.
Literature cited:
1-Marti S, Realini CE, Bach A, Perez–Juan M, Devant M. Effect of castration and slaughter
age on performance, carcass, and meat quality traits of Holstein calves fed a high-
concentrate diet. J Anim Sci 2013;(91):1129–114.
2-Silva LHP, Rodrigues RTS, Assis DEF, Benedetti PDB, Duarte MS, Chizzotti ML.
Explaining meat quality of bulls and steers by differential proteome and
phosphoproteome analysis of skeletal muscle. J Proteom 2019;(199):51–66.
3- Steen RWJ. The effect of plane nutrition and slaughter weight on growth and food
efficiency in bulls, steers and heifers of three breed crosses. Livest Prod Sci 1995:(42):
1-11
4-Page JK, Wulf DM, Schwotzer TR. A survey of beef muscle color and Ph. J Anim Sci
2001;79(3):678-87.
5-Rodriguez J, Unruh J, Villarreal M, Murillo O, Rojas S, Camacho J. Carcass and meat

quality characteristics of Brahman cross Bulls and steers finished on tropical pastures in
Costa Rica. Meat Sci 2014;(96):1340–1344.
6-Weston AR, Rogers PRW, Althen TG. Review: the role of collagen in meat tenderness.
Prof Anim Sci 2002;18(2):107-111.
7-Nian Y, Kerry JP, Prendiville R, Allen P. The eating quality of beef from young dairy bulls
derived from two breed types at three ages from two different production systems. Irish
J Agric Food Res 2018;56(1):31-44.
8-Sadowska A, Swiderski F, Rakowska R, Nogalski Z. The quality of steer and bull meat
obtained by crossing Holstein – Friesian cows with Charolais bulls. Pak J Agr Sci
2017;(54):899-905.
9-Rhee MS, Wheeler TL, Shackelford SD, Koohmaraie M. Variation in palatability and
biochemical traits within and among eleven beef muscles. J Anim Sci 2004;82(2):534–
550.
10-Starkey CP, Geesink GH, Oddy VH, Hopkins DL. Explaining the variation in lamb
longissimus shear force across and within ageing periods using protein degradation,
sarcomere length and collagen characteristics. Meat Sci 2015;(105):32–37.
145
11-Mazzucco JP, Melucci LM, Villarreal EL, Mezzadra CA, Corva P, Motter MM, et al.
Effect of ageing and μ-calpain markers on meat quality from Brangus steers finished on
pasture. Meat Sci 2010;(86):878–882.
12-dos Santos MD, de Almeida Rego FC, da Silva JM, Costa DS, de Souza CN, Santana JL.
Rendimento e acabamento da carcaça de novilhos inteiros e castrados da raça Brangus
terminados em confinamento. Rev Bras Hig San Anim 2014;8(3):62–71.
13-Elzo MA, Johnson DD, Wasdin JD. Driver Carcass and meat palatability breed
differences and heterosis effects in an Angus–Brahman multibreed population. Meat Sci
2012;(90):87–92.
14-Seenger J, Nuernberg G, Hartung M, Szucs E, Ender K, Nuernberg K. ANKOM – a new

instrument for the determination of fat in muscle and meat cuts – a comparison. Arch
Tierz Dummerstorf 2008;51(5):449-457.
15-Warner–Bratzler shear-force American Meat Science Association (AMSA). 1995.
16-Bergman I, Loxley R. Two improved and simplified methods for the spectrophotometric
determination of hydroxyproline. Ann Chem 1963;(35):1961–1965.
17-Hill HF. The solubility of intramuscular collagen content in meat animals of various ages.
Food Sci 1966;(31):161–166.
18-Cross HR, West RL, Dutson TR. Comparison of methods for measuring sarcomere length
in beef muscle. Meat Sci 1981;(5):261-266.
19-Monin G, Sellier P. Pork of low technological quality with a normal rate of muscle ph fall
in the immediate postmortem period: The case of the Hampshire breed. Meat Sci
1985;(13):49-63.
20-Pighin DG, Davies P, Grigioni G, Pazos AA, Ceconi I, Mendez D, Buffarini M, Sancho
A, Gonzalez CB. Effect of slaughter handling conditions and animal temperament on
bovine meat quality markers. Arch Zootec 2013;(62):399–404.
21-Neath KE, Del Barrio AN, Lapitan RM, Herrera JRV, Cruz LC, Fujihara T, Muroya S,
Chikuni K, Hirabayashi M, Kanai Y. Difference in tenderness and pH decline between
water buffalo meat and beef during post-mortem ageing. Meat Sci 2007;(75):499–505.
146
22-Hopkins DL, Martin L, Gilmour AR. The impact of homogenizer type and speed on the
determination of myofibrillar fragmentation. Meat Sci 2004;(67):705-710.
23- Kuss F, López J, Jardim-Barcellos JO, Restle J, Moletta LJ, Perotto D. Características da
carcaça de novilhos não-castrados ou castrados terminados em confinamento e abatidos
aos 16 ou 26 meses de idade. R Bras Zootec 2009;38(3):515-522.
24- Restle J, Vaz FN. Eficiência e qualidade na produção de carne bovina. In: Reuniao
Annual da Sociedade Bras de Zootec. Santa Maria. 2003:40.
25-Aalhus JL, Janz JAM, Tong AKW, Jones SDM, Robertson WM. The influence of chilling
rate and fat cover on beef quality. Can J Anim Sci 2001;8(3):321-330.
26-Battaglia C, Vilella GF, Bernardo APS, Gomes CL, Biase AG, Albertini TZ, Pflanzer SB.
Comparison of methods for measuring shear force and sarcomere length and their
relationship with sensorial tenderness of longissimus muscle in beef. J Texture Stud
2019;(51):252–262.
27-Fitzpatrick LA. Growth and meat quality of grain finished entire male Bos indicus cattle.
Project code: B.NBP.0486. M & Liv Austr Lim, North Sydney, Australia; 2014.
28-Koohmaraie M, Matthew PK, Shackelford SD, Veiseth E, Wheeler TL. Meat tenderness
and muscle growth: is there any relationship? Meat Sci 2002;(62):345–352.
29-Wright SA, Ramos P, Johnson DD, Scheffler JM, Elzo MA, Mateescu RG, Bass AL, Carr
CC, Scheffler TL. Brahman genetics influence muscle fiber properties, protein
degradation, and tenderness in an Angus-Brahman multibreed herd. Meat Sci
2017;(135):84-93.
30-Gil M, Serra X, Gispert M, Angels OM, Sañudo C, Panea B, et al. The effect of breed-
production systems on the myosin heavy chain 1, the biochemical characteristics and
the color variables of longissimus thoracis from seven Spanish beef cattle breeds. Meat
Sci 2001;(58):181–188.
31-Ijaz M, Jaspal MH, Hayat Z, Yar MK, Badar IH, Ullah S, et al. Effect of animal age,
postmortem chilling rate, and aging time on meat quality attributes of water buffalo and
humped cattle bulls. Anim Sci J 2020;(91):e13354.
32-Hughes JM, Clarke FM, Purslow PP, Warner RD. Meat color is determined not only by
chromatic heme pigments but also by the physical structure and achromatic light
scattering properties of the muscle. Compr Rev Food Sci Food Saf 2019;(19):44–63.
147
33-Oliete B, Moreno T, Carballo JA, Varela A, Monserrat L, Sánchez L. Influence of ageing

time on the quality of yearling calf meat under vacuum. Eur Food Res Technol
2005;(20):489–493.
34-Duarte MS, Paulino PVR, Fonseca MA, Diniz LL, Cavali J, Serão NVL, et al. Influence
of dental carcass maturity on carcass traits and meat quality of Nellore bulls. Meat Sci
2011;(88):441–446.
148
Article
Construction and validation of questionnaires to assess the risk of

veterinary antibiotics in egg consumption and their impact on food safety
Eriberto Joel Tejada Rodríguez a,b
Andrea Arreguín b,c*
a
Universidad Católica del Cibao (UCATECI). Facultad de las Ingenierías, Escuela de
Agronomía. La Vega, República Dominicana.
b
Universidad Internacional Iberoamericana. Campeche, México.
c
Universidad Autónoma de San Luis Potosí. Facultad de Enfermería y Nutrición. San Luis
Potosí, México.
*
Corresponding author: andrea.arreguin@uaslp.mx
Abstract:
Poultry production is one of the most important agricultural sectors worldwide due to the
high nutritional value of its products, such as meat and eggs, for human consumption. In this
regard, veterinary antibiotics are used to treat or prevent disease-causing pathogens in order
to ensure and maintain production. The objective of the study was to design and validate two
questionnaires for assessing the risk of veterinary antibiotics used in egg-laying hens and
their perceived impact in relation to food safety. Its logic and the validity of its content were
determined by expert evaluation. Its construct validity was assessed by exploratory factor
analysis, and its reliability, with Cronbach's Alpha coefficient. The survey was applied to 44
establishments or egg producers in the Espaillat province and to 385 consumers in the Santo
Domingo province. A Cronbach's alpha coefficient of 0.799 was obtained for egg producers
and veterinarians, and of 0.771, for consumers. The principal component analysis identified
a KMO sample size adequacy measure of 0.558 for egg producers and veterinarians, and
0.797 for consumers. The questionnaire for egg producers and veterinarians consists of 8
factors and 22 items, and the questionnaire for consumers, of 3 factors and 8 items. The
149
results confirm that the scale found is reliable and valid for the construct the risks associated
with the potential consumption of food containing veterinary antibiotic residues.
Keywords: Egg, Food Safety, Risks, Reliability, Antibiotic, Factor Analysis.
Introduction
Safe animal feeding is important for animal health, animal food consumer safety, and the
environment. There is a close link between the safety of animal feed and derived foods such
as eggs. However, additives are deliberately added to animal feed or to the animal directly(1).
While eggs are a high-demand product that has promoted the growth of the poultry industry
and intensive agriculture, they have also increased the morbidity and mortality of farm
poultry, which in turn can lead to diseases in the population such as fowl cholera, avian flu,
spotted liver disease, avian salmonellosis, infectious bronchitis, Marek's disease, Gumboro
disease, and parasitic diseases(2) due to bacteria, viruses, fungi, internal and external parasites,
and other handling-related diseases(3). Veterinary antibiotics are one of the most viable
solutions to combat them.
There is evidence that some poultry producers administer human antibiotics or antibiotics
prescribed for other animal species(4); this may be legal, but their residues may be present in
eggs, egg byproducts, and biowaste, including eggshells(5), leading to the development of
antimicrobial resistance(6). Thus, the presence of antibiotics in egg yolk and albumin is related
to the active ingredient or to the pharmacokinetic properties of the antibiotic in question.
which will follow different distribution routes within the organism or in the animal tissues,
leaving residues that depend on the type of antimicrobial(7). Consequently, this instills a
suspicion of unsafety in egg consumers due to the potential risks involved, mainly because
of the constant health crises and alarms, such as the avian flu virus and others that attack
poultry.
Food safety is highly compromised when the Maximum Residue Limits, the withdrawal
periods for the antibiotics administered, the effects of antibiotics on animals, and the
regulatory standards for the use of veterinary antibiotics are not respected. At the
international level, the norm CX/MRL 2-2021 of the Codex Alimentarius of the United
150
Nations’ World Health Organization and Food and Agriculture Organization (FAO), which
deals with Maximum Residue Limits (MRLs) and Risk Management Recommendations
(RMR) for veterinary antibiotic residues in food, is taken as a reference(8). In the case of the
Dominican Republic, it is regulated by Decree No. 354-10, which establishes the technical
regulation of the MRLs of veterinary antibiotics and related substances in food of animal
origin(9). This implies that consumers are constantly exposed to this type of antibiotics and
any other additives used in animal feed and disease control that can put their health at risk.
Therefore, it is of great interest to have instruments to determine the reliability and validity
of the use of veterinary antibiotics in poultry, in addition to the consumer’s knowledge,
attitude, and practice (KAP) for the consumption of food of animal origin, as all these play a
role in ensuring food safety.
The objective of this research was to design and validate a questionnaire to assess the risk of
veterinary antibiotics used in poultry production in egg-laying hens and their perceived
impact on the consumers in terms of food safety in the Dominican Republic.
Design
A study was conducted with a quantitative and qualitative approach and an analytical cross-
sectional design for the construction and validation of an instrument (questionnaire) to assess
the risk of veterinary antibiotics in egg consumption and their impact on food safety. Study
participants received written information on the purpose and procedures of the study, as well
as the right to withdraw at any time. They were assured that the data would be treated
confidentially. Prior to the data collection, informed consent was obtained from each
participant. Participation was on a voluntary basis.
Study population
The study population included the 2010 national census conducted by the National Statistics
Office (Oficina Nacional de Estadística, ONE) of the Dominican Republic. A 95 %
confidence level and a 5 % error were estimated for a total of 385 people in the Santo
Domingo province and 44 farms or veterinaries in the Espaillat province, both in the
151
Dominican Republic. The selected poultry farms had the characteristics of being managed
under an intensive production system (birds confined in cages or covered all the time) and
were managed within the category of small and medium-sized enterprises.
Research instrument
An online questionnaire was designed to be filled out by two groups ―1) Poultry producers
in the selected sample and veterinary-antibiotics sales managers of veterinary and
agrochemical centers, and 2) Table egg consumers― in order to obtain information on the
perception of the use of veterinary antibiotics, their residual nature and the relationship with
food safety and the risk they may pose to human health (Annex 1). In addition, there were
collected general data and other data related to the characteristics of the veterinary antibiotics
used in this species (commercial presentation, active ingredient, pharmaceutical form,
concentration), the management of veterinary antibiotics (dosage used, route, and frequency
of administration, duration of treatment, withdrawal time, indications, precautions-warnings-
recommendations) and to who prescribes the antibiotics(10-11).
Questions were developed based on the researchers' previous experience, literature reviews,
or expert opinions(10-11). The questionnaires were structured considering 15 domains or
dimensions. The first questionnaire consists of 29 items, divided into ten sections: 1) General
characteristics of egg producers, according to factors such as age, sex, name of the
commercial establishment or poultry farm, sector, and province; 2) Technical characteristics
of the control and prescription of veterinary antibiotics, knowledge and compliance with
regulations for their use in poultry production; 3) Characteristics of the veterinary antibiotics
used in poultry production; 4) Technical factors of poultry health management and use of
veterinary antibiotics; 5) Duration of veterinary treatments applied to the birds; 6) Frequent
application of veterinary antibiotics to laying hens; 7) Regular use of veterinary antibiotics
in egg production and food safety; 8) Farm and/or veterinary administrative management; 9)
Withdrawal time of veterinary antibiotics prior to use of poultry products; 10) Management
of poultry by route of administration of veterinary antibiotics. The second questionnaire
applied to consumers consisted of 17 items, divided into five sections: 1) General consumer
characteristics; 2) Characteristics of egg consumption such as quantity and frequency; 3)
Consumer perception of the presence of veterinary antibiotic residues in eggs and regulatory
compliance by poultry producers; 4) Relationship between egg consumption and egg
poisoning, and 5) Purchase and verification of the quality and hygiene conditions of eggs at
the point of sale (supermarket, market, etc.). Responses to the items were generally four- or
five-point Likert scales. A version of the questionnaire was developed using the Google
Forms platform.
152
Validation of the instrument
Validation of the specific contents was carried out based on expert review. Five experts were
recruited from various agricultural science disciplines. They were asked to evaluate the
questionnaire, using a scale of 1 to 5 points to assess the basic dimensions. They also had the
option of adding open comments. Construct validity was assessed using Principal Component
Exploratory Factor Analysis (PCA); while reliability was determined by Cronbach's alpha
coefficient both overall and for each of the questionnaire’s dimensions.
Data analysis
Internal consistency was evaluated by focusing on the correlations between the questionnaire
items, which indicates their degree of theoretical adequacy. Cronbach's alpha was used for
this purpose. An alpha between 0.70 and 0.95 was considered acceptable(12). All data were
analyzed using IBM SPSS Statistics version 25, and the significance level was set at 0.05 for
the confirmatory factor analysis.
Results
A total of 429 people responded to the questionnaire. The sample of this research was made
up of 93.2 % men and 6.8 % women in the case of farms and veterinaries. For consumers, it
consisted of 50.9 % women and 49.1 % men.
Cronbach's alpha score measuring the internal consistency of the questions was satisfactory
(α= 0.799 and 0.771). Tables 1a and 1b show their values for each questionnaire. Internal
consistency was satisfactory in all the domains. However, 7 items were eliminated from the
initial 29 items of the first questionnaire (Table 1a), and 9 items, from the original 17 items
of the second questionnaire (Table 1b), considering the analysis of the corrected item total,
whose correction was deemed necessary because it exhibited a negative correlation and very
low representativeness among the questions, which affected the subsequent analysis.
153
Table 1a: Item-total statistics of the reliability test for egg producers and veterinarians
Items Scaling Scale Total Squared Cronbach's
average if variance if correlation multiple alpha if the
the item the item of the correlation item has
has been has been corrected been
suppressed suppressed items suppressed
P1. Commercial establishment/Poultry 72.5 121.605 0.672 0.751 0.788
farm.
P2. Professional veterinary prescription. 69.93 108.53 0.771 0.849 0.768
P3. Antibiotic control or management 70.32 109.989 0.507 0.517 0.781
program for poultry production.
P6. Knowledge of the regulations on 70.55 102.672 0.628 0.708 0.771
veterinary antibiotics in poultry production
and of the recommended maximum limits
for harmful residues in food.
P18. Whether or not to vaccinate poultry 69.23 127.482 0.121 0.617 0.8
regularly with antibiotics.
P8. Knowledge of the antibiotics banned by 70.39 108.847 0.538 0.636 0.779
the Dominican government for use in egg
production.
P9. Most commonly used veterinary 69.61 116.243 0.499 0.584 0.784
antibiotics in poultry egg production.
P28. To what age class of animals are 69.43 119.646 0.375 0.617 0.791
veterinary treatments applied?
P29. Route of application of veterinary 72.64 127.493 0.144 0.495 0.8
antibiotics.
P17. What is the frequency of antibiotic 72.52 123.465 0.179 0.558 0.8
administration?
P14. For what types of treatments are 69.32 127.385 0.013 0.572 0.809
veterinary antibiotics indicated?
P16. Keeps records of veterinary antibiotic 69.41 126.387 0.057 0.521 0.806
applications.
P17. Compliance with label warnings for 69.82 128.059 0.003 0.662 0.807
veterinary antibiotics administered to
animals.
P24. Often reads the labels of veterinary 69.39 119.266 0.414 0.401 0.789
products before applying them to animals.
P15. Have you applied any veterinary 71.91 120.457 0.291 0.492 0.795
antibiotics to animals for which they are not
meant?
P25. Know the withdrawal periods of 69.91 122.364 0.188 0.53 0.801
veterinary antibiotics before they are
applied.
P26. Meeting veterinary antibiotic 69.48 125.046 0.193 0.415 0.798
withdrawal deadlines is crucial for
consumer safety.
P27. What is the withdrawal period for the 71.59 113.41 0.551 0.655 0.78
veterinary antibiotics applied to the birds?
P19. Compliance with national regulations 70.16 113.16 0.399 0.451 0.789
on the use of veterinary antibiotics in poultry
farming.
P20. Veterinary antibiotics can harm if 69.68 120.594 0.264 0.409 0.796
proper withdrawal measures are not
followed.
154
P10. Are you familiar with the following 71.57 114.344 0.416 0.679 0.788
veterinary antibiotics: chloramphenicol,
dietylstilbestrol (DES), and nitrofurans?
P11. Have you treated the birds with, or sold 71.8 115.143 0.462 0.77 0.785
one of these veterinary antibiotics
(chloramphenicol, dietylstilbestrol (DES),
and nitrofurans)?
Table 1b: Total item statistics for the reliability test for the consumer questionnaire
Items Scaling Scale variance Total Squared Cronbach's
average if the if the item has correlation of multiple alpha if the
item has been been corrected items correlation item has been
suppressed suppressed suppressed
Q3. Do you consume hen’s 20.86 60.538 0.803 0.810 0.689
eggs (table eggs) as food?
Q4. How often do you 22.12 58.531 0.602 0.544 0.720

consume eggs?
Q5. Amount of egg 22.31 60.086 0.775 0.762 0.691
consumed, when eaten
according to frequency.
Q6. When you consume 21.85 54.696 0.710 0.652 0.694
eggs, how do you eat them?
Q16. When you buy egg 22.40 77.912 0.136 0.050 0.798
products, do you take notice
of the packing date, the
expiration date, and the
brand name?
Q7. Do you consider that it is 21.18 73.561 0.313 0.138 0.770

safer to consume eggs than
other foods?
Q9. Do you understand that 20.90 77.233 0.190 0.320 0.787

egg producers comply with
the Dominican animal health
legislation to treat diseases in
laying hens?
Q10. Egg producers comply 21.54 77.676 0.272 0.344 0.773

with the withdrawal period
for veterinary antibiotics in
laying hens as specified on
the label when placing egg
products on the market for
consumption.
The normality test for both questionnaires showed that there is no significant correlation (α=
0.05) for the Kolmogorov-Smirnow and Shapiro-Wilk methods, as all variables show
significance results of P<0.000, i.e., below alpha.
155
The exploratory factor analysis identified a Kaiser - Meyer - Olkin sampling adequacy
measure for egg producers and veterinarians of 0.558, while for consumers it was 0.79.
Bartlett's test of sphericity is significant at P=0.000 <α<0.0. The degree of significance has
a value of 0.000, i.e., the hypothesis of the identity matrix is rejected, and there is a correlation
between the variables (Tables 2 and 3).
The total variance explained test for egg producers and veterinarians found that the first 8
components were able to account for 72.035 % of the cumulative variance representativeness
of the selected items (Table 2). For consumers, the amount of total variance that is explained
by each extracted factor is 3 factors, with a cumulative variance representativeness of
74.807 % (Table 3).
Table 2: Results of total variance explained for the questionnaire applied to egg producers
and veterinarians
Component Baseline eigenvalues Sums of squared extraction Sums of loads squared by rotation
charges
Total % of Cumulative Total % of Cumulative Total % of Cumulative
variance % variance % variance %
1 5.122 23.283 23.283 5.122 23.283 23.283 3.424 15.565 15.565
2 2.296 10.435 33.718 2.296 10.435 33.718 2.458 11.171 26.736
3 2.011 9.140 42.858 2.011 9.140 42.858 2.001 9.097 35.833
4 1.709 7.769 50.627 1.709 7.769 50.627 1.775 8.068 43.901
5 1.309 5.948 56.575 1.309 5.948 56.575 1.634 7.425 51.326
6 1.198 5.444 62.019 1.198 5.444 62.019 1.535 6.978 58.304
7 1.113 5.060 67.080 1.113 5.060 67.080 1.521 6.913 65.217
8 1.090 4.955 72.035 1.090 4.955 72.035 1.500 6.818 72.035
9 .906 4.120 76.154
10 .843 3.831 79.985
11 .755 3.430 83.416
12 .625 2.840 86.256
13 .600 2.728 88.983
14 .540 2.454 91.437
15 .430 1.955 93.392
16 .346 1.573 94.965
17 .305 1.389 96.354
18 .235 1.068 97.421
19 .216 .982 98.404
20 .163 .741 99.144
21 .112 .511 99.655
22 .076 .345 100.000
Extraction method: principal component analysis.
Kaiser-Meyer-Olkin measure of sampling adequacy 0,558
Bartlett's test for sphericity Approx. chi-square 364.243
gl 231
Sig. 0,000
156
Table 3: Total variance explained results for consumers

Component Baseline eigenvalues Sums of squared extraction Sums of loads squared by
charges rotation
Total % of Cumulative Total % of Cumulative Total % of Cumulative
variance % variance % variance %
1 3.431 42.884 42.884 3.431 42.884 42.884 3.190 39.876 39.876
2 1.532 19.151 62.035 1.532 19.151 62.035 1.627 20.338 60.213
3 1.022 12.772 74.807 1.022 12.772 74.807 1.167 14.594 74.807
4 .808 10.096 84.902
5 .443 5.537 90.439
6 .395 4.934 95.373
7 .238 2.980 98.352
8 .132 1.648 100.000
Kaiser-Meyer-Olkin measure of sampling adequacy 0,797
Bartlett's test for sphericity Approx. chi-square 1421.936
gl 28
Sig. 0,000
In the test of unidimensionality of the construct, as established by Kaiser's rule in the

sedimentation graph, 8 factors were obtained according to the line drawn at the eigenvalue
level for egg producers and veterinarians and 3 for consumers, which explain most of the
total variability (Figures 1 and 2).
Figure 1: Questionnaire survey from egg producers and veterinarians
157
Figure 2: Questionnaire for egg consumers
Tables 4 and 5 of the rotated component matrix show the component data that were extracted,
using the Varimax orthogonal rotation with Kaiser normalization, for eight components for
egg producers and veterinarians and three components for consumers. The cut-off point as
coefficient of factor loadings of the weights and weightings started at 0.5 within each factor,
and the communality value was equal to or greater than 0.5.
The instrument or model studied for egg producers and veterinarians was structured with 22
items grouped into 9 factors or dimensions. For consumers, it was made up of 8 items and 3
factors or components.
Table 4: Rotated component matrix for egg producers and veterinarians

Rotated component matrixa
Items Component Communality
1 2 3 4 5 6 7 8 Extraction
P1 .722 .762
P2 .694 .838
P3 -.718 .723
P6 .665 .681
P18 .865 .815
P8 .664 .678
P9 .732 .663
P28 .515 .670
P29 .819 .812
P17 .524 .616 .685
P14 -.673 .686
158
P16 .836 .789

P17 -.630 .771
P24 .664 .513
P15 .834 .793
P25 .817 .788
P26 .671 .633
P27 .616 .686
P19 .512 .647
P20 .592 .649
P10 .738 .663
P11 .788 .823
Rotation method: Varimax with Kaiser normalization.
a= Rotation has converged in 16 iterations.
Table 5: Rotated component matrix for consumers

Rotated component matrixa
Items Component Comnunality
1 2 3 Extraction
Q3 .925 .893
Q4 .903 .712
Q5 .867 .846
Q6 .843 .777
Q16 .871 .752
Q7 .863 .488
Q9 .851 .760
Q10 .607 .757
Rotation method: Varimax with Kaiser normalization.
a= Rotation has converged in 16 iterations.
The components according to the group of items, and to their internal consistency, that the
model incorporates for egg producers and veterinarians are the following:
Factor 1, technical characteristics of the control and prescription of veterinary antibiotics,

and knowledge and compliance with regulations for their use in poultry production. It
comprises 9 items and accounts for 23.283 % of the total variance. For Factor 2,
characteristics of veterinary antibiotics used in poultry production, accounts for 10.435 % of
the total variance and contains 4 items. Factor 3, technical factors of poultry sanitary
management and use of veterinary antibiotics, produces 9.140 % of the total variance and
includes 4 items. Factor 4, time of duration of veterinary treatments when administered to
159
laying hens, is the cause of 7.769 % of the total variance and consists of 2 items. Factor 5,
technical characteristics in the frequent application of veterinary antibiotics to laying hens,
results in 5.948 % of the total variance and is grouped into 2 items. Factor 6, regular use of
veterinary antibiotics in egg production and food safety, accounts for 5.444 % total variance,
with a single item. Factor 7, technical characteristics of bird handling in the administration
routes of veterinary antibiotics, has an explanatory value of 5.060 % of the total variance and
is represented by 2 items. Factor 8, administrative management of the farms/veterinaries
with respect to keeping records to establish traceability systems in the production, amounts
to 4.955 % of the total variance and is represented by a single item.
The components extracted for the consumers incorporated into the model by group of items
and their internal consistency are the following:
Factor 1, characteristic of egg consumption and frequency of consumption. It covers

42.884 % of the total variance, includes 4 items that have a positive correlation with the
consumption of hen’s eggs (table eggs) as food; the number of eggs consumed according to
the frequency; the manner of egg consumption, and the frequency of consumption of eggs.
Factor 2, purchase and verification of the quality and hygiene conditions of eggs at the point
of sale (supermarket, market, other). This component accounts for 19.151 % of total variance
and comprises 2 items and groups: when you buy the egg products, do you take notice of the
packing date and expiration date and the type of commercial brand? Do you consider egg
consumption to be safer than that of other foods? The latter corresponds to section 3. While,
Factor 3, consumer perception of the presence of veterinary antibiotic residues in eggs and
compliance with the regulations by poultry producers, represents the variables considered as
consumer perception of compliance by poultry farmers with the sanitary measures in egg
production. This component represents 12.772 % of the total variance, includes 2 items, and
covers compliance of egg producers in the application of the Dominican animal health
legislation to treat diseases in laying hens, as well as compliance with the withdrawal period
of veterinary antibiotics in laying hens according to the antibiotic label when placing eggs
on the market for consumption.
Discussion
The assessment of the potential risks of veterinary antibiotics in egg consumption and their
impact on food safety is not easy to analyze due to various factors associated with the use of
veterinary antibiotics. In this sense, this paper provides a practical tool to evaluate aspects
related to the use of antibiotics and its role in ensuring food safety. In the present study,
construct validity was assessed by means of an exploratory principal-component factor
160
analysis, and the internal consistency of the questionnaires was evaluated by means of
Cronbach's alpha coefficient. Cronbach's alpha model in veterinary epidemiology has been
applied very scarcely for the development, evaluation, and validation of questionnaires(13);
even so, it has been used in preventive veterinary medicine(14), being useful for this research.
The content and logical validity assessments of the questionnaires by a group of experts were
favorable. The majority of the surveyed professionals responded with a maximum score,
indicating that they agreed with the format, wording, and usefulness of the questionnaire and
that Cronbach's alpha model in veterinary epidemiology has been applied very scarcely for
the development, evaluation, and validation of questionnaires.
The internal consistency of the questionnaires obtained a Cronbach's alpha of 0.799 for the
egg producer/veterinarian questionnaire, and 0.771 for the consumers’ questionnaire,
indicating that the instruments have adequate reliability for the measurement of veterinary
antibiotic use and the perception of food safety-related impact, respectively.
Regarding the construct validation, it was observed that the principal component analysis
yielded 8 factors for the questionnaire for egg producers in poultry farms or veterinary
establishments, and 3 factors for the consumer questionnaire, which associates the similarity
of correction between the variables of the evaluated study. This suggests that what has been
described above constitutes a first insight into the perception by the farm owners,
veterinarians, and consumers of the association that exists in the use and management of
veterinary antibiotics or the use of antimicrobials in food production for human consumption.
The instrument applied to producers in egg farms and veterinary establishments and
consumers was designed to evaluate the use of veterinary antibiotics in laying hens and the
consumers' perception of the risk associated with table egg consumption and food safety. The
results show that the hypothesis in the correlation matrix was positive between the variables
with Bartlett's test of sphericity. The Kaiser-Meyer-Olkin (KMO) measures of sampling
adequacy for egg producers and veterinarians (0.558) and consumers (0.797) have a high
positive correlation, which indicates that their values are adequate because they range
between 0 and 1, i.e., they are close to unity. These results coincide with those found by
Salazar((15), who obtained a relatively high KMO (of 0.725). A KMO of over 0.80 in the data
matrix is appropriate for running the factorization(16). In another study(17), a high KMO value
(0.94) was observed for the food estimation and food frequency section, where Bartlett's test
of sphericity proved significant (P<0.001), converging in 10 iterations and a six-factor
structure.
The total variance tests of this study confirm that the variance matrix values, covariance, and
percentage of each of the items, and the eigenvalues of the quantities of poultry production
farms, veterinarians, and egg consumers are accounted for by each extracted factor and by
161
the related percentages in the equation model. The residual analysis for checking the
goodness of fit of the utilized factorial model shows that the results of the differences between
the initial observed correlation matrix and those reproduced by the model indicate that this
value is considered an indicator of good fit as it is close to absolute zero.
The analysis of the resulting principal components that were above 0.5 according to the
groups of items, both for egg producers/veterinarians and consumers, made it possible to
determine the magnitude of the samples of the effect that the variables had on each one of
the components that provide the best exposure of the initial variables obtained in each
component, with their respective positive or negative factor loadings. Loadings of 0.50 can
generally be considered strong and allow the magnitude of factor loadings to be evaluated as
a function of sample size(18,19). This allows the interpretation of the factor loadings that have
an absolute value above 0.4 with their variance of the variables evaluated(20). In this sense,
another validation study of the questionnaire on food estimation and frequency of food
consumption(17) found a correlation ≥ 0.40 with a reliability index of 0.92 for section
estimation and of 0.90 for food frequency. The data found in this study allowed us to
discriminate the variables with positive or negative factor loadings below 0.5, so that each of
the dimensions of the instrument had acceptable values (≥ 0.5) and made it possible to
perform the global scale analysis.
The domains or dimensions used for the evaluation of the use of veterinary antibiotic use and
fowl management factors in poultry production are related to the items studied by Chah et
al(21) mainly in regard to the characteristics of antibiotic use in small-scale poultry farming,
the knowledge, and the kinds and frequency of the antibiotics utilized in poultry farms.
Speksnijder et al(22) also evaluated dimensions related to having a lower threshold for
applying antibiotics to animals; their results resemble the ones obtained for the items
evaluated in this research both in sections two and eight, on the characteristics of veterinary
antibiotics used in poultry production and farm/veterinary administrative management,
respectively.
Principal component analysis for the egg producers’ and veterinarians’ questionnaire
confirmed that positive scores above 0.8 were related to such items as whether or not to
vaccinate the birds regularly, the route of application of veterinary antibiotics, knowledge of
the withdrawal periods of the antibiotics, keeping records of veterinary antibiotic
applications, and treatment with antibiotics prohibited for birds. These findings prove that
poultry producers adequately manage the following poultry components: 2) characteristics
of veterinary antibiotics used in poultry production; 4) duration time of veterinary treatments
administered to laying hens; 6) regular use of veterinary antibiotics in egg production and
food safety; 7) technical characteristics of poultry handling in veterinary antibiotic
administration routes, and 8) administrative management of farms/veterinaries with respect
to keeping records to establish a production traceability system, respectively.
162
The highest score (0.9) for the consumer questionnaire was achieved in section or domain,
characteristics of egg consumption, and frequency of egg consumption. The other assessed
sections ―including the consumers' perception of the presence of veterinary antibiotic
residues in eggs and the verification of egg quality and hygiene conditions in sales outlets
(supermarket, market, others)― have lower scores (≥ 0.6 and ≥0.8), which agree with the
results obtained by other authors(17). Studies carried out by various researchers(23,24) assessed
methods for developing food safety, knowledge, and attitude scales to determine criteria for
reliability and validity. According to the study by Al-Makhroumi et al(25), in the three
evaluated sections, the respondents had low food safety knowledge, with a value of 44 %,
compared to the other sections such as good practices, with 70 %, and positive attitudes, with
77 %. Other researchers(26) found a moderately positive correlation between the mean scores
of antibiotic knowledge and antibiotic use (0.55 P<0.001), and a moderately positive
correlation between the participants' mean scores on antibiotic resistance knowledge and
their scores for knowledge of antibiotic use (0.41 P<0.001). The results obtained from the
consumers surveyed in this study show that the second domain, on the consumers' perception
of the presence of veterinary antibiotic residues, and the third domain, of egg quality and
hygiene verification at points of sale, have low scores compared to the first domain, on the
egg consumption and frequency of consumption characteristics, indicating a lack of
independent consumer awareness of poultry management practices and little knowledge of
the antibiotics administered to laying hens.
Finally, in this study, in order to establish the model with a Cronbach's Alpha coefficient
over 0.5, it was necessary to adjust the items, i.e., to eliminate some variables that could be
important for future studies and discussions of the original model. Furthermore, as mentioned
by Hernández and Amador(27), a confirmatory factor analysis should be performed to confirm
the theory, as the purpose of the utilized factor analysis was to construct the theory.
The results of the present study confirm the reliability and validity of the questionnaire items,
finding a satisfactory fit between the use of veterinary antibiotics in egg production and egg
consumption. The value of over 0.7 obtained for both questionnaires in the assessment of the
validity and reliability of the results of Cronbach's Alpha coefficient shows that the
established model fits the extracted components with their variance of over 50 %; this
represents a strength of the research because the scale of competence used for the construct
produces fast and reliable results that serve to measure the incidence or risks in the health of
people due to the consumption of food contaminated through the use of veterinary antibiotics
in laying hens as antimicrobials or as growth promoters for egg production.
163
Institutional Review Board Statement
The study was conducted according to the guidelines of the Declaration of Helsinki and was
approved by the Institutional Review Board (or Ethics Committee) of the Iberoamerican
International University (Universidad Internacional Iberoamericana) in the minutes
registered with the number CR-181.
Acknowledgments
The authors are grateful to the National Institute for the Protection of Consumers’ Rights
(Instituto Nacional de Protección de los Derechos del Consumidor, ProConsumidor) and to
UCATECI and UNINI-Mexico for their contributions to professional training and research.
Conflicts of interest
The authors declare that they have no conflicts of interest.
Literature cited:
1. Woutersen RA, Waalkens-Berendsen I, Wester P, Rietjens IMCM. La evaluación de la
seguridad para el consumidor de los aditivos para piensos y los aditivos añadidos a los
alimentos de origen animal. Garantía de seguridad alimentaria de ECVPH 2018;99-117.
doi.org/10.3920/978-90-8686-877-3_04.
2. Moquillaza LA. Estudio de los niveles de residuos de antibióticos en músculo e hígado de

pollos beneficiados en la ciudad de Tacna. Universidad Nacional Jorge Basadre
Grdhmann. Tacna, Perú. 2012.
3. Houriet JL. Guía práctica de enfermedades más comunes en aves de corral (ponedoras y
pollos). INTA EEA Cerro Azul, Misiones. Miscelánea 2007;58:48.
4. Di Pillo F, Anríquez G, Alarcón P, Jiménez-Bluhm, P, Galdames P, Nieto V, et al.

Backyard poultry production in Chile: Animal health management and contribution to
food access in an upper middle-income country. Prev Vet Med 2019;164:41–48.
164
5. Gbylik-Sikorska M, Łebkowska-Wieruszewska B, Gajda A, Nowacka-Kozak E, Lisowski

A, Posyniak A. Transfer of enrofloxacin, ciprofloxacin, and lincomycin into eggshells
and residue depletion in egg components after multiple oral administration to laying
hens, Poultry Sci 2021;100(9):101341. doi.org/10.1016/j.psj.2021.101341.
6. Mensah KB, Ansah C. Uso irracional de antibióticos y el riesgo de diabetes en Ghana. Rev
Médica de Ghana 2016;50(2). doi:107. doi:10.4314/gmj.v50i2.9.
7. Mund MD, Khan UH, Tahir U, Mustafa BE, Fayyaz A. Antimicrobial drug residues in
poultry products and implications on public health: A review. Int J Food Prop
2017;(20):1433–1446.
8. CX/MRL 2-2021. Límites Máximos de Residuos (LMR) y recomendaciones sobre la

gestión de riesgos (RGR) para residuos de medicamentos veterinarios en los alimentos
2021. https://www.fao.org/fao-who-codexalimentarius/sh-
proxy/en/?lnk=1&url=https%253A%252F%252Fworkspace.fao.org%252Fsites%252F
codex%252FStandards%252FCXM%2B2%252FMRL2s.pdf.
9. Decreto No. 354-10. Reglamento técnico de límites máximos de residuos de medicamentos

veterinarios y afines en alimentos de origen animal. Gaceta Oficial No. 10579. 2010.
https://members.wto.org/crnattachments/2012/sps/DOM/12_2698_00_s.pdf.
10. Astaíza MJM, Benavides MCJ, López CMJ, Portilla OJP. Diagnóstico de los principales
antibióticos recomendados para pollo de engorde (broiler) por los centros agropecuarios
del municipio de Pasto, Nariño, Colombia. Rev Med Vet 2014;(27):99-110.
11. Estrella CMP. Estudio piloto sobre el análisis de residuos de antibióticos en pechuga de
pollos comercializados en la ciudad de Ambato [tesis de grado]. Universidad Técnica de
Ambato, Ecuador. 2017;92.
12. Cortina JM. What is coefficient alpha? An examination of theory and applications. J Appl
Psychol 1993;78(1): 98. https://doi.org/10.1037/0021-9010.78.1.98.
13. Dohoo I, Emanuelson U. El uso de modelos de teoría de respuesta al ítem para evaluar
escalas diseñadas para medir el conocimiento y las actitudes hacia el uso de antibióticos
y la resistencia en productores lecheros suecos. Med Vet Prev 2021;195, 105465.
https://doi.org/10.1016/j.prevetmed.2021.105465.
14. Silva GS, Leotti VB, Castro SMJ, Medeiros AAR, Silva A, Linhares DCL, Corbellini
LG. Assessment of biosecurity practices and development of a scoring system in swine
farms using item response theory. Prev Vet Med 2019;167:128–136.
15. Salazar MZ. El Test de actitudes hacia la alimentación en Costa Rica: primeras evidencias
de validez y confiabilidad. Actualidades en Psicología 2012;51-71.
165
16. López-Aguado M, Gutiérrez-Provecho L. Cómo realizar e interpretar un análisis factorial

exploratorio utilizando SPSS. REIRE Revista d’Innovació i Recerca en Educació
2019;12(2): 1–14. doi.org/10.1344/reire2019.12.227057.
17. Díaz RFJ, Franco PK. Desarrollo y validación inicial de la escala estimación y consumo
de alimento (ECA). Rev Mex Trast Alim 2012;3(1):38-44.
18. Osborne JW, Costello AB. Sample size and subject to item ratio in principal components
analysis. Practical Assessment, Research & Evaluation 2014;9(11).
http://pareonline.net/getvn.asp?v=9&n=11.
19. Mavrou I. Análisis factorial exploratorio: Cuestiones conceptuales y metodológicas. Rev

Nebrija Lingüística Aplicada 2015;19:71-80. https://revistas.nebrija.com/revista-
linguistica/issue/view/25/numero%2019.
20. Field A. Discovering statistics using SPSS. 3rd ed. London, UK: SAGE Publications.
2009.
21. Chah JM, Nwankwo SC, Uddin IO, Chah KF. Knowledge and practices regarding
antibiotic use among small-scale poultry farmers in Enugu State, Nigeria, Heliyon
2022;8:4. https://doi.org/10.1016/j.heliyon.2022.e09342.
22. Speksnijder DC, Jaarsma DAC, Verheij TJM, Wagenaar JA. Attitudes and perceptions
of Dutch veterinarians on their role in the reduction of antimicrobial use in farm animals.
Prev Vet Med 2015;121(3-4): 365–373. doi:10.1016/j.prevetmed2015.08.014.
23. Medeiros LC, Hillers VN, Chen G, Bergmann V, Kendall P, Schroeder M. Design and
development of food safety knowledge and attitude scales for consumer food safety
education. J Am Diet Assoc 2004;104(11):1671-7. doi:10.1016/j.jada.2004.08.030.
PMID: 15499353.
24. Parmenter K, Wardle J. Evaluación y diseño de medidas de conocimiento nutricional.

Rev Educ Nutric 2000;32(5):269-277. doi.org/10.1016/S0022-3182(00)70575-9.
25. Al-Makhroumi N, Al-Khusaibi M, Al-Subhi L, Al-Bulushi I, Al-Ruzeiqi M.

Development and validation of a food safety knowledge, attitudes and self-reported
practices (KAP) questionnaire in Omani consumers. J Saudi Soc Agric Sci
2022;21(7):485-492. https://doi.org/10.1016/j.jssas.2022.02.001.
26. Ozturk Y, Celik S, Sahin E, Acik MN, Cetinkaya B. Assessment of farmers' knowledge,
attitudes and practices on antibiotics and antimicrobial resistance. Animals (Basel)
2019;9(9):653. doi:10.3390/ani9090653.
166
27. Hernández OR, Amador LN. Construcción y validación de un cuestionario para evaluar
la percepción de la tutoría metodológica en los cursos de Especialización Médica. Nova
Scientia 2021;13(26). doi.org/10.21640/ns.v13i26.2698.
167
Annex 1: Questionnaires applied to poultry producers, veterinarians, and consumers

I. QUESTIONNAIRE APPLIED TO PRODUCERS AND VETERINARIANS
Section 1. General characteristics of egg producers, according to factors such as age,

sex, name of the commercial establishment or poultry farm, sector, and province
1. Name of Business Establishment/ Poultry farm: __________________________

 Name of the respondent: ____________________________________________
 Age: ______________
 Sex: ☐ M ☐ F.
 Sector: ____________________
 Province: ___________________
Section 2. Technical characteristics of the control and prescription of veterinary

antibiotics, and knowledge and compliance with regulations on their use in poultry
production
Items 1 Totally 2 Disagree 3 Neither 4 Agree 5 Totally
disagree agree nor agree
disagree
2. Are vaccines and antibiotics ☐ ☐ ☐ ☐ ☐
used in egg production under
prescription by a veterinary
professional?
3. Do you have an antibiotic ☐ ☐ ☐ ☐ ☐
control or management program for
egg production on the farm?
4. Do you have a veterinary ☐ ☐ ☐ ☐ ☐
professional in your
establishment/poultry farm to guide
and, if necessary, determine animal
diseases and apply sanitary treatments?
5. Do you understand the ☐ ☐ ☐ ☐ ☐

national and international norms and
regulations for poultry production and
animal welfare?
6. Are you aware of the ☐ ☐ ☐ ☐ ☐
standards for the use of veterinary
antibiotics to prevent the presence of
harmful residues in food after treating
an animal?
168
Section 3. Characteristics of veterinary antibiotics used in poultry production

Items 1 Totally 2 3 Neither 4 5 Totally
disagree Disagree disagree nor Agree agree
agree
7. Do you believe that veterinary antibiotics ☐ ☐ ☐ ☐ ☐
have a positive impact on bird welfare?
8. Do you know which antibiotics are ☐ ☐ ☐ ☐ ☐
prohibited by the Dominican government for use
in egg production?
9. Do you know which veterinary antibiotics ☐ ☐ ☐ ☐ ☐
are most commonly used in poultry egg
production?
10. Are you familiar with the following ☐ ☐ ☐ ☐ ☐
veterinary antibiotics: chloramphenicol,
diethylstilbestrol (DES), and nitrofurans?
11. Have you treated the birds or sold one of ☐ ☐ ☐ ☐ ☐
these veterinary antibiotics (chloramphenicol,
diethylstilbestrol (DES), and nitrofurans)?
Section 4. Technical factors of poultry health management and use of veterinary

antibiotics
Items 1 Totally 2 3 Neither 4 5 Totally
disagree Disagree disagree nor Agree agree
agree
12. Do you know which are the diseases that ☐ ☐ ☐ ☐ ☐
most frequently attack birds?
13. Do you understand that, in the case of ☐ ☐ ☐ ☐ ☐

birds, prevention is better than cure?
14. For what types of treatments are ☐ ☐ ☐ ☐ ☐
veterinary antibiotics indicated? Please choose
several options according to the type of antibiotic.
a. Respiratory and intestinal diseases.
b. Prevention
c. Growth promoter
d. Hoarseness, aches and pains
15. Have you applied any veterinary ☐ ☐ ☐ ☐ ☐

antibiotics to animals for which their use is not
appropriate?
169
Section 5. Duration of veterinary treatments applied to poultry

disagree disagree nor agree
agree
16. What is the duration of ☐ ☐ ☐ ☐ ☐
preventive, curative, or topical
treatments, according to the type of
veterinary antibiotic?
a. 3 days
b. 4 to 7 days
c. 5 days
d. 10 days
e. 15 days
f. Curative, 5 to 7 days
g. Preventive, 3 days
h. 2 to 3 weeks
Section 6. Frequent use of veterinary antibiotics in laying hens

disagree disagree agree
nor agree
17. What is the frequency of ☐ ☐ ☐ ☐ ☐

administration of antibiotics?
a. Every 24 hours
b. Continually, every 24 hours
c. Every 48 hours
d. Every 72 hours
e. Every 5 days
Section 7. Regular use of veterinary antibiotics in egg production and food safety
dagree disagree nor agree
agree
18. Do you think that birds ☐ ☐ ☐ ☐ ☐

should be vaccinated regularly if
they do not exhibit any apparent
symptoms?
19. Do you understand that ☐ ☐ ☐ ☐ ☐
national regulations regarding the
use of veterinary antibiotics in
poultry production are being
complied with?
20. Do you understand the ☒ ☐ ☐ ☐ ☐
harm that can be caused by
veterinary antibiotics utilized for
treating animal (poultry) health, if
any, when the necessary
170
precautionary measures are not

taken during the withdrawal
period?
Section 8. Farm or veterinary administrative management

Items 1 Totally disagree 2 Disagree 3 Neither 4 Agree 5 Totally
disagree nor agree
agree
21. Do you keep records of ☐ ☐ ☐ ☐ ☐
veterinary antibiotic applications,
whether preventive, curative, or
topical?
22. Do you understand that it ☐ ☐ ☐ ☐ ☐
is important to read the labels of
veterinary products before
applying them to animals?
23. Do you comply with the ☐ ☐ ☐ ☐ ☐
warnings stipulated on the labels of
veterinary antibiotics when
administering them to animals?
24. Do you frequently read ☐ ☐ ☐ ☐ ☐
the labels of veterinary products
before applying them to animals?
Section 9. Withdrawal period of veterinary antibiotics prior to use of poultry products

agree
25. Do you know the ☐ ☐ ☐ ☐ ☐
withdrawal times of veterinary
antibiotics before application?
26. Do you comply with the ☐ ☐ ☐ ☐ ☐
withdrawal times for veterinary
antibiotics when applied to animals
before the products and by-products
are destined to the consumer?
27. What is the withdrawal ☐ ☐ ☐ ☐ ☐
period of each of the antibiotics
applied?
 ___ 2 to 5 days
 ___ 7 to 10 days
 ___ 12 days
 ___ 15 days
 ___ 17 days
 ___ 20 days
 ___ 25 days
 ___ 30 days
 ___ Other
171
Section 10. Management of poultry by route of administration of veterinary

antibiotics
agree
28. Do you know at what age class ☐ ☐ ☐ ☐ ☐
the veterinary antibiotics are applied to
the animals in egg production?
29. Which is the most ☐ ☐ ☐ ☐ ☐

recommended route of application of the
veterinary antibiotics recommended to
poultry producers?
a. Oral route
b. Subcutaneous route (injected)
c. Ocular route
d. Spray
172
II. FOOD SAFETY QUESTIONNAIRE ON THE CONSUMPTION OF FOOD

CONTAMINATED WITH VETERINARY ANTIBIOTICS
Section 1. General consumer characteristics

1. Consumer characteristics:
1. Age: ______________.
2. Sex: ☐ M ☐ F.
3. Sector: ______________, Province: _______________________
Section 2. Characteristics of egg consumption such as quantity and frequency

agree
2. Have you ever been sick from ☐ ☐ ☐ ☐ ☐

eating contaminated food?
3. Do you consume hen’s eggs ☐ ☐ ☐ ☐ ☐

(table eggs) as food?
4. How often do you consume ☐ ☐ ☐ ☐ ☐
eggs?
a. Every day
b. Every other day
c. Every 3 days
d. Every 5 days
e. Weekly
f. Does not know
5. How many eggs do you eat, ☐ ☐ ☐ ☐ ☐
by frequency? Please specify:
a. Less than one egg
b. 1 egg
c. 2 eggs
d. 3 eggs
e. 4 eggs
f. More than 5 eggs
6. When you eat eggs, how do ☐ ☐ ☐ ☐ ☐

you eat them? Please choose one of the
following options:
a. Fresh and raw
b. Boiled or hard-boiled
c. Poached
d. Fried or scrambled
e. Frozen cooked
f. Pastry
173
Section 3. Consumer perception of veterinary antibiotic residues in eggs and poultry

producers' compliance with regulations
agree
7. Do you consider that it is ☐ ☐ ☐ ☐ ☐
safer to consume eggs than other
foods?
8. Do you consider that ☐ ☐ ☐ ☐ ☐
domestically produced eggs may
contain veterinary antibiotic residues?
9. Do you understand that egg ☐ ☐ ☐ ☐ ☐
producers comply with Dominican
animal health legislation for treating
diseases in laying hens?
10. Do you believe that egg ☐ ☐ ☐ ☐ ☐

producers comply with the withdrawal
period of veterinary antibiotics in
laying hens as specified on the label
when they put egg products on the
market for consumption?
11. Do you understand that ☐ ☐ ☐ ☐ ☐
organically produced eggs may contain
veterinary antibiotics?
174
Section 4. Relationship between egg consumption and intoxications due to egg

ingestion

agree
12. Have you ever been ☐ ☐ ☐ ☐ ☐
intoxicated by the ingestion of eggs?
13. How many times have you ☐ ☐ ☐ ☐ ☐
been poisoned by eating
contaminated eggs?
a. Once
b. Twice
c. Thrice
d. 4 times
e. More than 5 times
14. After getting sick, have ☐ ☐ ☐ ☐ ☐
you had any tests done to determine
the reason for your illness?
15. Have you changed your ☐ ☐ ☐ ☐ ☐

consumption habits as a result of
this situation of getting sick from
the consumption of this product?
Section 5. Purchase and verification of the quality and hygiene conditions of eggs at
the point of sale (supermarket, market, etc.)
agree
16. When you buy egg ☐ ☐ ☐ ☐ ☐
products, do you take notice of the
packing date, expiration date, and
brand name?
17. Do you check the quality ☐ ☐ ☐ ☐ ☐

and hygienic conditions of eggs
when you purchase them, such as
whether they are dirty or broken?
175
Article
José Manuel Sanes a
Juan Seva a*
María Jesús Gamón a
Inmaculada Torrego a
Eliana Abellán a
a Universidad de Murcia. Facultad de Veterinaria. Departamento de Anatomía y

Anatomía Patológica Comparadas. Murcia, España.
*Corresponding author: jseva@um.es
Abstract:
The objective was to determine the incidence of fighting cattle farms in the Spanish
dehesa, defining those that are in this territory, and quantifying the hectares they occupy
and some productive aspects in order to verify the importance of the breeding of the
fighting bull in the maintenance and conservation of its biodiversity. To this end, different
documentary sources of livestock associations and the Ministry of Agriculture, Fisheries
and Food were consulted; and 304 surveys were carried out among fighting bull farmers
in the Spanish provinces with dehesa. The area of the dehesa is 3’515,846 ha distributed
in the Autonomous Communities of Andalusia, Extremadura, Castile and Leon, Castilla-
La Mancha and Madrid, where there are 726 registered fighting cattle farms, although
only 631 of them are active in the Stud Book of the Fighting Bovine Breed (2022), with
a downward trend in recent years, and with an average census of 144 dams and 9 bulls, a
low stocking rate. The estimated number of farms in the dehesa engaged exclusively in
fighting bull farming is 581, with an average area of 534 ha and occupying 315,301 ha,
representing 8.97 % of the total Spanish dehesa, although it would amount to 347,744 ha
(9.89 %) considering the entire farm with the presence of other complementary activities.
These farms are located in 358 municipalities, in which 72.61 % of the census is less than
5,000 inhabitants, which could help to fix the rural population.
Keywords: Dehesa, Fighting bull, Hectares.
176
Rev Mex Cienc Pecu 2024;15(1): 176-191
Introduction
The dehesa is one of the most characteristic landscapes of the Iberian Peninsula, and it is
also the most characteristic and representative agrosilvopastoral system in Spain. It is a
land-use system in which perennial woody plants and arable crops coexist, either in
mixtures, zoned or sequentially over time, with the presence or absence of production
animals(1). The dehesas are classified by the European Union as Systems of High Natural
Value, they are mostly located in disadvantaged areas of the Iberian Peninsula, many of
them in natural parks and some in national parks, and they are a model of sustainable
development with great ecological, economic, and social value(2).
The dehesa system is of great economic and social importance, both because of its area
and because of the function of fixing the rural population in its nuclei, helping to minimize
the negative migratory impact and its consequences, such as ageing, increased mortality
rates, reduced activity rates and abandonment of farms. In addition, it has a great
environmental and biodiversity value, since forestry, agricultural, hunting, and livestock
activities are carried out in this territory(3,4).
The main use of the dehesa is animal production, and it is characterized by having a great
ecological relevance, contributing to maintaining and improving the fertility of the
pastures on which the cattle feed. One of the animals with the greatest presence in the
dehesa is the fighting bull. It is mostly raised extensively and has a beneficial effect on
the conservation of the land itself, since it rejuvenates the lowlands by preventing the
invasion of scrubland, prevents soil erosion and desertification thanks to balanced
grazing, which allows the optimal use of natural resources(3,5). Therefore, the proper and
sustainable management of fighting cattle farms is key to ensuring the quality and
sustainable maintenance of the dehesa agroecosystem(6).
The fighting bull is considered to be the most emblematic animal in Spain and constitutes
the greatest Spanish contribution to cattle breeding(7) and world genetics, in addition to
being one of the oldest cattle breeds in the world, and the Spanish native breed with the
greatest international fame, catalogued by various authors as a jewel of the Spanish and
world genetic heritage as well as the “guardian of biodiversity”(8). Likewise, it is
considered not as a species, but as a meta-breed or also called a breed of breeds, due to
the variety of “encastes” with wide genetic differentiation between them(9). All this is the
result of the activity of the cattle farmers, who leave their mark on the selection, playing
a fundamental role in the conservation of the environment, the ecosystem where they live,
177
the flora and fauna, even carrying out conservation programs for protected species in the
dehesa itself, as well as being stopping points for migratory birds when there is the
presence of aquifers. It has even been found that the fighting bull that grazes in the
dehesas has a contribution to their maintenance that is higher than that of the tame or
slaughter cattle(10). Likewise, the fighting bull is considered an irreplaceable tangible and
intangible cultural heritage(8). For all these reasons, the dehesa and the fighting bull are
ecological heritages that contribute to Spain being an important natural reserve of
biodiversity(8), and this combination of flora and fauna is not present in the rest of the
European countries.
This study aimed to determine the incidence of fighting cattle farms in the Spanish dehesa,
defining the number of cattle farms and farms and quantifying the hectares they occupy,
as well as some productive aspects. This was done in order to highlight the importance of
breeding fighting bulls in this European ecosystem of High Natural Value.
Collection of information
Initially, to carry out this work framed in the year 2022, several documentary sources
were considered, which contained census data of the different existing fighting cattle
farms, as well as their geographical distribution, with special attention in the main
provinces of the Autonomous Communities (ACs) of Extremadura, Andalusia, Castilla-
La Mancha, Castile and Leon, and Madrid, representative of the Spanish dehesa.
The sources consulted for this work have been the publications, in various formats (book,
compact disk, web), of each of the officially recognized cattle farmers’ associations that
manage the Stud Book of the Fighting Bovine Breed (SBFBB), among which were the
Fighting Bull Livestock Breeders Association (UCTL, for its acronym in Spanish),
Fighting Cattle Farm Association (AGL, for its acronym in Spanish), United Fighting
Cattle Breeders (GLU, for its acronym in Spanish), Spanish Association of Fighting Bull
Cattle Breeders (AEGRB, for its acronym in Spanish) and Association of Fighting Bull
Cattle Breeders (AGRL, for its acronym in Spanish). Likewise, the latest census data
published, as of December 31, 2022, on the fighting cattle breed by the National
Information System ARCA under the Ministry of Agriculture, Fisheries and Food
(MAPA, for its acronym in Spanish) were considered.
With the information available on the list of cattle farms located in the provinces of the
ACs that present dehesa, a questionnaire was prepared in 2022, in order to obtain the
information for this study. The variables collected by the questionnaire were as follows.
178
1) Name of the cattle farm. 2) Name of the farm on which it is located. 3) Locality where
the farm is located. 4) Is the cattle farm located in the dehesa? 5) Total area of the farm
in ha. 6) Area of hectares allocated to the breeding of fighting bulls. 7) Current number
of dams. 8) Current number of bulls. 9) Does the cattle farm share the farm with another?
10) Other complementary activities of the farm.
From the different contact possibilities (address, email, telephone, and social networks),
information was obtained from the owners or representatives of the fighting cattle farms
for the collection of the data specified in the questionnaire. To make it available to the
cattle farms that were the object of the sample, a simple online format was designed,
which was distributed via email or through the different digital platforms available, or
through direct contact by telephone.
Likewise, through the use of the viewer application of the Agricultural Plot Geographic
Information System (SIGPAC, for its acronym in Spanish)(11) and the Google Maps
application, the territorial location of the cattle farms was carried out, considering the
diverse cartography of the dehesa published by MAPA and the ACs affected by it, with
expression of the location coordinates. Also, through the Official Population Figures of
the Spanish municipalities file of the National Institute of Statistics (INE, for its acronym
in Spanish)(12), as of December 21, 2022, the number of inhabitants of the localities where
the studied cattle farms were located was obtained.
Analysis of information
To determine the hectares of dehesa occupied by fighting cattle farming in Spain, several
considerations were taken as a starting point. Firstly, a quantification of the area of
Spanish dehesa in hectares and its territorial delimitation was made; to this end, data were
taken from references that fit the strict definition of dehesa as a multifunctional livestock
or hunting system in which at least 50 % of the area is occupied by grassland with
scattered adult trees producing acorns and with a canopy cover fraction between 5 and
60 %(13). Next, the precise number of fighting cattle farms currently existing (inventoried)
was determined according to the association to which they belong and the farms they
occupy in the provinces with dehesa, considering the location of the corresponding
agricultural farm according to its geographical location; and, later, the number of active
fighting cattle farms in these provinces according to MAPA was determined.
Subsequently, an estimate was made of the total number of farms with dehesa in their
territory engaged in the breeding of fighting bulls, based on the percentages obtained from
the surveyed farms, and the total area occupied by them according to the average size of
the farms surveyed in the territory occupied by dehesa. Productive data of the cattle farms
were also assessed, such as the number of breeding stock and complementary activities
and the population of the municipalities where they are located.
179
The population count of cattle farms located in the provinces that have dehesa and,
therefore, on which the questionnaire was sent, was 726 cattle farms (Table 1). To
consider the result as statistically significant, it was necessary to obtain a sample with a
minimum number of 252 for the 95 % confidence level and a margin of error of 5 %,
having assessed the results of 304 surveys received, 41.87 % of the total, as of February
28, 2023.
All the data obtained from the answered surveys were recorded in a database created using
Microsoft Excel® Office 16 version and then processed using IBM SPPS Statistics®
version 28. Finally, a descriptive statistical study of the information collected and the
Kruskal-Walis test were carried out to study the possible significant differences (P<0.05)
between ACs in the number of animals, cattle farms, and hectares of the farms.
Results and discussion
Despite the large presence of fighting bulls in the Spanish dehesa, Systems of High
Natural Value, and the beneficial effect that cattle exert on its maintenance and
conservation(3,5), there are very few rigorous studies that indicate the area of dehesa
occupied by fighting cattle farming. It has even been found that the fighting bull that
grazes in the dehesas has a contribution to their maintenance greater than that of the cattle
for slaughter, and that the owners of fighting cattle have a high preference for the
continuity of the activity, so that their dehesas show an environmental value in the market
higher than the environmental value of the tame or slaughter cattle(10). For this reason, the
results obtained and the analysis carried out can be placed within the framework of a
general scarcity of specific studies that delve into the true incidence of fighting cattle
farming in the context of the dehesa in Spain.
Area of the dehesa in Spain
In Spain, the dehesa is mainly distributed in the west and southwest, covering the Castile
and Leon province of Salamanca, Extremadura, and the western area of Andalusia, and
with derivations that extend to other ACs such as Madrid and Castilla-La Mancha. The
total area occupied by the dehesa in the country differs according to the different sources
consulted, fluctuating between very disparate figures that range from 2.3 to 5.8 million
hectares(4,13,14), and perhaps this has to do with the definition of the term itself and its
greater or lesser quantification depending on whether other adehesada or potential
formations are taken into account according to the percentage of the type of trees,
grasslands, shrublands, or including open areas of juniper, pine forests and some low
scrubland(13).
180
To carry out this study, an estimated area of around 3.5 million hectares (Table 1) was
taken as a reference for the Spanish dehesa, adjusted to its strict definition, provided by
Silva and Fernández(15). This, in its wide territorial distribution, is located in several ACs,
although not all of their provinces have dehesa. Nevertheless, there are other sources that
report different areas; the Extremadura Forest Plan indicates a larger area of dehesa,
1’987,733 ha according to the canopy cover fraction(4); for Andalusia, Costa(16) also
indicates a larger area of 1’262,594 ha; however, the area of dehesa in Castilla-La Mancha
is lower, with 486,916 ha of Mediterranean Iberian dehesa, which extends through the
five provinces of the La Mancha region(13). From all this, it can be deduced that, according
to the criteria applied by the ACs themselves and the contributions of other authors, the
area of the dehesa may vary substantially, yielding different figures, even higher if other
territories or systems called adehesados, which are not classified as dehesa per se, are
estimated, since they do not meet the strict definition of dehesa(13) and would, therefore,
significantly increase the overall figure of the area of the Spanish dehesa.
Table 1: Area of the dehesa in Spain distributed by Autonomous Community and

number of fighting bull farms
Autonomous Community Area Area Inventoried Active
(ha) (%) farms* farms**
Extremadura 1’237,000 35.18 263 222
Andalucia 946,482 26.92 169 168
Castilla-La Mancha 751,554 21.38 115 103
Castilla y León 467,759 13.30 107 83
Madrid 113,051 3.22 72 55
Total 3,515,846 100.00 726 631
* Number of cattle farms inventoried according to livestock associations. ** Number of active cattle
farms according to the SBFBB (MAPA(17)).
Source: Silva and Fernández(15).
Number of fighting cattle farms in dehesas in Spain
In Spain, a total of 980 fighting cattle farms have been inventoried according to livestock
associations; on the other hand, according to the latest available census data on the
Fighting Cattle Breed(17), and as of 31 December 2022, only 840 of them were active in
the SBFBB. A total of 726 cattle farms which were in provinces with dehesa were selected
to be surveyed, with this value being higher than the 631 active cattle farms located in the
ACs with dehesa (Table 1). Nonetheless, it was not feasible to have carried out the survey
on this last population of active cattle farms, since the figures provided by the census are
global and there is no individually specified data to be able to identify the cattle farms,
and therefore, in view of this lack of knowledge, in this work the total number of
inventoried cattle farms was surveyed.
181
Thus, of the total of 980 cattle farms initially inventoried in the Spanish territory, the 726
that are located in provinces with dehesa were selected; it should also be noted that, of
the 840 Spanish cattle farms active in the SBFBB, 631 cattle farms are located in ACs
with dehesa (Table 1).
Assessing the location by autonomous community, it can be observed that Andalusia is

the one with the highest number of cattle farms devoted to the breeding of fighting cattle,
followed by Castile and Leon, Extremadura, Castilla-La Mancha, and Madrid,
respectively (Table 1). Of the five ACs mentioned, the provinces of Córdoba, Cádiz,
Huelva, Seville, Málaga, Jaén, Cáceres, Badajoz, Albacete, Ciudad Real, Toledo,
Guadalajara, Ávila, Zamora, Salamanca, and Madrid (Figure 1) are the ones that have
dehesa(4,18,19).
Figure 1: Provinces and cattle farms located in dehesas in Spain of each of the livestock
associations that make up the SBFBB
From the detailed analysis of the initial data regarding the locality and the farm in which
the different cattle farms are located, with expression of the geographical coordinates of
latitude and longitude which indicate their precise location, it is observed that several of
them have the same municipal location and farm. Thus, the 726 cattle farms are housed
in 621 farms, since in 541 farms there is only one cattle farm, in 61 farms there are 2
cattle farms, in 13 farms there are 3 cattle farms and in 6 farms there are 4 cattle farms.
Therefore, in order to determine the area of fighting cattle farms and, therefore, the area
they represent over the total dehesa in Spain, it is necessary to establish the number, as
reliable as possible, of fighting cattle farms located on their corresponding farm. It can be
observed that the number of farms is lower than the number of cattle farms, mainly due
to the fact that some cattle farms share the same farm, since they have different cattle
branding irons, understood as the identity mark of the cattle farm(20), which are even
182
registered in different associations. Nevertheless, from the data reported, it can also be
deduced that there are some cattle farms that, although they do not currently have animals
of the fighting breed, keep their registration in the corresponding association, and even
some have changed their legal ownership and still appear in the catalogues consulted,
without the corresponding deregistration. For all these reasons, the most accurate thing
for this study, instead of taking the number of existing cattle farms itself as a reference,
is to contemplate the number of farms in which they are located, facts verified in some of
the responses issued by the cattle farmers, where they indicate that they share a farm with
other cattle farms.
From the results of the 304 surveys received, it can be observed that there are 283 fighting
cattle farms located in the dehesa, which represents 93.1 % of them. Nevertheless, in
order to make the total estimate of the farms located in dehesas, must be know that these
cattle farms are located in 263 different agricultural farms, representing (93.5 %), a
percentage that applied to the total number of farms inventoried with dehesa would allow
to estimate the number of farms with dehesa at 580.88 and, broken down by AC,
Andalusia is the one with the highest number of farms in dehesa engaged in bull breeding
(Table 2), as well as in the overall calculation of fighting cattle farms(17).
Table 2: Number of fighting cattle farms in the dehesa in Spain by Autonomous

Community
Farms surveyed Farms in dehesa
With dehesa Without No. of farms No. of
Autonomous No. dehesa inventoried* farms
Community Total No % No % estimated**
Andalucía 110 104 94.55 6 5.45 233 220.30

Castilla y León 58 55 94.83 3 5.17 125 118.54
Extremadura 33 31 93.94 2 6.06 105 98.64
Castilla-La Mancha 31 28 90.32 3 9.68 95 85.81
Madrid 31 28 90.32 3 9.68 63 56.90
Total 263 246 93.54 17 6.46 621 580.88
*No. of farms inventoried according to information from livestock associations. **No. of farms estimated
when applying the % of farms with dehesa resulting from the survey and which appears in the same row.
It should be noted that the state registry created by MAPA to know the census of live
animals also refers to the number of fighting cattle farms active in the SBFBB(17) and does
not do so for the farms in which they are located according to the criterion cited above.
However, if the latest data published by MAPA on the number of active fighting cattle
farms in the stud book is taken as a reference, in 2022 there are 631 cattle farms in the
ACs that present dehesa(17), and if the aforementioned correction criteria were applied,
that is, 93.1 % of the cattle farms located in the reference ACs that are located in the
dehesa (93.54 % of the farms), an adjusted number of 587.5 cattle farms or 549.5 referring
to farms would be obtained, values slightly lower than the 580.88 farms with fighting
cattle in the dehesa estimated in this study, and to be taken into account, since it registers
183
those cattle farms that provide ownership of fighting animals for the corresponding annual
period according to MAPA.
Area of fighting cattle farms in dehesas in Spain
In recent years, there has been an intense social debate about bullfighting and it seems
that it is necessary to repeatedly justify the importance of the fighting bull in ecology and
biodiversity, systematically resorting to linking its breeding with the conservation of the
dehesa and trying to justify the large area enjoyed by the farms engaged in the breeding
of fighting cattle immersed in this space rich in biodiversity. Thus, there are repeated
references by multiple authors who attribute a total area ranging from 400,000 ha to
540,000 ha(5,6,21), or globally “one seventh” of the dehesa, as simplified by others, even
stating that 20 % of the more than three million hectares allocated to the dehesa in Spain
are occupied by fighting cattle(22). These values are higher than those provided in this
study, where is estimated that the production of the fighting bull occupied 315,300.79 ha
in the Spanish dehesa (Table 3).
Table 3: Area of farms engaged in the breeding of fighting bulls in dehesas in Spain
Area of farms surveyed (ha) Estimated farms area
(ha)
Autonomous Total Fightingbull Area/ Farm/ No. of Total, Area**
Community Fightingbull farms
(AC)
Andalucía 64,600 59,503 572.14±448.14e 220.30 126,042.44
Castilla y León 32,059 27,329 496.89±350.49e 118.54 58,901.34
Extremadura 21,050 19,060 614.84±592.01e 98.64 60,645.58
Castilla-La 21,214 17,214 614.79±672.75e 85.81 52,752.95
Mancha
Madrid 8,345 8,345 298.04±199.11a,b,c,d 56.90 16,958.48
Total 147,268 131,451 534.35±466.40 580.88 315,300.79
* Average value of the area allocated to fighting bull breeding per farm. **Estimated area allocated to
fighting bull breeding, obtained by multiplying the estimated number of farms by the area per farm.
a,b,c,d,e
Significant differences (P<0.05) between ACs.
It should be noted that in order to estimate this area of dehesa, the duplication of the area
of cattle farms located or sharing the same farm must be discarded and, therefore, it would
be more appropriate to use the concept of farm and not that of cattle farm. Thus, the total
area of the farms surveyed in which the breeding of the fighting bull coexists in the dehesa
amounts to 147,268 ha, and that of those allocated exclusively to it decreases to 131,451
ha, since some farms carry out other complementary activities, such as the production of
184
other breeds of cattle, Iberian pigs and sheep(22), implying a global average of 598.65 ha
for the total of the farm and 534.35 ha allocated to the fighting breed, although the most
opportune, as has already been seen, is to consider the results individually for each of the
different ACs (Table 3). In this sense, it can be observed that the cattle farms located in
Madrid have an area significantly smaller than those located in the rest of the ACs, which
could be related to the higher economic value of the land in Madrid, which stands at 9,260
€/ha(23). Few contributions have been made regarding the area allocated by cattle farmers
to the breeding of fighting bulls, and much less in relation to the dehesa; these include
those by Purroy and Grijalba(24), who, after a study in 20 farms, provide an average area
of 715 ha, and those by Tabernero de Paz et al.(22), who, after a survey of 177 cattle farms
throughout the national territory, establish that they have an average area of 536 ha, being
657 ha for those farms located in what they call zone 1, which precisely corresponds to
the ACs in which the dehesa is circumscribed (Andalusia, Castilla-La Mancha, Castile
and Leon, Extremadura and Madrid) and in which they only conduct 132 surveys.
Nevertheless, the average farm size of 534.35 ha (Table 3) is smaller than in this study(22),
and similar to the 529.5 ha found by Bea(25), although the location of all the farms in the
dehesa is not specified, and to the 500 ha on average of the cattle systems in the
dehesa(3,26). In addition, it was observed that the variation in the area of the farms ranges
from a minimum of only 10 ha to 3,000 ha; 10.16 % (25 farms) have less than 100 ha,
55.7 % (137 farms) have between 100 and 500 ha, 26.42 % (65 farms) have between 500
and 1,000 ha and 7.72 % (19 farms) have more than 1,000 ha.
In any case, the larger area of dehesa allocated to fighting bulls observed in previous
studies(22,24) could be due to several factors, such as the lower number of surveys carried
out by these authors, a possible duplication of cattle farms counted and the date they were
conducted, where more hectares were allocated to fighting bull breeding on the farms and
the number of fighting cattle farms was higher (Table 4). In this sense, the data published
by MAPA on the number of active cattle farms registered in the SBFBB in the last
decade(17) can be observed, showing a worrying progressive downward trend, which
could also be influenced by the outbreak of the Covid-19 pandemic, although this trend
has remained less pronounced in the last two years (Table 4).
Table 4: Number of active fighting cattle farms in the last decade (MAPA, 2023).
2013 2014 2015 2016 2017 2018 2019 2020 2021 2022
TOTAL -SBFBB-* 1016 1003 990 971 988 984 951 913 881 881
ACs. with dehesa 742 732 714 698 705 703 677 648 630 631
* Number of active cattle farms according to SBFBB in Spain, Portugal, and France.
Considering the limitations mentioned throughout the text, such as the difference in the
total area of dehesa, which varies according to the various data of authors and the ACs
themselves, the existence of several cattle farms located on the same farm and that, at
present, not all cattle farms are active, and in accordance with the criteria provided here
regarding the number of farms to calculate the reference hectares of fighting cattle farms
185
as the best approximation to the average area for the ACs with dehesa, it could be
estimated that the 580.88 farms that house the fighting cattle farms could occupy an area
of 315,300.79 ha, which currently represents 8.97 % of the total dehesa (3’515,846 ha) in
Spain; although it is true that the total area would amount to 347,743.81 ha (9.89 % of the
total area) taking into account the entire farm itself, with the carrying out of other
activities complementary to the main one, which is the breeding of fighting cattle.
Size of fighting cattle farms in dehesas in Spain
In most cases, the size of a fighting cattle farm is estimated in terms of the number of
breeding stock it presents and this can vary depending on several factors, such as the
capacity of the farm itself, the different production strategies of each cattle farmer and
the market demand since, in general, the animals are carefully selected to ensure an
offspring with the desirable genetic, physical, and behavioral characteristics for their
destination in bullfighting(27).
In addition, of course, cattle farms tend to have a much higher number of breeding cows
than bulls. According to these results, breeding cows represent an average of 144.05 for
those farms located in the Spanish dehesa, with 8.99 for bulls (Table 5), where the cattle
farms with the most breeding stock are in Andalusia, despite the fact that the farms that
use the most hectares for fighting bulls are in Extremadura (Table 3). In addition, the
results of the present study on the size of the cattle farms are lower than the 162 cows and
6 bulls provided in 2013 by Tabernero de Paz et al(22) and Bea(25), who found an average
of 185.6 mother cows per cattle farm. The decrease in breeding females, compared to
previous studies, may be in line with a lower census of fighting cattle in recent years, in
line with the lower number of cattle farms, and the lower demand for animals(21). On the
other hand, it is worth highlighting the increase in the number of bulls in the cattle farms,
compared to these studies, which could be due to the improvement in production
management in recent years, in order to increase the fertility rates of the cattle farms since
artificial insemination and other assisted reproduction techniques are very scarce(28).
Table 5: Average number of breeding stock in the cattle farms in the dehesa by
Autonomous Community (AC)
AC Breeding cows Bulls
Andalucía 158.59±126.75 9.91±7.66
Castilla y León 136.10±113.87 8.04±8.80
Extremadura 128.77±84.58 9.20±6.07
Castilla-La Mancha 119.75±77.08 7.50±3.32
Madrid 146.27±97.81 8.38±4.50
Total 144.05±111.34 8.99±7.34
186
As can be seen in Table 6, almost half of the cattle farms have up to 100 breeding cows,
with cattle farms with a minimum of 15 breeding cows and even a cattle farm with more
than a thousand individuals. In the case of bulls, it can be observed that three quarters of
the cattle farms have fewer than 10 bulls, with those with more than 20 units (5 %) being
exceptional. Thus, the size of a fighting cattle farm can vary significantly, from small
family farms, the majority, to large cattle companies with more than a thousand head of
cattle, occupying large extensions, being an animal production where the size of the cattle
farm presents great heterogeneity, as in other productive aspects(22). It should be noted
that the stocking rate in this production is lower than in other animal productions, which
favors the conservation and maintenance of the dehesa to a greater extent(10).
Table 6: Cattle farms located in the dehesa in Spain according to the number of
breeding stock
Breeding cows Bulls
Cattle farm No. of % Cattle farms No. of animals % Cattle farms
animals
Small ≤ 100 46.58 ≤ 10 73.75
Medium > 100 ≤ 200 35.74 > 10 ≤ 20 21.25
Large > 200 17.67 > 20 5.00
Population in the municipalities of the dehesa in Spain with fighting

cattle farms
There is no doubt about the importance of the fighting cattle breed in its relationship with
the dehesa in terms of the territory it covers, as well as the protection of the biodiversity
of this valued ecosystem with the use of the natural resources available and the
conservation of wild flora and fauna(2,3). But it cannot ignore the enormous social and
economic significance that this entails in the rural environment due to the role that cattle
farms and bull production contribute to the fixation of the rural population, in its
corresponding territorial location. Thus, from the extract of the 621 farms studied, these
are located in 358 different municipalities (Table 7), of which more than 72 % are located
in towns with less than 5,000 inhabitants, with Andalusia, Castile and Leon, and Castilla-
La Mancha, respectively, being the ACs with the most farms in these municipalities, data
that agree with those collected from the 2022 annual report of indicators prepared by
MAPA, which establishes them among those with the largest number of people registered
in rural municipalities.
187
Table 7: Number of inhabitants in municipalities with dehesa in Spain where fighting

bull farms are located
No. of
Percentage
municipalities
≤ 1,000 154 43.01 72.61
> 1,000 ≤ 5,000 106 29.60
> 5,000 ≤ 10,000 39 10.89 27.36
> 10,000 ≤ 20,000 27 7.54
> 20,000 ≤50,000 15 4.19
> 50,000 17 4.74
Total 358 100 100
Considering that the activity rate and population density is lower in municipalities with
dehesas compared to those that do not include them, as reported by Campos et al(14), the
activity carried out in fighting cattle farming is assumed to contribute to avoiding
depopulation, reducing the migratory flow in those nuclei with clear agricultural activity,
in which it is difficult to find alternatives to carry out other productive or industrial
activities, as reflected in the characteristics of the dehesa in the Master Plan of the
Andalusia Dehesas.
The number of active fighting cattle farms, according to MAPA, is lower than the number
inventoried by the livestock associations themselves in the provinces of the Spanish
dehesa; in addition, their trend has been downward in recent years. The area of dehesa of
the farms engaged in the breeding of the fighting bull, which sometimes includes the
presence of other productions and complementary activities, is estimated at around
350,000 ha, values lower than previous studies. The existence of fighting cattle farms for
the breeding of fighting bulls is intimately linked to the maintenance and conservation of
the highly biodiverse ecosystem of the Spanish dehesa, with a low stocking rate, which
makes it a low-intensity land use system. For this reason, the progressive decrease in the
number of fighting cattle farms and the area occupied in this system classified by the
European Union as of High Natural Value is worrying. Finally, the fighting cattle farms
in the dehesa are located in municipalities that mostly have less than 5,000 inhabitants,
which could help to fix the rural population.
Literature cited:
1. Fernández P, Porras CJ. La dehesa. Algunos aspectos para la regeneración del arbolado.
Sevilla. Colección de Informaciones Técnicas 58/98. Consejería de Agricultura y
Pesca de la Junta de Andalucía. 1998.
188
2. Urivelarrea P. La dehesa como Sistema de Alto Valor Natural. III Congreso Ibérico de
la Dehesa y del Montado. IFEBA. Badajoz. 2018
3. Gaspar P, Mesías FJ, Escribano M, Rodríguez De Ledesma A, Pulido F. Economic and

management characterization of dehesa farms: Implications for their sustainability.
Agroforestry Systems 2007;71(3):151-162.
4. Escribano AJ. Estudio de la producción bovina ecológica y convencional en sistemas

extensivos de dehesas en Extremadura. Análisis técnico-económico de sostenibilidad
y eficiencia de su sistema productivo. Posibilidades de conversión al modelo de
producción ecológica [tesis doctoral]. Universidad de Extremadura. 2014.
5. Gómez. PJ, Espejo AJ, Ortiz F, Caño AB. Manejo del suelo frente a la erosión en
dehesa. Sevilla. Instituto de Investigación y Formación Agraria y Pesquera (IFAPA).
Consejería de Agricultura, Pesca y Desarrollo Rural de la Junta de Andalucía. 2016.
6. Jordano P. El toro bravo y su ecosistema. Instituto Juan Belmonte. Fundación Toro de

Lidia. 2022.
7. Sánchez-Belda A. Razas bovinas españolas. Madrid. Ministerio de Agricultura, Pesca

y Alimentación. 1984.
8. UCTL. (2019). Toro bravo, Guardián de la Biodiversidad. Exposición Parlamento

Europeo Bruselas. Consultado 15 mar, 2023. https://torosbravos.es/2019/11/08/la-
exposicion-toro-bravo-guardian-de-la-biodiversidad-triunfa-en-las-instituciones-
europeas/
9. Cañón J, Tupac-Yupanqui I, Garcia-Atance MA, Cortes O, García D, Fernández J,

Dunner S. Genetic variation within the Lidia bovine breed. Animal Genetics 2008;
39:439–445.
10. Campos P. La renta ambiental en las dehesas de producción de ganado de lidia.

Economía de la ganadería de lidia en España. Rev Instituto de Estudios Económicos
2005;3.
11. SIGPAC. Sistema de Información Geográfica de Parcelas Agrícolas. Consultado 15

mar, 2023. https://sigpac.mapama.gob.es/fega/visor/.
12. INE. Instituto Nacional de Estadística. Consultado 15 mar, 2023

https://www.ine.es/buscar/searchResults.do?Menu_botonBuscador=&searchType=
DEF_SEARCH&startat=0&L=0&searchString=%22Cifras%20de%20Poblaci%C3
%B3n%22.
13. Campos P, Carranza J, Coleto JM, Díaz M, Diéguez E, Escudero A. et al. Libro Verde
de la Dehesa. Documento para el debate hacia un Estrategia Ibérica de gestión. 2010.
Consultado 15 mar, 2023 https://docplayer.es/46945237-Libro-verde-de-la-
dehesa.html.
189
14. Gil P, Suárez JM. Medidas para la conservación de las dehesas ibéricas mediterráneas
en el marco del programa de desarrollo sostenible del medio rural en Castilla-La
Mancha. Toledo. Consejería de Agricultura Junta de Comunidades de Castilla La
Mancha. 2008.
15. Silva R, Fernández V. Claves para el reconocimiento de la Dehesa como “paisaje

cultural” de UNESCO. Anales de Geografía 2015;35(2):121-142.
16. Costa JC. Dehesas de Andalucía. Caracterización ambiental. Sevilla. Consejería de

Medio Ambiente, Junta de Andalucía. 2006.
17. MAPA. Datos censales de la Raza Bovina de Lidia. Razas ganaderas (ARCA).
Ministerio de Agricultura, Pesca y Alimentación. Consultado 15 mar, 2023
https://www.mapa.gob.es/es/ganaderia/temas/zootecnia.
18. Escribano M, Pulido F, Martín M. Estructura ganadera de la dehesa española.

Agricultura: Rev Agropecu Ganadera. 1996;764:209-213.
19. Acosta R. La cultura de la dehesa. En: Rodríguez BS (coordinador) Proyecto

Andalucía. Sevilla. Antropología, Tomo XI. Publicaciones Comunitarias. 2005:209-
246.
20. Domecq y Díez A. El Toro Bravo. Madrid. Colección La Tauromaquia. Editorial

Espasa-Calpe. 1985.
21. Lomillos JM, Alonso de la Varga ME. Análisis de la situación actual de la raza de
lidia. Conservación de los encastes en peligro de extinción. Rev Complutense Cienc
Vet 2017;11(1):14-32.
22. Tabernero de Paz MJ, Bartolomé DJ, Posado R, Bodas R, García JJ. Sistemas de
explotación del ganado de lidia en España I: caracterización y tipología de las
ganaderías de lidia. Rev Española Estudios Agrosoc Pesq 2013;235:89-106.
23. UCTL. (2015). La ganadería de lidia conserva cientos de miles de hectáreas valoradas
en 1.862 millones €. Consultado 15 mar,2023. https://torosbravos.es/2015/06/09/.
24. Purroy A, Grijalba M. Estudio técnico-económico de las ganaderías de toros de Lidia.

En: Purroy A. editor. V Jornadas sobre Ganado de Lidia (Textos presentados).
Pamplona: Ed. Universidad Pública de Navarra. 2006:33-59.
25. Bea J. Eficiencia técnico-económica de las ganaderías de toros de lidia. Trabajo Fin
de Carrera. Universidad Pública de Navarra. 2013.
26. Porras CJ, Brum P, González A, Sánchez RM, Sánchez MC. Estudio técnico
económico de explotaciones ganaderas extensivas 1997-1999. Sevilla. Consejería de
Agricultura y Pesca. Junta de Andalucía. 2000;129.
190
27. Sanes JM, Seva J, Pallarés FJ, Ramis G. Ganaderías de lidia. En: Atención sanitaria
en festejos taurinos. Madrid. Ed: Antonio Ríos Zambudio y Aran Ediciones S.L.
Aran Ediciones S.L. 2013.
28. Lomillos JM, Alonso ME, Gaudioso V. Análisis de la evolución del manejo en las
explotaciones de toro de lidia. Desafíos del sector. ITEA. 2013;109(1):49-68.
191
Article
In silico analysis of miRNA target genes possibly induced by tuberculosis

infection
Elba Rodríguez-Hernández a*
Laura Itzel Quintas-Granados b
Feliciano Milian Suazo c
Ana María Anaya Escalera a
a
Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal-
INIFAP. Carretera a Colón, Ajuchitlán, Colon, Querétaro, México.
b
Universidad Autónoma de la Ciudad de México. Colegio de Ciencias y Humanidades,
Plantel Cuautepec. Ciudad de México, México.
c
Universidad Autónoma de Querétaro. Querétaro, México.
* Corresponding author: rohe577@hotmail.com
Abstract:
The objective was to identify, through in silico analysis, the genes to which miR-146a, miR-
146b, and miR-155 bind and to analyze the metabolic pathways in which they participate
during tuberculosis infection. For the analysis, it was used: miRBase, UniProtKB,
TargetScan Human, miRDB, and miRTarBase. miR-146a interacts with or binds to genes
important in cell adhesion and the process of phagocytosis (CLDN16 and ATP6V1C2,
respectively) (P< 0.05); this interaction could have important implications in the
pathogenesis of tuberculosis or related diseases. The results of this work suggest that the
activation of specific molecular mechanisms in response to tuberculosis is regulated by miR-
146a, miR-146b, and miR-155. The genes with which miR-146a and miR-155 interact or
bind are involved in the immune response and cellular processes essential during tuberculosis
infection.
Keywords: Mycobacterium, miR-146a, miR-146b, miR-155, Prediction, Diagnosis.
192
Introduction
Tuberculosis (TB) caused by Mycobacterium tuberculosis (Mtb) represents a risk to public

health and a threat to health security; it is one of the leading causes of morbidity and mortality
worldwide(1). It is an infectious-contagious disease that mainly affects the lungs(2). The World
Health Organization (WHO) reported that 1.4 million people died in 2021 and considers it
the deadliest disease after COVID-19; it is estimated that 10.6 million people fell ill with TB
in 2021(3). It is evident that during the COVID-19 pandemic, the TB care, diagnosis, and
treatment system was deficient; this increases the possibility of a rebound of the disease, with
a possible impact on global health(4). In most cases, the SARS-CoV-2 virus causes a
respiratory infection in the infected individual, which can be complicated in varying degrees,
ranging from mild to severe. The use of immunosuppressive drugs in COVID-19 may lead
to an increase in Mtb gene expression. Some reports describe cases of co-infection between
Mtb and SARS-CoV-2, with a prevalence of TB between 0.47 and 4.47 % among patients
with COVID-19, and it is reported that the mortality rate in patients with TB/COVID-19 was
higher than that of patients affected by only one of these pathogens(4-6).
In daily clinical practice, the accurate diagnosis of TB is through the culture of the
microorganism, and growing bacteria are required to perform drug susceptibility tests, which
is a major medical challenge and slows down the procedure(7). In addition to this, there is the
problem of the progressive development of drug-resistant TB, which reinforces the urgent
need to research new molecules for the diagnosis and control of TB(8). Early diagnosis, as
well as effective treatment of infected individuals, could help reduce TB. For this reason, it
is essential to conduct research on novel biomarkers to design control methods. In recent
years, microRNAs have been studied as promising molecules for such effects due to their
high stability, sensitivity, and specificity(9). miRNAs are small, non-coding regulatory RNAs
that act by repressing protein expression at the post-transcriptional level and have important
functions in many physiological and pathophysiological processes(10). The regulatory
mechanisms of miRNAs are based on the complementarity of sequences between the miRNA
and the target mRNA; if the binding is perfect, it results in the degradation of the mRNA; if
the binding is partial, the translation is repressed(11). mRNA deadenylation leads to mRNA
instability and, thus, degradation(10). After any of these mechanisms, the host’s innate
immune response is activated, with the production of cytokines and chemokines(11).
Development in omics sciences has allowed the rapid identification and characterization of
small non-coding RNAs, which are part of a complex gene regulatory system, and differential
expression of these has been found in individuals infected with TB. During infection with
193
Mtb, the host’s immune response is activated; in this host-Mtb interaction, the profile of
miRNAs is manipulated; this implies the regulation of several biological processes mediated
by these molecules(11). Some miRNAs that are modified during an Mtb infection are also
produced in immune cells contained in the granuloma and lead to the adaptive immune
response; they can also be secreted into the extracellular medium through processes such as
apoptosis or necrosis, encapsulation within microvesicles or exosomes, and through binding
to high-density lipoproteins (HDL), among others. This allows stable expression patterns of
miRNAs associated with TB infection(12).
Little is known about the molecular pathogenesis of the disease, but there are recent reports
that demonstrate the importance of miRNAs in pulmonary TB and that they can be detected
in the blood of infected patients, so they are currently indicated as candidates for diagnosis.
The miRNAs that are modulated in response to Mtb infection are miR-125b, miR-155, miR-
144, miR-3179, miR-147, miR-146a/b, miR-886-5p, let-7e, and let-7i(13,14). The presence and
regulation of these miRNAs in TB-infected humans indicates their importance in the
pathogenesis and survival of the bacillus, so their study during infection is indispensable.
miRNA 146b has been associated with the regulation of various signaling pathways, and
some of its described target genes are AKT3, IL6, IRAK1, NFKB1, and TLR4(15); and it has
been reported to be overexpressed in the serum of patients with active TB(16). miR-155
modulates the production of inflammatory mediators in response to microbial stimuli by
downregulating the expression of TAK1 and the TRAF6-binding protein. It has also been
observed that, in TB infection, miR-155 is overexpressed and inhibits IFN-γ-induced
autophagy; some of the target genes with which it has been associated are AKT1, APAF1,
ATP6V1H, and CASP3(15). Interestingly, miR-155 has a dual function during TB infection;
on the one hand, it maintains the survival of Mtb-infected macrophages and, on the other
hand, promotes the survival and function of Mtb-specific T cells(17). Considering the
importance of miRNAs in the pathogenesis of human TB, where they have been detected in
the blood of sick patients, in this work, the genes to which miR-146a, miR-146b, and miR-
155 bind were predicted, and the metabolic pathways in which they participate were
analyzed.
Selection of study miRNAs
The three miRNAs used for the analysis were selected through a bibliographic search in the
NCBI database, through the collection of biomedical journals of PubMed Central
(https://www.ncbi.nlm.nih.gov/pmc/)(18), the selected miRNAs were those studied in
humans, those consistently reported in at least five scientific journals and those that were
194
found to be overexpressed in infected individuals in experimental trials; of these, three were

selected at random. The miRBase database(19) was used to obtain data on the miRNAs of
interest, such as the access number and mature sequence of each miRNA, which were as
follows: hsa-mir-146a-3p: MIMAT0004608 (CCUCUGAAAUUCAGUUCUUCAG), hsa-
miR-146b-3p: MIMAT0004766 (GCCCUGUGGACUCAGUUCUGGU), hsa-miR-155-3p:
MI0000681 MIMAT0004658 (CUCCUACAUAUUAGCAUUAACA).
Prediction of miRNA pathways and target genes
Three ontological models were used to determine the target genes of the miRNAs analyzed,
which allowed to obtain the most accurate meta-information and describe the semantics of
the most objective data. The following programs were used: TargetScan Human(20),
miRDB(21,22), particularly analyzed with the target ontology(23) and miRTarBase tools(23,24).
The inclusion criteria of the target genes to be studied were as follows. For the TargetScan
Human software(20), only genes with context scores above -0.20 were included for analysis.
In the case of Target ontology(23), only target genes that met a target score above 77 were
selected. For the miRTarBase software(23,24), the target genes of each miRNA were chosen
according to the experimental evidence validated by at least two methods and reported in
papers related to the study topic. In addition, the genes that were found consistently in at least
two of the programs used were the ones that were considered for their review. Finally, of
these, at least two target genes were randomly selected to review their relevance in TB
infection. Each gene was assigned a metabolic or regulatory pathway using information from
the Kyoto Gene and Genome (KEGG) library(25).
Results
Prediction of target genes and analysis of the metabolic pathways of

miRNAs
Bioinformatic analyses allowed the prediction of target genes for miR-146a, miR-146b, and
miR-155 (Table 1); some of these genes have major implications during TB infection. miR-
146a can regulate genes involved in cell adhesion and phagosome formation processes
(CLDN16, ATP6V1C2) (Figure 1). miR-146b is involved in the metabolic pathways of
degradation of valine, leucine, and isoleucine and the thyroid hormone signaling pathway,
among others (Figure 2). miR-155 is involved in the pathways of the sulfur relay system and
195
tryptophan metabolism, according to the predictions of the KEGG program (January 2022)
(Figure 3).
All three miRNAs have target genes validated in the database. In the specific case of miR-
146a, its main KEGG metabolic pathways are cell adhesion molecules and phagosome, but
it also participates in the regulation of cancer metabolism; one of the genes that stand out in
this process is ZEB2, which is a transcription factor that plays a role in transforming growth
factor-β signaling pathways, which are essential during early fetal development, and their
dysregulation has been characterized in different types of cancer(26). The miRTarBase
software does not show an intersection of miRNAs in metabolic pathways, as they do not
share predicted target genes.
Table 1: Prediction of the main metabolic pathways and genes to which miR-146a, miR-
146b, and miR-155 miRNAs bind and intercept
miRNA KEGG metabolic Outstanding target genes P-Value
pathway
Cell adhesion molecules
CLDN16 (claudin 16) 0.02
miR-146a
ATP6V1C2 (ATPase H+
Phagosome 0.03
transporting V1 subunit C2)
BCKDHB (branched chain keto
Degradation of valine, acid dehydrogenase)
0.006
leucine, and isoleucine ABAT (4-aminobutyrate
miR-146b aminotransferase)
THRA (thyroid hormone receptor
Thyroid hormone
alpha) 0.01
signaling pathway
RXRB (retinoid X receptor beta)
Sulfur relay system MOCS2 (molybdenum cofactor
0.006
synthesis 2)
miR-155
Tryptophan metabolism IDO-1 (indoleamine 2,3-
0.01
dioxygenase 1)
The analysis was performed from the mature sequence -3p of each miRNA.
196
Figure 1: KEGG metabolic pathways predicted for miRNA 146a according to the genes it
binds to. Panel A) Cell adhesion molecules, Panel B) Phagosome. The genes that stand out
in this research are highlighted (yellow)
197
Figure 2: KEGG metabolic pathways predicted for miRNA 146b according to the genes it
binds to. Panel A) Degradation of valine, leucine, and isoleucine, Panel B) Thyroid
hormone signaling pathway. The genes that stand out in this research are highlighted
(yellow)
198
Figure 3: KEGG metabolic pathways predicted for miRNA 155 according to the genes it
binds to. Panel A) Tryptophan metabolism, Panel B) Sulphur relay system. The genes that
stand out in this research are highlighted (yellow)
199
Discussion
In the analysis of miR-146a, two important predicted metabolic pathways were found, where
there are two genes with which this miRNA interacts in independent pathways; one of them
is the CLDN16 gene, which encodes claudin 16. Claudins are proteins with transmembrane
domains found in the area of tight junction between epithelial and endothelial cells; together
with other proteins, they form pores and are key components of the paracellular channel.
Paracellular channels at the tight junction have properties of ionic selectivity, pH
dependence, and other effects(27). The overexpression of claudin-16 has been associated with
ovarian cancer and other diseases, and its importance has been determined in cellular
magnesium reabsorption(27).
One study determined the expression pattern of some claudins (2 and 4) and analyzed
structural changes in colon biopsies in patients with TB. The results show that claudin-2
expresses itself in the area of tight junction between cells, and no structural changes were
observed in the tissue analyzed(28). Recently, the effect of TB infection on the expression of
cell-binding proteins in the central nervous system (CNS) was studied. These results suggest
that Claudin-5 decreases its expression and changes its location within the cell in response to
infection with Mtb of the N15 strain, suggesting that Mtb affects the expression of brain
proteins at cell junctions. This damage consisted of cellular changes suggestive of toxicity
due to the observation of signs of necrosis(29).
The ATP6V1C2 gene encodes an enzyme that is an ATPase; some studies have suggested the
importance of P-type ATPases in the physiology and intracellular survival of
mycobacteria(30). A human transcriptional profile of ATPases under conditions of hypoxia,
oxidative stress, starvation, and intoxication by chemical agents and infection processes in
vitro and in vivo evidenced the differential expression of these transporters in these
conditions. ATPase is a highly conserved proton pump that expresses itself in cells(31).
Recently, a study was conducted where two compounds that inhibit the growth of drug-
sensitive and drug-resistant TB strains were studied; in this study, through transcriptomic
assays, changes in the expression of certain genes in response to TB infection were shown;
one of these genes was ATP6V1C2, which was found to be overexpressed in response to TB
infection(32).
miR-146b interacts with prominent genes involved in energy production in cells, such as
dehydrogenase (BCKDHB), and with aminotransferase (ABAT), which is involved in the
degradation of valine, leucine, and isoleucine; some reports indicate that increased serum
lactate dehydrogenase activity is an indicator of presumptive diagnosis of pneumonia and
other infections such as TB(33).
200
miR-155 showed interaction with the MOCS2 and IDO-1 genes, which come from the sulfur
relay system and tryptophan metabolism, respectively. The MOCS2 gene encodes two
different proteins, MOCS2A and MOCS2B; these two together form the molybdopterin
synthase enzyme, which is involved in the biosynthesis of the molybdenum cofactor (MoCo),
which is a prosthetic group. MoCo-dependent enzymes are involved in many biological
processes; interestingly, MoCo works directly on ethylbenzene dehydrogenases and other
enzymes(34). Molybdenum (Mo) is necessary for several enzymes, such as sulfite oxidase and
aldehyde oxidase, among others, to have their function. The function of those enzymes is the
breakdown of substances in the body, some of which are toxic if not metabolized. Some
mycobacteria have genes that code for MoCo. Mtb possesses multiple homologs that encode
synthase in the biosynthesis of MoCo; this suggests that its expansion may fulfill different
cellular functions(35).
Mo enzymes are catalysts in energy generation and detoxification reactions, among other
functions. It is known that the substrates converted by bacterial Mo enzymes, which are
important for virulence, are of the group that is generated in the host during inflammation or
signaling network. This suggests that they could be important drug targets(36). Mo enzymes
catalyze important redox reactions. Mycobacteria have several enzymes that contain Mo;
they help regulate Mtb latency. The MoCo cofactor is the common cofactor of Mo enzymes
in mycobacteria(37). In some experiments, a novel pathway that uses Mtb for resistance to
host-imposed stress (hypoxia) has been identified; this ability of Mtb to persist under hypoxia
conditions contributes to TB latent in the host. Through horizontal transfer, Mtb acquired the
moaA1-D1 gene, which is involved in the biosynthesis of MoCo; namely, these genes have
homologs present in the entire genus Mycobacterium; interestingly, the moaA1-D1 genes are
induced under hypoxia conditions(38). Evolutionarily, the Mtb complex has developed
mechanisms for success, in part by acquiring genes involved in pathogenesis. Deciphering
and knowing the mechanisms through which Mtb causes a disease is relevant to identifying
unknown targets of interest for developing new methods of control, diagnosis, and therapy
of the disease. The broad study of the biosynthesis of the MoCo enzymes of Mtb will help
identify promising drug targets to control TB, especially latent TB.
The IDO-1 gene encodes an enzyme found mainly in macrophages; the enzyme participates
in the degradation of tryptophan that generates kynurenine; this metabolic pathway
constitutes a mechanism of modulation of the immune response. Indolamine 2,3-dioxygenase
(IDO-1) is an enzyme found in numerous cells(39). IDO-1 helps break down tryptophan into
kynurenine inside cells and thus regulates the availability of tryptophan. This has broad
implications for the body’s immune response. The IDO-1 protein has been reported to be
overexpressed in response to Mtb infection in human and murine macrophages in vitro. The
overexpression of IDO-1 has also been correlated with the expression of other inflammatory
markers, such as C-reactive protein, and the poor diagnosis of patients with TB(40,41).
201
In vitro studies show that the activity of IDO-1 in antigen-presenting cells inhibits the
proliferation of mycobacterial antigen-specific T cells. The activity of IDO-1 could play an
important role in inhibiting the Mtb-specific adaptive immune response and could help the
pathogen survive in the infected host. Tryptophan metabolism is a means of regulating T cell
functions, such as tumor-induced immune system evasion, peripheral tolerance, and
inflammation during infection(40,42). Activation of tryptophan metabolism is an antimicrobial
mechanism that occurs against some pathogenic bacteria. The activation of IDO-1 and
tryptophan metabolism in macrophages within the CNS is related to AIDS-associated
dementia and other inflammatory brain diseases(43). Intervening the activity of the IDO-1
enzyme is a promising strategy for developing treatments for HIV-associated neurological
disorders. In relation to the high prevalence of individuals infected with HIV and Mtb. It is
also an effective (host-directed) therapy against TB.
Although this analysis was performed on the miRNAs that have been described in humans,
it is important to note that the genome of M. bovis has similarity of more than 99.95 % with
M. tuberculosis at the nucleotide level; nevertheless, M. bovis has lost part of its genome due
to genetic mutations, through deletion mechanisms; this makes it smaller (M. bovis
AF2122/97: 4’345,492 bp) compared to M. tuberculosis (CDC1551: 4’403,836 bp)(44,45).
Interestingly, it has been suggested that M. tuberculosis arose from M. bovis during the period
when man domesticated cattle, approximately 10-15,000 years ago, when it infected
humans(46). This assertion is based on the observation of infection (caused by several strains
of M. bovis) in different animal hosts, including humans; on the other hand, natural infection
of M. tuberculosis is, up to the date of this publication, apparently restricted to humans(47).
This close similarity between these two species makes the study of gene products, protein
products, and miRNAs that may be analogous or equivalent between M. tuberculosis and M.
bovis viable to try to understand a little more about the pathogenesis of tuberculosis caused
by these two species, and perhaps to lay the foundations for the design of new biomarkers or
possible therapeutic targets.
The findings shown here suggest that miR-146a, miR-146b, and miR-155 are associated with
activating specific molecular mechanisms in response to TB. The genes with which miR-
146a and miR-155 interact or bind are involved in the immune response and cellular
processes essential during TB infection.
Acknowledgments
To CONAHCYT for contributing the economic funds to carry out this work, with project
number 284118.
202
The authors declare that they have no conflict of interest.
Literature cited:
1. Cohen A, Mathiasen VD, Schön T, Wejse C. The global prevalence of latent tuberculosis:
a systematic review and meta-analysis. Eur Respir J 2019;54(3).
2. Organization WH. Tuberculosis. Accessed Ago 15, 2023.
3. Bagcchi S. WHO's Global Tuberculosis Report 2022. Lancet Microbe 2023;4(1):e20.
4. Bostanghadiri N, Jazi FM, Razavi S, Fattorini L, Darban-Sarokhalil D. Mycobacterium

tuberculosis and SARS-CoV-2 Coinfections: A Review. Front Microbiol 2022;12:4039.
5. Gao Y, Liu M, Chen Y, Shi S, Geng J, Tian J. Association between tuberculosis and
COVID‐19 severity and mortality: A rapid systematic review and meta‐analysis. J Med
Virol 2021;93(1):194-196.
6. Proaño R, Morales N, Cajiao D. Vista de tuberculosis miliar en paciente con infección por
COVID-19 (Doble Problema). Prac Fam Rur Hosp Ecu 2021;6(1).
7. Afsar I, Gunes M, Er H, Sener AG. Comparison of culture, microscopic smear and

molecular methods in diagnosis of tuberculosis. Rev Española Quimioter
2018;31(5):435.
8. Ryu YJ. Diagnosis of pulmonary tuberculosis: recent advances and diagnostic algorithms.
Tuberculosis and Respiratory Dis 2015;78(2):64-71.
9. Sinigaglia A, Peta E, Riccetti S, Venkateswaran S, Manganelli R, Barzon L. Tuberculosis-

associated microRNAs: from pathogenesis to disease biomarkers. Cells
2020;9(10):2160.
10. Iwakawa H-o, Tomari Y. The functions of microRNAs: mRNA decay and translational
repression. Trends Cell Biol 2015;25(11):651-665.
11. Daniel EA, Sathiyamani B, Thiruvengadam K, Vivekanandan S, Vembuli H, Hanna LE.

MicroRNAs as diagnostic biomarkers for Tuberculosis: A systematic review and meta-
analysis. Front immunol 2022;13:954396.
12. Correia CN, Nalpas NC, McLoughlin KE, Browne JA, Gordon SV, MacHugh DE, et al.
Circulating microRNAs as potential biomarkers of infectious disease. Front Immunol
2017;8:118.
203
13. Sharbati J, Lewin A, Kutz-Lohroff B, Kamal E, Einspanier R, Sharbati S. Integrated

microRNA-mRNA-analysis of human monocyte derived macrophages upon
Mycobacterium avium subsp. hominissuis infection. PloS one 2011;6(5):e20258.
14. Yi Z, Fu Y, Ji R, Li R, Guan Z. Altered microRNA signatures in sputum of patients with

active pulmonary tuberculosis. PloS One 2012;7(8):e43184.
15. Chauhan D, Davuluri KS. microRNAs associated with the pathogenesis and their role in
regulating various signaling pathways during Mycobacterium tuberculosis infection.
Front Cell Infect Microbiol 2022:1577.
16. Fu Y, Yi Z, Wu X, Li J, Xu F. Circulating microRNAs in patients with active pulmonary

tuberculosis. J Clin Microbiol 2011;49(12):4246-4251.
17. Rothchild AC, Sissons JR, Shafiani S, Plaisier C, Min D, Mai D, et al. MiR-155–
regulated molecular network orchestrates cell fate in the innate and adaptive immune
response to Mycobacterium tuberculosis. PNAS 2016;113(41):E6172-E81.
18. Sayers EW, Bolton EE, Brister JR, Canese K, Chan J, Comeau DC, et al. Database
resources of the national center for biotechnology information. Nucleic Acids Res
2022;50(D1):D20.
19. Griffiths-Jones S. miRBase: the microRNA sequence database: MicroRNA Protocols;

2006 [129-38]. https://www.mirbase.org/.
20. Agarwal V, Bell GW, Nam JW, Bartel DP. Predicting effective microRNA target sites in
mammalian mRNAs. eLife. 2015;4:e05005.http://www.targetscan.org.
21. Wang X. miRDB: a microRNA target prediction and functional annotation database with
a wiki interface. RNA 2008;14(6):101-117. http://mirdb.org.
22. Chen Y, Wang X. miRDB: an online database for prediction of functional microRNA
targets. Nucleic acids research 2020;48(D1):D127-D31. http://mirdb.org.
23. Kozomara A, Birgaoanu M, Griffiths-Jones S. miRBase: from microRNA sequences to

function. Nucleic Acids Res 2019;47(D1):D155-D62. https://mirdb.org/ontology.html.
24. Huang HY, Lin YCD, Cui S, Huang Y, Tang Y, Xu J, et al. miRTarBase update 2022:
an informative resource for experimentally validated miRNA–target interactions.
Nucleic Acids Res 2022;50(D1):D222-D30.
https://mirtarbase.cuhk.edu.cn/~miRTarBase/miRTarBase_2022/php/index.php.
204
25. Bock G, Goode JA, editors. The KEGG database. ‘In silico’simulation of biological
processes: Novartis Foundation Symposium. Wiley Online Library. 2002:247.
https://doi.org/10.1002/0470857897.ch8.
26. Ghoumid J, Drevillon L, Alavi-Naini SM, Bondurand N, Rio M, Briand-Suleau A, et al.

ZEB2 zinc-finger missense mutations lead to hypomorphic alleles and a mild Mowat–
Wilson syndrome. Hum Mol Genet 2013;22(13):2652-2661.
27. Hou J, Goodenough DA. Claudin-16 and claudin-19 function in the thick ascending limb.
Curr Opin Nephrol Hypertens 2010;19(5):483.
28. Das P, Goswami P, Das TK, Nag T, Sreenivas V, Ahuja V, et al. Comparative tight
junction protein expressions in colonic Crohn’s disease, ulcerative colitis, and
tuberculosis: a new perspective. Virchows Archiv 2012;460(3):261-270.
29. Sánchez-Garibay C, Salinas-Lara C, Gómez-López MA, Soto-Rojas LO, Castillón-

Benavides NK, Castillón-Benavides OJ, et al. Mycobacterium tuberculosis infection
induces BCSFB disruption but No BBB disruption in vivo: Implications in the
pathophysiology of tuberculous meningitis. Int J Mol Sci 2022;23(12):6436.
30. López M, Quitian LV, Calderón MN, Soto CY. The P-type ATPase CtpG preferentially
transports Cd2+ across the Mycobacterium tuberculosis plasma membrane. Arch
Microbiol 2018;200(3):483-492.
31. Smith AN, Borthwick KJ, Karet FE. Molecular cloning and characterization of novel
tissue-specific isoforms of the human vacuolar H+-ATPase C, G and d subunits, and
their evaluation in autosomal recessive distal renal tubular acidosis. Gene 2002;297(1-
2):169-77.
32. Chaudhary D, Marzuki M, Lee A, Bouzeyen R, Singh A, Gosain TP, et al. Disulfiram
inhibits M. tuberculosis growth by altering methionine pool, redox status and host-
immune response. bioRxiv 2020; http://dx.doi.org/10.2139/ssrn.3696891.
33. Quist J, Hill AR. Serum lactate dehydrogenase (LDH) in Pneumocystis carinii
pneumonia, tuberculosis, and bacterial pneumonia. Chest 1995;108(2):415-418.
34. Hover BM, Tonthat NK, Schumacher MA, Yokoyama K. Mechanism of pyranopterin
ring formation in molybdenum cofactor biosynthesis. PNAS 2015;112(20):6347-6352.
35. Williams MJ, Kana BD, Mizrahi V. Functional analysis of molybdopterin biosynthesis
in mycobacteria identifies a fused molybdopterin synthase in Mycobacterium
tuberculosis. J Bacteriol 2011;193(1):98-106.
205
36. Zhong Q, Kobe B, Kappler U. Molybdenum enzymes and how they support virulence in
pathogenic bacteria. Front Microbiol 2020;11:615860.
37. Shi T, Xie J. Molybdenum enzymes and molybdenum cofactor in mycobacteria. J Cell
Biochem 2011;112(10):2721-2728.
38. Levillain F, Poquet Y, Mallet L, Mazères S, Marceau M, Brosch R, et al. Horizontal

acquisition of a hypoxia-responsive molybdenum cofactor biosynthesis pathway
contributed to Mycobacterium tuberculosis pathoadaptation. PLoS Pathog
2017;13(11):e1006752.
39. Suchard MS, Adu‐Gyamfi CG, Cumming BM, Savulescu DM. Evolutionary views of
tuberculosis: indoleamine 2, 3‐dioxygenase catalyzed nicotinamide synthesis reflects
shifts in macrophage metabolism: indoleamine 2, 3‐dioxygenase reflects altered
macrophage metabolism during tuberculosis pathogenesis. BioEssays
2020;42(5):1900220.
40. Blumenthal A, Nagalingam G, Huch JH, Walker L, Guillemin GJ, Smythe GA, et al. M.
tuberculosis induces potent activation of IDO-1, but this is not essential for the
immunological control of infection. PloS one 2012;7(5):e37314.
41. Gautam US, Foreman TW, Bucsan AN, Veatch AV, Alvarez X, Adekambi T, et al. In
vivo inhibition of tryptophan catabolism reorganizes the tuberculoma and augments
immune-mediated control of Mycobacterium tuberculosis. PNAS 2018;115(1):E62-
E71.
42. Katz JB, Muller AJ, Prendergast GC. Indoleamine 2, 3‐dioxygenase in T‐cell tolerance
and tumoral immune escape. Immunol Rev 2008;222(1):206-21.
43. Davies NW, Guillemin G, Brew BJ. Tryptophan, neurodegeneration and HIV-associated
neurocognitive disorder. Int J Tryp Res 2010;3. doi:10.4137/IJTR.S4321
44. Guta S, Casal J, Napp S, Saez JL, Garcia-Saenz A, Perez de Val B, et al. Epidemiological
investigation of bovine tuberculosis herd breakdowns in Spain 2009/2011. PLoS One
2014;9(8):e104383.
45. Golby P, Nunez J, Witney A, Hinds J, Quail MA, Bentley S, et al. Genome-level analyses
of Mycobacterium bovis lineages reveal the role of SNPs and antisense transcription in
differential gene expression. BMC Genom 2013;14(1):1-18.
206
46. Diamond J. Evolution, consequences and future of plant and animal domestication.
Nature 2002;418(6898):700-707.
47. Mostowy S, Cousins D, Brinkman J, Aranaz A, Behr MA. Genomic deletions suggest a
phylogeny for the Mycobacterium tuberculosis complex. J Infect Dis 2002;186(1):74-
80.
207
Review
The sweet clover-Sinorhizobium meliloti system as a useful interaction for

nitrogen fixation and as a soil improver. Review
Gabriel Gallegos Morales a
Omar Jiménez Pérez a
Juan Manuel Sánchez Yañes b
Perpetuo Álvarez Vázquez a
Francisco Castillo Castillo c*
a
Universidad Autónoma Agraria Antonio Narro. Departamento de Parasitología. Calzada
Antonio Narro # 1923, Buenavista, Saltillo, 25315 Coahuila, México.
b
Universidad Michoacana de San Nicolás de Hidalgo. Instituto de Investigaciones en
Química y Biología. Michoacán, México.
c
Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Campo
Experimental Saltillo. Coahuila, México.
* Corresponding author: reyes.francisco@inifap.gob.mx
Abstract:
Faced with the challenges posed by the need for fertilizers to maintain agricultural
production, a biological process of atmospheric nitrogen fixation occurs naturally, which is
carried out by a group of symbiotic bacteria that form a very close association with plants
of the legume group, among which is the sweet clover (Melilotus spp.). From an ecological
point of view, this plant has an essential function due to its good ability to associate with
native nitrogen-fixing bacteria of the genus Sinorhizobium. A fundamental aspect is that
this plant species can grow normally in alkaline soils, which doubles its importance since,
on the one hand, it fixes nitrogen, and on the other hand, it can be incorporated as green
manure. With this, the physicochemical properties of the soil are improved, and the levels
208
of organic matter, which is in extremely poor condition in arid zone areas, are increased.
Additionally, this species can withstand low temperatures and grow satisfactorily in winter.
This paper presents a synthesis of the genus Melilotus and its symbiont Sinorhizobium
meliloti and its importance as a potential natural soil improver.
Keywords: Melilotus, Sinorhizobium, Symbiont, Nitrogen, Soil.
Introduction
Within the Fabaceae family, weed plants have an enormous value in agricultural systems
due to their ability to associate symbiotically with nitrogen-fixing bacteria(1,2), which
becomes an N supply and an improvement in soil quality, in addition to promoting the
production of more protein-rich forages(3); among these species is the sweet clover or
melilotus(4). Three species of Melilotus have been reported for Mexico(5), where the species
Melilotus indica (L.) is the most adapted or most common as a weed worldwide, in rustic
environments such as temperate climates; it also develops in moderately saline areas, where
traditional forage legumes cannot be successfully cultivated(6,7). This weed is classified in
the Fabaceae family(8); its growth is widespread and can be present in crops such as wheat,
tomato, soybeans, sorghum, beetroot, prickly pear, apple, corn, flax, chickpeas, fruit trees,
beans, asparagus, citrus fruits, peas, rye, barley, safflower, squash, oats, cotton, alfalfa,
grapes, and garlic(6). The growth of M. indica associated with certain crops such as wheat is
considered dangerous since the presence of coumarin in almost all parts of the plant is
common, which causes the characteristic smell of the plant to be transmitted to the cereal,
to the grains of the plant and later to the flour(8). For this reason, it is considered a noxious
weed in agriculture. Seeds of this species can also be found as foreign bodies in seeds of
alfalfa, flax, and many other cereals, which limits their direct consumption. On the other
hand, the fixation of N by soil microorganisms has an essential role in agriculture as it can
replace or reduce the use of costly chemical fertilizers, reduce pollution in the environment,
prevent soil fertility losses, and improve production costs. The legume-Sinorhizobium
symbiosis offers an opportunity for bioremediation and the improvement and fertilization
overexploited soils in agricultural and livestock areas(9). The recovery of Melilotus seeds
and the isolation of the bacteria associated with this legume could benefit the possibility of
regenerating the quality of depleted or eroded soils by sowing the M. indica plant
209
inoculated with the nitrogen-fixing bacteria Sinorhizobium meliloti. Therefore, this paper
presents a general review of the species Melilotus spp. and its symbiont Sinorhizobium
meliloti as a potential improver of soil quality.
Origin and distribution
In the legume or Fabaceae family, the genus Melilotus includes different species, generally
known as sweet clovers(7). Its origin is found in Europe and Asia(10). During the conquest, it
dispersed and adapted abundantly in America and Australia, although today, it has a
cosmopolitan distribution. It is noted that in Mexico(5), in most states, it is recorded as a
weed and is considered an exotic plant, with the species Melilotus indica (L.) being the
most widely distributed(8) compared to the other two species present (M. albus and M.
officinalis). It has been recorded in Aguascalientes, Baja California Norte, Baja California
Sur, Distrito Federal, Oaxaca, Querétaro, Sinaloa, Sonora, Tlaxcala, Veracruz, Durango,
Guanajuato, Hidalgo, Jalisco, Estado de México, Michoacán, Morelos, Nuevo León,
Chiapas, Chihuahua, Coahuila, and Colima(11).
Botanical characteristics
The species Melilotus indica is characterized as an herbaceous, annual or biannual, erect,

highly-branched, 30-50 cm tall plant with a taproot, with compound, trifoliate leaves,
remarkably similar to those of traditional alfalfa, slightly dentate margin; with variable size
from 1 to 2 cm long by 3 to 5 cm wide, obtuse or rounded apex and attenuated base. It has a
stem with lanceolate stipules. Inflorescence arranged in clusters of 30 to 70 and small
flowers 3 to 5 mm long with very short pedicels, with yellow or white corolla 1-3 mm long,
in thin clusters (Figure 1), starting from the axil of the upper leaves and being longer than
these, with the banner longer than the other petals, and a group of 10 stamens distributed in
9 that form a bundle and one that is free(12,13).
210
Figure 1: Inflorescence of two species of melilot, yellow (Melilotus indica) and white (M.
albus)
The fruit is a subglobose legume, about 3 mm, apiculate, hairless, yellowish-green, with
transverse wrinkles, containing one or two smooth, yellowish seeds of 1.5 mm in diameter
and globose surface (Figure 2). Flowering usually occurs in May and can last all summer.
The plant has a slightly bitter taste; when it dries, it emits an intense coumarin aroma(13).
Figure 2: Fruits of green (a) and mature (b) melilots
In the seedling stage, it is characterized by having a hypocotyl measuring 11 to 42 mm,

greenish, smooth, and cotyledons of oblong to elliptical blade 4 to 8 mm long and 2 to 4
mm wide, without pubescence and without epicotyl. Alternate leaves, the first simple and
the second compound (Figure 3).
211
Figure 3: Morphotypical characteristics of Melilotus plants. Lanceolate leaves and

Branched stem
Taxonomy of Melilotus indicus
The species Melilotus indicus (L.) All. is included in the following taxa: Class:
Equisetopsida; Subclass: Magnoliidae; Superorder: Rosanae; Order: Fabales; Family:
Fabaceae; Genus: Melilotus (L.) Mill; Species: indicus [Melilotus indicus (L.) All.]. Other
synonyms given to the species are: Sertula indica (L.) Kuntze and Sertula melilotus var.
indica (L.) Lunell(8).
Generalities, impact, and importance of Melilotus indicus on crops
Melilotus species are undesirable, considered weeds when they grow together with cereal
crops, with annual growth, mainly in wild environments of temperate climates(14); due to
the production of coumarin that gives it a characteristic aroma, there is a great diversity of
names given to it, such as sweet clover or small-flowered melilot, small melilot, scented
melilot, scented clover, royal crown, yellow sweet clover, king’s narrow crown, scented
cart(15). In addition, it is noted that this species can be considered a good forage plant(16) and
212
a good plant source for production and incorporation as green manure. It is also noted that
it can be a good option for soil improvement and nitrogenation as it has the ability to make
symbiotic associations with nitrogen-fixing microorganisms naturally.
Due to the presence of coumarin, transmitted as a characteristic smell to cereals or grains

and later transmitted to flour during milling, Melilotus spp. plants are listed as a weed
(Figure 4), which is undesirable to find among seeds intended for human consumption, and
for this reason, it has been declared as a weed in many countries, including Mexico, where
it is considered exotic(11).
Figure 4: Sweet clover crop plants and their association with maize crops
“El Bajío” Experimental Field. Antonio Narro Autonomous Agrarian University in Buenavista, Saltillo,
Coahuila, Mexico
It has been reported that, among different species of Melilotus, the coumarin content varies
between varieties, ecotypes, and individuals of the same species(17). This presence of
coumarin also varies throughout the plant’s growth cycle, where it is mentioned that its
presence is maximum in new leaves or buds, or as a response to stress from pests and
diseases (biotic factors), as well as salinity, alkalinity, nutritional deficiencies in the soil,
etc. (abiotic factors)(18). Its relevance is also due to its ability to fix atmospheric nitrogen
symbiotically, which allows it to be a protein store, which is another important factor that
allows it to be chosen as forage; in addition, it reduces production costs since it reduces the
work of applying and purchasing fertilizers, which leads to an improvement in the chemical
properties of the soil.
213
Biological and ecological importance of Melilotus
Species belonging to the genus Melilotus have recently received particular attention due to
their use in response to the need for a broader range of legume species suitable for saline
soils(19,20). Cultivars that have shown considerable potential have been released, such as
Melilotus albus cultivar Jota Medik(21). The potential of M. siculus (Turra) Vitman ex B. D.
Jacks. (Syn. M. messanensis) as a grass species has also been described as a cultivar(22,23).
As already mentioned, Melilotus spp. contributes indirectly to the nutrition process of

cultivated plants by allowing symbiosis or association with rhizobacteria, allowing this
utilization to a large extent due to the beneficial fixation of atmospheric nitrogen, in
addition to promoting greater solubility and conductivity of nutrients(24). This biological
nitrogen fixation results from the enzymatic conversion of gaseous nitrogen to ammonium;
this is a characteristic of all prokaryotes, and very specifically of the genera of free-living
nitrogen-fixing rhizobacteria associated with legumes(25), such as the group of species of
the genus Sinorhizobium, which mainly associate with legumes(26).
The symbiotic relationship formed by the plant species Medicago sativa and the beneficial
bacteria Sinorhizobium meliloti is a reference model to know and explore the mechanisms
that interact in molecular expression, through which the legumes-rhizobia symbiosis
develops, and how these are regulated, making it possible to lay the foundations to address
the manipulation and improvement of symbioses for practical purposes in an agroeconomic
sense(27).
Relationship of Sinorhizobium and Melilotus
Under natural conditions, there is a very specific symbiotic relationship between the species
of the genus Sinorhizobium, which is characterized by the formation of nodules in some
legumes, settling within their roots, where they proliferate, differentiate and fix nitrogen(28).
In this sense, a very specific symbiotic relationship is found between Melilotus plants and
the genus Sinorhizobium meliloti(26,29,30), as shown in Figure 5. Currently, there are few
descriptions of legume-type plants associated with a greater number of nitrogen-symbiotic
species(24).
214
Figure 5: Melilot plants with nodules characteristic of the bacteria Sinorhizobium under
natural conditions growing as wild weeds
N assimilation is carried out by an enzymatic process where a change from atmospheric

nitrogen to ammonium occurs. This process is a primary characteristic of prokaryotes and is
distributed in different genera of bacteria with the same ability to fix N naturally(25).
Generally, the artificial incorporation of nitrogen as a chemical fertilizer inhibits nodule
formation and atmospheric nitrogen fixation in plants with the presence of nodules. It is
mentioned that the nitrogen fixation process is very energetically expensive(31).
Atmospheric nitrogen fixation contributes about 90 million tonnes annually for legume
crops such as soybeans, red clover, and peas(30).
The interaction between the plant and the bacteria begins with the signaling or synthesis in
the roots and the exudation of flavonoids, which are chemical recognition signals between
the two organisms(32). Phenolic compounds start the expression in bacteria of the genes
involved in the nodulation process, which allows the synthesis and secretion of lipochitins
called nodulation factors(32,33,34), which, when interacting in the root, cause morphological
changes in the plant according to the type of legume(35). Once the bacteria invade the root
cells of the plant, they proliferate and differentiate as bacteroids (Figure 6), which are
responsible for nitrogen fixation inside the cell; these bacteroids are surrounded by a plant-
derived peribacteroid membrane, which constitutes a new organelle called a symbiosome.
The plant contributes carbohydrates to the bacteroid for its metabolism through the phloem,
and the bacteroid contributes ammonium to the plant in the form of different amino
acids(36,37). The verification of the cell morphology allows to observe the bacteroids that are
characteristic of these bacteria existing within the root cells. This form of bacteroid is due
to the lack of a defined shape (Figure 6) as they lack a cell wall; therefore, they are
considered amorphous(38).
215
Figure 6: In vivo Sinorhizobium meliloti bacteroids obtained from nodules and observed
under the 100X compound microscope.
Characteristics of Sinorhizobium meliloti
The characteristics of these bacteria are that they are bacillary in shape, belong to the
Gram-negative group, do not form spores, and are heterotrophic and aerobic. The bacteria
S. meliloti are very capable of thriving both in a complex and competitive environment,
such as the rhizosphere, and intracellularly once the association is established. Due to their
complex and large genome size, these microorganisms are highly versatile, which gives
them a great metabolic capacity with advantages of colonizing different niches in nature(39).
Generally, the bacterial cell of Sinorhizobium has dimensions between 0.5-1.0 x 1.2-3.0
μm, with the presence of large plasmids, megaplasmids, quite common in these species,
where symbiotic genes are located in some cases(40). Their use in agricultural systems
would bring benefits such as: the reduction of production costs as the use of chemical
fertilizers decreases, the increase in agricultural production, and the contribution to the
remediation of overexploited, alkaline, or low organic matter soils(41).
When wanting to isolate S. Meliloti, nodules that are generally reddish, which indicates that
they contain leghemoglobin, and present in the secondary roots of sweet clover plants
should be collected, washed with soap and water, and disinfected with chlorine and washed
several times with sterile distilled water, to subsequently macerate the nodule in a sterile
tube and seed the resulting liquid into the culture medium through a bacteriological loop.
For this purpose, it is common to use the growth medium based on the yeast mannitol agar-
Congo red and incubate at 28 °C for two days until the red growth of the typical colonies of
the genus is observed. Subsequently, it is purified by streaking in the same culture medium
until isolated colonies are obtained in the culture(24). The main characteristic of the colonies
216
of these bacteria on mannitol agar is that they are of the mucoid type with an elevation and
smooth edges (Figure 7). Certain tests help to identify the bacteria better, such as the Gram
stain test, which must be negative (-), presence of flagella, polysaccharide (KOH)
production positive, sodium chloride growth positive, indole production positive, and acidic
pH growth positive (42).
Figure 7: Isolation by reseeding of rhizobacteria from sweet clover nodules
a) Streak seeding of the maceration of melilot nodules and growth of colonies typical of the genus
Sinorhizobium spp. in mannitol agar culture. b) Rhizobacteria purified by simple streaking.
Diversity of symbiotic nitrogen rhizobacteria
As a group, rhizobacteria are very diverse in terms of genera, species, and molecular
phylogenetic relationships. It is noted that they include six genera (Allorhizobium1,
Azorhizobium2, Bradyrhizobium3, Mesorhizobium4, Rhizobium5, and Sinorhizobium6), each
with different species, and target plant species, as described below in Table 1(43,44,45).
217
Table 1: Nitrogen-fixing bacteria and their associated species

Rhizobacteria Rhizobacteria
Genus Species Crop Genus Species Crop
Allorhizobium undicola Neptunia Azorhizobium caulinodans Sesbania
natans rostrata
Bradyrhizobium Japonicum Glycine max Rhizobium hainanense Sesbania
elkanii Glycine max hautiense herbacea
liaoningense Glycine max Vicia
yuanmingense Lespedeza leguminosarum (peas)/
Trifolium
mongolense (clover)
Medicago
tropici ruthenica/
Phaseolus
vulgaris
Phaseolus
vulgaris/
Leucaena
Neptunia
natans
Mesorhizobium Loti Lotus Sinorhizobium arboris Acacia
amorphae Amorpha fredii senegal/
cicero fructicosa kostiens Prosopis
huakuii Cicer medicae chilensis
mediterraneum arietinum meliloti Glycine
plurifarium Astragalus saheli max
C. terangae Acacia
mediterranium senegal/
Leucaena Prosopis
xinjiangense chilensis
Medicago
spp
Medicago
sativa
sesbania
Sesbania/
Acacia
Glycine
max
218
Melilot response to nodulation
Bioassays carried out under greenhouse conditions to determine the efficiency of nodule
formation showed that, when sowing melilot seed inoculated with Sinorhizobium meliloti,
the latter induced the formation of nodules mostly cylindrical and branched (Figure 8),
characteristics representative of symbiotic nodules of S. meliloti(40). It is reported that
Sinorhizobium meliloti induces the formation of pinkish nodules in seed-generated
Melilotus spp. plants, both in pots and naturally(46).
Figure 8: Roots of melilot plants with the presence of lobulated pinkish nodules of
Sinorhizobium meliloti
Some agroecological characteristics of melilot plants
Sweet clovers or melilots can develop in saline soils(12) poor in organic matter, with
alkaline pH, at temperatures ranging from temperate to cold, where it has been observed
that in some areas of occasional or irregular cold, they withstand temperatures of at least 0
°C and manage to grow normally during winter at temperatures below 15 °C, so this make
this plant agronomically interesting for soil remediation during the winter seasons. It is a
very competent weed, manages to develop favorably among plants, and fruits before or
after the formation of crop fruits; it particularly excels in garlic, onion, corn, oats, sorghum,
and wheat crops (Figure 9).
219
Figure 9: Melilot plants surviving winter frosts that damage other weeds
Nitrogen fixation by Melilotus spp
Generally speaking, most rhizobia symbiotically fix atmospheric N2 in amounts of up to

200 kg ha-1 year-1 of N in the nodules of plants of the Fabaceae family under specific
conditions of temperature, pH, humidity, content of inorganic N, Fe, Co, Mo, and P in the
soil. Among the best-known genera with this function are: Azospirillum, Bacillus,
Beijerinckia, Azotobacter, and Pseudomonas. N2 fixation by free-living bacteria in
associated meadows of ryegrass (Lolium perenne) and Melilotus albus and inoculation with
Rhizobium meliloti (Sinorhizobium meliloti) is reported with a similar N2 content, both in
meadows under cutting and under grazing(48). They also point out that the density of plants
modifies the amount of fixation, being greater in cutting since grazing reduces the
persistence of the legume in the meadow. These authors report a nitrogenase activity
between 1.83 and 1.36 nmol of C2H4 produced plant-1 h-1, respectively. Al Sherif(6) points
out that M. indicus is a species with a high percentage of nodulation (68-95 %) and high
nitrogenase activity, 1.81 mmol C2H4 plant-1 h-1 on average, and high protein content (21-
30 %); he concludes that the high percentage of nodulation and nitrogenous activity
recorded in M. indicus plants gives the species economic importance as it can be used to
improve soil fertility. The rhizobium-legume symbiotic system requires that there be no
mineral limitations, either by excess or defect. High concentrations of nitrates inhibit the
infection process, the development of nodules, and the expression of nitrogenase activity.
The greater the presence of N in the soil, the fewer possibilities there are for Biological
Nitrogen Fixation (BNF), and conversely, the lower the presence of N in the soil, the more
220
N from BNF. The presence of combined forms of nitrogen limits BNF. Fertile soils with
moderate or high availability of inorganic forms of N at the time of sowing or high rates of
mineralization during the crop cycle affect the establishment of symbiosis since they delay
the beginning of nodulation or inhibit the functioning of the fixative system.
Ways of nitrogen incorporation
a) Incorporation as green manure. Using green manures is a practice that counteracts the
negative effects of improper soil management. Some authors(49) incorporated melilots for a
period of four successive years, finding improvements in the soil, such as an increase in
organic matter (OM), which went from 0.32 to 0.69 %. Likewise, Fontana et al(50)
incorporated whole plants or remnants of Melilotus albus combined with rye as green
manure, with the latter being the control; then the nitrate content was determined, which
behaved as follows: at the year of incorporation, the NO3 values in ppm were 38.0, 39.0 and
44.0 for treatments of rye, rye + Melilotus remnant and rye + whole Melilotus plant,
respectively. For the second year, the NO3 values were as follows: 17.7, 26.0 and 47.4 ppm
for the same sequence of treatments, respectively. It was observed that only the treatment
that includes the whole melilot plant achieved consecutive increases in NO3. These data
show that at the end of year two, a difference of 30 ppm of NO3 was found between the
treatment of incorporation with Melilotus and rye.
b) Growth and symbiosis with nitrifying bacteria. A common feature of microorganisms

involved in biological nitrogen fixation is the arrangement of nitrogenase enzymes, which
reduce atmospheric nitrogen to NH4+ ions, which are the assimilable form. This enzymatic
activity is highly susceptible to oxygen concentration in the environment, so
microorganisms have adapted the necessary adaptation mechanisms such as respiratory
protection, conformational protection, and cellular compartmentalization(51). These
processes involve a group of families of specialized activating proteins, which interact with
RNA polymerase (RNAP) containing the transcription factor (sigma σ54), called enhancer-
binding proteins (EBPs), in order to activate transcription from upstream sites through the
DNA Loop. These proteins interact with upstream activating sequences similar to the
enhancer proteins through a C-terminal DNA-binding domain and the conserved central
domain belonging to the AAA+ family, which couples hydrolyzed ATP until activation of
transcription by σ54-RNAP. The activity of EBPs is highly regulated in response to
environmental signals through amino-terminal regulatory modules and, in some cases,
through interactions with other regulatory proteins(52,53).
221
c) Soil improvement. Fontana et al(50) found positive effects of incorporating green manure
from M. albus on the production of forage and CP of rye crops in subsequent cultivation
cycles (two years). In addition, they mention that there was a remnant of nitrates in the soil,
so they infer that the increased fertility did not fully translate into production.
Aspects such as forage:

It is mentioned that both M. albus and M. indicus are forage plants used for animal feed due
to their abundant source of protein(54); however, their use should apply only to major
animals (cattle, horses, goats, and sheep), who consume them as a whole plant in a mixed
form: (grazing and forage), since they are toxic to smaller species, especially the species M.
indicus(55). Although Melilotus species have a high content of coumarins and derivatives
thereof, some authors(56) report that, depending on the part analyzed, the quantification of
coumarin may vary; for example, it is quantified in a greater quantity in flowers, followed
by stems and leaves in plants before regrowth; they also observed that after several
phenological cycles, these compounds decrease both in leaves and stems (after 2 and 4
cycles, respectively). In this sense, melilots are a reliable and cost-effective source of
protein in ruminants and non-ruminants because they are independent of soil nitrogen. In
addition, melilots are an excellent source of minerals, and intakes of melilots are generally
higher than those of grasses with equal digestibility(55).
In order to know the behavior of sowing density (SD) and the effect of cut age (CA),
researchers(56) developed a study in which they reported significant differences for SD and
CA with respect to the production of M. albus. They observed an increase of more than
100 % when SD went from 500 to 1,500 seeds (from 333.34 to 736.62 plants after
emergence per m-2, respectively), which represented a higher production of fresh (FM) and
dry matter (DM), with values between 1.66 and 2.29 kg m-2 of FM and values from 0.37 to
0.52 kg m-2 of DM. The cut age (before bud break [A], bud break [B] and full flowering
[C]) had behaviors similar to SDs; FM was observed with values between 1.11 and 3.06 kg
m-2 and, for DM, values between 0.18 and 0.80 kg m-2; however, a decrease in the
percentage of leaves was observed as the cut age increased (40 [A] to 19 % [C]); it is worth
mentioning that in an evaluation period, no differences were found between years for these
variables. Regarding the variables of total protein (TP), crude fat (CF), fiber (F), and ash
(As), there were no differences between the SD or in the years evaluated, but differences
were observed concerning harvest age; for TP it was 21.72, 17.08 and 14.81 in the A-B-C
stages, for CF it was 2.41, 2.08, and 1.71 in A-B-C, for F it was 34.55, 40.27, and 42.82 for
A-B-C, respectively.
Quero et al(57) point out that the agronomic characterization of species with high forage
productivity for the purpose of cultivar development and seed production would be one of
the tools to improve the productivity and adaptability of pastures to the environment. One
222
of the most important species for restrictive environments is Melilotus albus Medik as it
has high productivity, wide genetic variability, and extensive environmental adaptation(58).
Medicinal aspects:
Since time immemorial, medicinal plants have been consumed by man all over the world to
treat various ailments or disorders in their health or that of their domestic animals, in acute
ailments, and as adjuvants in chronic problems because they produce hundreds of
substances of very different types, and some with negative effects. In this sense, the
coumarin produced by Melilotus species has negative effects due to the hemorrhages
caused in calves fed with this plant; however, from the medicinal point of view, it was
identified as an anticoagulant, and reports indicate that cattle suffered severe bleeding
disorders after having ingested sweet clover (Melilotus albus) stored in silos(59). It is also
mentioned(60) that Melilotus has potential for the management of side effects in the
management of diabetics since Melilotus officinalis can be used in herbal medicine;
previous studies have shown that it is effective in reducing skin aging, induces
microvascularization, and has anti-inflammatory effects(61,62).
With all the above, from an ecological, agricultural, and livestock point of view, melilots
are an opportunity point for the improvement and reclamation of overexploited or
unproductive soils, forage production, and substantive changes in soil fertility, as well as
for favoring the diversity of microbial species in the environment and broad utility in
medicine.
Conclusions
The sweet clover or melilot is a plant that manages to grow as a weed in a great diversity of
crops, where its presence is not pleasant due to the characteristic smell that the plant
generates when it develops, especially in grasses, which are usually used to produce flours
or pasta. However, its characteristics of growth and agroecological development make it a
plant desirable for the improvement or remediation of soils poor in organic matter, salty or
alkaline, in climates of temperate to very cold temperatures where its association with
symbiotic nitrogen-fixing bacteria of the Sinorhizobium meliloti type is detected, with
which it associates to obtain nitrogen, which is favorable for improving the nutritional
quality of the soil where it grows.
223
Acknowledgments and conflicts of interest
The authors declare no conflicts of interest.
Literature cited:
1. Zamora NJF, Zapata HI, Villalvazo HA. Fijación biológica del nitrógeno en tres
especies silvestres del género Lupinus (Leguminosae, Papilionoideae) en México. Act
Bot Mex 2019;(126):e1543. https://doi.org/10.21829/abm126.2019.1543.
2. Córdova-Sánchez S, Castelán-Estrada M, Salgado-García S, Palma-López JD, Vera-

Núñez JA, Peña-Cabriales JJ, et al. Biological nitrogen fixation by three fabaceas
(Leguminosae) in acid soil of Tabasco, México. Avances en Investigación
Agropecuaria 2011;15(1):31-50.
3. Castro-Rincon E, Mojica-Rodríguez JE, Carulla-Fornaguera JE, Lascano-Aguilar CE.

Abonos verdes de leguminosas: integración en sistemas agrícolas y ganaderas del
trópico. Agron Mesoam 2018;29(3):711-729.
4. Salas ME. La simbiosis fijadora de nitrógeno Sinorhizobium meliloti-alfalfa:

aproximaciones ómicas aplicadas a la identificación y caracterización de determinantes
genéticos del rizobio asociados a la colonización temprana de la raíz de alfalfa
(Medicago sativa) [tesis posgrado]. Argentina: Instituto de Biotecnología y Biología
Molecular; 2015. https://doi.org/10.35537/10915/46558.
5. Mondragón PJ, Vibrans H. Manual de malezas de México. CONABIO; 2009.

http://www.conabio.gob.mx/malezasdemexico/fabaceae/melilotus-
indica/fichas/ficha.htm.
6. Al Sherif EA. Melilotus indicus (L.) All., a salt-tolerant wild leguminous herb with
high potential for use as a forage crop in salt-affected soils. Flora: Morphol Distrib
Funct Ecol Plants 2009;204(10):737-746.
7. Toll VJR. Los tréboles de olor como recurso forrajero. 1ª ed. Argentina: Universidad
Nacional de Tucumán; 2018. ISBN 978-987-754-136-6.
8. Tropicos. Tropicos.org. Missouri Botanical Garden. Consultado 28 Jun, 2023.

https://tropicos.org/name/13035799. 2022.
9. López C, Odorizzi A, Basigalup DH, Arolfo V, Martínez MJ. El trébol de olor blanco
y su uso en la provincia de Córdoba. 1ª ed. Buenos Aires, Argentina: Ediciones INTA:
2016. ISBN 978-987-521-716-4.
224
10. Aboel-Atta AMI. Isozymes, RAPD and ISSR variation in Melilotus indica (L.) All.
and M. siculus (Turra) BG Jacks. (Leguminosae). Acad J Plant Sci 2009;2(2):113-118.
11. Villaseñor JL, Espinosa GFJ. Catálogo de malezas de México. Universidad Nacional
Autónoma de México. Consejo Nacional Consultivo Fitosanitario. México, D.F.
Fondo de Cultura Económica; 1998.
12. Mesa D. Obtención de plantas resistentes a la salinidad para los suelos salinos
cubanos. Rev Cubana Cienc Agr 2003;(37):217-226.
13. Floraiberica. Melilotus. LXXXVIII. LEGUMINOSAE – TRIFOLIEAE. 2020.

http://www.floraiberica.es/floraiberica/texto/pdfs/07_39%20Melilotus.pdf. Consultada
28 Jun, 2023.
14. Wu F, Zhang D, Ma J, Luo K, Di H, Liu Z, Zhang J, Yanrong Wang Y. Analysis of

genetic diversity and population structure in accessions of the genus Melilotus. Ind
Crop Prod 2016;(85):84-92. https://doi.org/10.1016/j.indcrop.2016.02.055.
15. Zabala JM, Marinoni L, Ribero G, Sánchez R, Del Valle E. Rev Fave Secc Cienc
Agrar 2016;15(1):14.
16. Martínez PJL. Melilotus indicus (L.). Herbario nacional de México (MEXU) Plantas
vasculares, UNAM; 2012. https://datosabiertos.unam.mx/IBUNAM:MEXU:656408.
17. Nair R, Whittall A, Hughes S, Craig A, Revell D, Miller S, et al. Variation in

coumarin content of Melilotus species grown in South Australia. NZ J Agric Res
2010;53(3):201-213. https://doi.org/10.1080/00288233.2010.495743.
18. Flórez DDF. La alfalfa (Medicago sativa): origen, manejo y producción. Conexión
Agropecuaria JDC 2015;5(1):27-43.
https://revista.jdc.edu.co/index.php/conexagro/article/view/520.
19. Nichols PGH, Loi A, Nutt B, Evans PM, Craig AD, Pengelly BC et al. New annual
and short-lived perennial pasture legumes for Australian agriculture 15 years of
revolution. Field Crop Res 2007;104(1-3):10-23.
https://doi.org/10.1016/j.fcr.2007.03.016.
20. Dear BS, Ewing MA. The search for new pasture plants to achieve more sustainable
production systems in southern Australia. Aust J Exp Agric 2008;48(4):387-396.
https://doi.org/10.1071/EA07105.
21. Evans PM, Kearney GA. Melilotus albus (Medik.) is productive and regenerates well
on saline soils of neutral to alkaline reaction in the high rainfall zone of south-western
Victoria. Aust J Exp Agric 2003;43(4):349–355. https://doi.org/10.1071/EA02079.
225
22. Nichols PGH, Craig AD, Rogers ME, Albertsen TO, Miller SM, McClements DR, et
al. Production and persistence of annual pasture legumes at five saline sites in southern
Australia. Aust J Exp Agric 2008;48(4):518-535. https://doi.org/10.1071/EA07167.
23. Rogers MJ, Colmer TD, Frost K, Henry D, Cornwall D, Hulm E, et al. Diversity in the
genus Melilotus for tolerance to salinity and waterlogging. Plant Soil 2008;(304):89-
101. https://doi.org/10.1007/s11104-007-9523-y.
24. Yañez AA. Recuperación de rhizobacterias del cultivo de frijol (Phaseolus vulgaris)
de San Andrés Tlalamac, Estado de México [tesis Licenciatura]. México: Universidad
Autónoma Agraria Antonio Narro; 2017.
25. Young JPW, Haukka KE. Diversity and phylogeny of Rhizobia. New Phytol
1996;(136):87-94.
26. Aizawa S-I. 2014. Sinorhizobium meliloti — Nitrogen–fixer in the grassland. The
Flagellar World 2014;(1):82-83. https://doi.org/10.1016/B978-0-12-417234-0.00026-
8.
27. Lagares A. La simbiosis fijadora de nitrógeno Sinorhizobium meliloti - alfalfa

(Medicago sativa) caracterización del rol biológico del ARN pequeño sm8 en la vida
libre y simbiótica de los rizobios [tesis doctorado]. Argentina: Universidad Nacional
de La Plata; 2015. http://sedici.unlp.edu.ar/handle/10915/66185.
28. Cerdeño GGA. Tolerancia a estrés hídrico y promoción del crecimiento en alfalfa
(Medicago sativa) inoculada con bacterias de la rizósfera [tesis doctorado]. Chile:
Universidad de Concepción; 2018. http://repositorio.udec.cl/jspui/handle/11594/3363.
29. Ormeño OE, Vinuesa P, Zúñiga-Dávila D, Martínez-Romero E. Molecular diversity of

native bradyrhizobia isolated from lima bean (Phaseolus lunatus L.) in Peru. Sys Appl
Microbiol 2006;29(3):253–262. https://doi.org/10.1016/j.syapm.2005.09.002.
30. De Lajudie P, Willems A, Pot B, Dewettinck D, Maestrojuan G, Neyra M, et al.

Polyphasic Taxonomy of Rhizobia: Emendation of the Genus Sinorhizobium and
description of Sinorhizobium meliloti comb, nov., Sinorhizobium saheli sp. nov., and
Sinorhizobium teranga sp. nov. Int J Syst Evol Microbiol 1994;44(4):715-733.
https://doi.org/10.1099/00207713-44-4-715.
31. Soto-Urzua L, Baca BE. Mecanismos de protección de la nitrogenasa a la inactivación

por oxígeno. Rev Latinoam Microbiol 2001;(43):37-49.
226
32. Spaink HP. Root nodulation and infection factors produced by rhizobial bacteria. Annu
Rev Microbiol 2000;(54):257-288.
http://arquivo.ufv.br/dbv/pgfvg/BVE684/htms/pdfs_revisao/estresse/infectionfactors.p
df.
33. Lerouge P, Roche P, Faucher C, Maillet,F, Truchet G, Prome JC. et al. Symbiotic host
specificity of Rhizobium meliloti is determinated by a sulphated and acylated
glucosamine oligosaccharide signal. Nature 1990;(344):781-784.
https://doi.org/10.1038/344781a0.
34. Geurts R, Fedorova E, Bisseling T. Nod factor signaling genes and their fungtion in
the early stages of Rhizobium infection. Curr Opin Plant Biol 2005;8(4):346-352.
https://doi.org/10.1016/j.pbi.2005.05.013.
35. Fernández-Luqueño F, Espinosa-Victoria D. Bioquímica, fisiología y morfología de la

senescencia nodular: una revisión crítica. Terra Latinoam 2008;26(2):133-144.
36. Franche C, Lindstrom K, Elmerich C. Nitrogen-fixing bacteria associated with

leguminous and non-leguminous plants. Plants Soil 2009;(321):35-59.
https://doi.org/10.1007/s11104-008-9833-8.
37. Guzmán DD, Montero TJ. Interacción de bacterias y plantas en la fijación del
nitrógeno. RIIARn 2021;8(2):87-101. https://doi.org/10.53287/uyxf4027gf99eAguilar
2004.
38. Lodwig E, Poole P. Metabolism of Rhizobium Bacteroids. Crit Rev Plant Sci
2003;(22):37-78. https://doi.org/10.1080/713610850.
39. Amarelle LV. Elucidación de los sistemas de implicados en la captación y utilización

de hemina como fuente de hierro nutricional en Sinorhizobium meliloti 1021. [tesis
doctorado]. Uruguay: Universidad de la República; 2016.
https://www.colibri.udelar.edu.uy/jspui/bitstream/20.500.12008/8853/1/uy2418174.
40. Graham PH, Draeger KJ, Ferrey ML, Conroy MJ, Hammer BE, Martínez E, et al. Acid
pH tolerance in strains of Rhizobium and Bradyrhizobium, and initial studies on the
basis for acid tolerance of Rhizobium tropici UMR1899. Can J Microbiol
1994;(40):198-207. https://doi.org/10.1139/m94-03.
41. Batanony NHE, Castellano-Hinojosa A, Mamdouh A, Ashraf N, Bedmar EJ.

Agronomical parameters of host and non-host legumes inoculated with Melilotus
indicus-isolated rhizobial strains in desert unreclaimed soil. Arch Microbiol
2020;202(7):1929-1938. doi.10.1007/s00203-020-01907-x.
227
42. Kuykendall D, Young J, Martínez E, Kerr A, Sawada H. Rhizobium (Frank 1889), 338.
In: Bergey`s Manual of Systematic Bacteriology. Editorial Springer US; 2005.
43. Delgado MJ, Casella S, Bedmar EJ. Denitrification in Rhizobia-legume symbiosis.

Biology of the nitrogen cycle 2007;(1)83-91. https://doi.org/10.1016/B978-
044452857-5.50007-2.
44. Moreno RA, García MV, Reyes CJL, Vásquez AJ, Cano RP. Plant growth promoting
rhizobacterias: a biofetilization alternative for sustainable agriculture. Rev Colombi
Biotecnol 2016;20(1):68-83.
45. Velasco-Jiménez A, Castellanos-Hernández O, Acevedo-Hernández G, Aarland RC,

Rodríguez-Sahagún A. Bacterias rizosféricas con beneficios potenciales en la
agricultura. Terra Latinoam 2020;38(2):333-45.
https://doi.org/10.28940/terra.v38i2.470.
46. Antonio Del AM. Aislamiento e identificación Sinorhizobium meliloti de nódulos de

plantas de alfalfilla [tesis licenciatura]. México: Universidad Autónoma Agraria
Antonio Narro; 2021.
http://repositorio.uaaan.mx:8080/xmlui/bitstream/handle/123456789/48036/K%20672
27%20Antonio%20del%20%c3%81ngel%2c%20Maricela.pdf?sequence=6&isAllowe
d=y.
47. Bolger TP, Pate JS, Unkovich MJ, Turner NC. Estimates of seasonal nitrogen fixation
of annual subterranean clover-based pastures using the 15N natural abundance
technique. Plant Soil 1995;175:57-66. https://doi.org/10.1007/BF02413010.
48. Delgadillo MJ, Ferrera-Cerrato R, Galvis-Spínola A, Hernández-Garay A, Cobos-

Peralta MA. Fijación biológica de nitrógeno en una pradera de trébol hubba/ballico de
corte o de pastoreo. Terra Latinoamericana 2005;23(1):73-79.
49. Fontana LMC. Efectos de la alfalfa y del melilotus usados como forraje y abono verde,
sobre la producción de pasturas y cultivos [tesis licenciatura]. Argentina: Universidad
Nacional de Córdoba; 2014.
50. Fontana LMC, Juan NA, Ruiz MA, Babinec FJ. Utilización de trébol de olor blanco
(Melilotus albus Medik.) como abono verde, efecto sobre las condiciones del suelo y la
productividad del cultivo subsiguiente. Semiárida 2018;28(2)25-33.
http://dx.doi.org/10.19137/semiarida.2018(02).25-33.
51. Mayz-Figueroa, J. Fijación biológica de nitrógeno. Rev Científ UDO Agríc 2004;4:1-
20. https://dialnet.unirioja.es/servlet/articulo?codigo=2221548.
228
52. Bush M, Dixon R. The role of bacterial enhancer binding proteins as specialized
activators of σ54-dependent transcription. Microbiol Mol Biol Rev 2012;76(3):497-
529. doi: 10.1128/MMBR.00006-12.
53. Romero JL. Importancia del segundo mensajero c-di-GMP en la simbiosis rizobio-
leguminosa [tesis doctorado]. España: Universidad de Granada; 2016.
54. Aguirre-Mendoza Z, Jaramillo-Diaz N, Quizhpe-Coronel W. Arvenses asociadas a

cultivos y pastizales del Ecuador. Universidad Nacional de Loja. Ecuador. 2019.
https://unl.edu.ec/sites/default/files/archivo/2019-
12/ARVENSES%20ASOCIADOS%20A%20CULTIVOS%20Y%20PASTIZALES%
20DEL%20ECUADOR_compressed.pdf.
55. Castañeda SR, Albán CJ, Gutiérrez PH, Cochachin GE, La Torre AMI. Plantas
silvestres empleadas como alimento para animales en Pisha, Ancash. Ecología
Aplicada 2014;13(2):153-168.
55. Sowa-Borowiec P, Jarecki W, Dzugan M. The effect of sowing density and different
harvesting stage on yield and some forage quality characters of the white sweet clover
(Melilotus albus). Agriculture 2022;12(5):575.
https://doi.org/10.3390/agriculture12050575.
57. Quero CAR, Enríquez QJF, Miranda JL. Evaluación de especies forrajeras en América
Tropical, avances o status quo. Interciencia 2007;32(8):566-571.
58. Mosca J. Evaluación agronómica en caracteres reproductivos de una colección de

Melilotus albus Medik en Pergamino, Buenos Aires [tesis licenciatura]. Argentina:
Universidad Nacional del Noroeste de la Provincia de Buenos Aires; 2019.
59. Waizel-Bucay J, Waizel-Haiat S, Revilla-Peñaloza F. Los productos herbolarios, la

coagulación sanguínea y la cirugía otorrinolaringológica. Otorrinolaringología
2017;62(2):115-142.
60. Chorepsima S, Tentolouris K, Dimitroulis D, Tentolouris N. Melilotus: Contribution to

wound healing in the diabetic foot. J Herbal Med 2013;3(3):81-86.
https://doi.org/10.1016/j.hermed.2013.04.005.
61. Asres K, Eder U, Bucar F. Studies on the antiinflammatory activity of extracts and
compounds from the leaves of Melilotus elegans. Ethiopian Pharmaceutical J
2000;18:15-24.
62. Pleşca-Manea L, Pârvu AE, Pârvu M, Taămaş M, Buia R, Puia M. Effects of Melilotus
officinalis on acute inflammation. Phytother Res 2002;16(4):316-9. doi:
10.1002/ptr.875. PMID: 12112285.
229
Review
Main bioactive components and therapeutic properties of bee (Apis

mellifera L.) venom. Review
Karla Itzél Alcalá-Escamilla a
Yolanda Beatriz Moguel-Ordóñez b*
a
Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Centro Nacional de
Investigación Disciplinaria en Fisiología y Mejoramiento Animal. Km. 1, Carretera a Colón,
76280, Colón, Querétaro. México.
b
Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Centro de
Investigación Regional Sureste. Campo Experimental Mocochá, Yucatán. México.
*
Corresponding author: moguel.yolanda@inifap.gob.mx
Abstract:
Honeybee venom (HBV) is a secretion produced by Apis mellifera L females and is their
specialized defense mechanism for colony protection. Among the chemical components are
some bioactive compounds to which various biological properties are attributed. It has been
used for therapeutic purposes in a complementary or alternative way to traditional methods
for various health conditions; nevertheless, the application of HBV always involves a risk
for the individual due to the possibility of unfavorable effects. Currently, research work on
HBV is incipient; because of this, the present work presents a review of the works related to
the chemical composition, bioactive compounds, and their biological properties.
Keywords: Honeybees, Bioactive compounds, Venom.
230
Introduction
Beekeeping is the livestock activity aimed at raising the bees Apis mellifera L. In Mexico,
the activity has a social, economic, and ecological impact, because there are more than 43
thousand producers in the country, many of them located in rural areas, who obtain their
livelihood through the production and commercialization of honey. In 2021, 64,320 t of
honey were produced in the country, which placed Mexico as the ninth largest producer
worldwide; however, honey is not the only product that can be obtained from the hive(1,2). It
has been reported that up to 15 different products can be obtained from bees, including
honeybee venom (HBV)(3). HBV, also known as apitoxin, is a natural substance produced by
A. mellifera females, which, due to its composition, has been used to treat and combat health
problems; nonetheless, its use and application are not adequately regulated, and there is
always a latent risk of an exacerbated allergic response on the part of the individual receiving
the HBV(4). This review describes the main bioactive components and therapeutic properties
identified in HBV, such as the anti-inflammatory, antibacterial, and wound healing effects,
and their application against cancer; it also describes the main adverse effects that an
organism can present when coming into contact with HBV.
Honeybee venom
The HBV is produced through two glands located in the abdomen: the venom gland and
Dufour’s gland, also called the acid and alkaline glands, respectively(5). Only A. mellifera
females (workers and queen) have the ability to produce venom and possess a stinger, which
is located in the last abdominal segment and is associated with the acid and alkaline glands.
In workers, the stinger comes from a modification of the ovipositor organs(6) and consists of
a dorsal stylet and two lateral lancets with the ability to slide back and forth. The lancets have
at their lower end a series of spicules known as barbs, like harpoon points, which are
responsible for the stinger not detaching from its aggressor when it is introduced into the skin
of the enemy or aggressor, which causes a tear in the abdomen area of the bee causing the
loss of this structure along with the venom sac, the muscles and nerve center, allowing the
venom to flow easily (Figure 1). This loss of organs and tissues means that the worker dies
when it stings, so the use of the stinger is considered a specialized and adaptive mechanism
for the protection and defense of the colony against its natural predators or other insects(7,8).
The synthesis of venom in workers begins from the moment they emerge from their cells,
and after an average of two weeks, the glands are completely full(9,10).
231
Figure 1: Morphological structures that make up a worker’s stinger(11)
In the queen, the stinger is smooth, so she can sting several times without causing the loss of
the structure or death; in addition, at the time of emerging, she already has the venom glands
completely full; this is because the queen only uses her stinger against another queen, a
situation that can occur when two queens emerge at the same time or when the new queen
emerges, she must destroy other royal cells in the colony(7,8,9).
Characteristics and composition of honeybee venom
HBV is a transparent, odorless, bitter-tasting liquid, with a pH of 4.5 to 5.5, soluble in water
and insoluble in alcohol, and dries easily even at room temperature, and when in contact with
air, it forms grayish-white crystals(10,11). It is composed mainly of water (80 %) and a mixture
of peptides, enzymes, biologically active amines, amino acids, carbohydrates, volatile
compounds, phospholipids, pheromones, and minerals such as Ca, Mg, and P (Table
1)(12,13,14). The concentration of the components can be influenced by factors such as the
method of collection, environment, time of year, species, and age of the bees(8,12,15,17).
232
Table 1: Percentage of the main components that make up bee venom(14)

Component Group % in dry matter HBV
Melittin Peptide 50-60
Phospholipase A2 Enzyme 10-12
Complex ethers Volatile compounds 4-8
P, Ca, Mg Minerals 3-4
Glucose, fructose Carbohydrates 2-4
Apamin Peptide 1-3
Mast cell degranulating Peptide 1-3
peptide
Hyaluronidase Enzyme 1.5-2
Secapin Peptide 1-2
Histamine Biological amine 0.5-2
Dopamine Biological amine 0.1-1
Adolapin Peptide 0.1-0.8
Noradrenaline Biological amine 0.1-0.5
Melittin
It is the compound with the most reported biological activities and with the highest
concentration in the dry matter of HBV. It is a small and linear peptide, formed by 26 amino
acids (Figure 2); it is soluble in water, amphipathic, with a weight of 2,840 Da. Melittin only
induces mild allergic reactions, but it is the component that causes most of the pain associated
with stinging due to its direct and indirect action on primary nociceptor cells(14,17). It is
classified as a lytic peptide due to its amphipathic nature, which allows it to bind to the
surface of cell membranes, disturbing the integrity of phospholipid bilayers, creating pores
that can cause lysis or necrosis of cells. The formation of pores is what allows this molecule
to exhibit hemolytic, antimicrobial, antiviral, and antifungal activity; nevertheless, its non-
specific cellular lytic activity poses significant risks to healthy cells(18,19).
Figure 2: Amino acid composition of melittin(20)

𝐺𝑙𝑖 − 𝐼𝑙𝑒 − 𝐺𝑙𝑖 − 𝐴𝑙𝑎 − 𝑉𝑎𝑙 − 𝐿𝑒𝑢 − 𝐿𝑖𝑠 − 𝑉𝑎𝑙 − 𝐿𝑒𝑢 − 𝑇𝑟𝑒 − 𝑇𝑟𝑒 − 𝐺𝑙𝑖 − 𝐿𝑒𝑢 − 𝑃𝑟𝑜 − 𝐴𝑙𝑎
− 𝐿𝑒𝑢 − 𝐼𝑙𝑒 − 𝑆𝑒𝑟 − 𝑇𝑟𝑝 − 𝐼𝑙𝑒 − 𝐿𝑖𝑠 − 𝐴𝑟𝑔 − 𝐿𝑖𝑠 − 𝐴𝑟𝑔 − 𝐺𝑙𝑛 − 𝐺𝑙𝑛 − 𝑁𝐻2
In studies carried out with cell cultures and animal models, it has been shown that this
component has anticancer activity, part of this activity is due to the fact that it inhibits the
angiogenesis process, which retards tumor growth; it also alters the cell membrane, causing
necrosis in the cell(14). It has also demonstrated in vitro antibacterial activity against Borrelia
233
burgdorferi, the bacteria that cause Lyme disease(21), and against different strains of
Staphylococcus aureus, including methicillin-resistant strains(22). In a study carried out with
the human immunodeficiency virus (HIV), it was shown that nanoparticles prepared with a
melittin solution form small pore-like attack complexes, which can injure or break the
protective envelope of HIV-1, attacking a vital part of its structure(23).
In a study carried out with mice, the effect of this peptide was observed in injuries generated
in the biceps femoris muscle of the animals; the mice that received the melittin treatment had
less production of proinflammatory cytokines, an increase in the expression of biomarkers of
muscle regeneration, and a better locomotor activity compared to the positive control, which
received diclofenac; therefore, the authors suggest that melittin could serve as part of a
treatment for muscle lesions(24).
Phospholipase A2
It is the main immunogenic and allergenic component present in HBV; it is an enzyme with
a molecular weight of 19 kDa, made up of 134 amino acids. It is the second component with
the highest concentration in dry matter of HBV, and the second component in reported
biological activities; it is also one of the main allergenic components of HBV, causing high
allergic sensitivity(25). Phospholipases are enzymes that hydrolyze free and membrane-
associated phospholipids, converting them into fatty acids and other lipophilic substances,
leading to tissue injury and cell death by lysis; it also lowers blood pressure and inhibits
blood clotting(8,10).
This enzyme induces the synthesis of prostaglandins, which promotes inflammation(26). The
injection of phospholipase A2 intraperitoneally and subcutaneously in mice has been shown
to help prevent neurodegenerative diseases, such as Parkinson’s disease, because it has a
neuroprotective effect and contributes to regulating pathological manifestations(27,28). It has
been reported that this enzyme can cause lysis and prevent the proliferation of different
cancer cell lines, such as human kidney carcinoma (A498), human breast carcinoma (T-47D),
human prostate carcinoma (DU145), and human bronchial epithelial cell line (BEAS-2B), in
addition to stimulating monocyte-derived dendritic cells, cells with a fundamental role in the
immune response(29). Depending on its concentration and exposure time, phospholipase has
demonstrated bactericidal (at 2 h) and bacteriostatic (at 12 h) activity against Trypanosoma
brucei, Enterobacter cloacae, Escherichia coli, and Citrobacter freundii(30).
234
Apamin
It is the smallest neurotoxin in HBV; it is a peptide made up of 18 amino acids (Figure 3),
present only in HBV(13,14,18). It has neurotoxic action at the central and peripheral level, with
nerve cytotoxic and nociceptive effects due to its ability to cross the blood-brain barrier and
because it blocks potassium-dependent Ca2+ channels. In addition, it inhibits neuromuscular
transmission through the activation of M2 muscarinic inhibitory receptors in motor nerve
endings, an effect that could improve the control of muscle excitability in patients with
myotonic diseases, such as Parkinson’s disease(17,31).
In studies carried out on animal models, this peptide has been shown to protect dopaminergic
neurons(32). Another study demonstrated its anti-inflammatory activity in gouty arthritis(33);
its antioxidant, anti-apoptotic, and anti-inflammatory activity in acute kidney injuries has
also been demonstrated(34). The results position apamin as a component of interest for
research focused on the treatment of Parkinson’s disease, gouty arthritis, and problems
caused by acute kidney injury.
Figure 3: Amino acid composition of apamin(35)

𝐶𝑖𝑠 − 𝐴𝑠𝑛 − 𝐶𝑖𝑠 − 𝐿𝑖𝑠 − 𝐴𝑙𝑎 − 𝑃𝑟𝑜 − 𝐺𝑙𝑢 − 𝑇𝑟𝑒 − 𝐴𝑙𝑎 − 𝐿𝑒𝑢 − 𝐶𝑖𝑠 − 𝐴𝑙𝑎 − 𝐴𝑟𝑔 − 𝐴𝑟𝑔 − 𝐶𝑖𝑠
− 𝐺𝑙𝑛 − 𝐺𝑙𝑛 − 𝐻𝑖𝑠 − 𝑁𝐻2
Mast cell degranulating peptide (MCD peptide)
Also known as peptide 401, it is a peptide made up of 22 amino acids (Figure 4). It possesses
two antagonistic immune activities. In high amounts, it inhibits mast cell degranulation,
inhibiting the release of histamine, acting as a powerful anti-inflammatory agent; however,
at low concentrations, it has a powerful degranulating effect on mast cells, which causes the
release of histamine, which plays an important role in the inflammatory to allergic processes;
there is also release of autacoids, such as arachidonic acid derivatives, and serotonin. It is
most responsible for the erythema that appears at the site of the sting. In the central nervous
system, it acts as a neurotoxin with the ability to block potassium channels, and in the
cardiovascular system, it acts as a hypotensive agent(17,36,37).
Figure 4: Amino acid composition of mast cell degranulating peptide(38)

𝐼𝑙𝑒 − 𝐿𝑖𝑠 − 𝐶𝑖𝑠 − 𝐴𝑠𝑛 − 𝐶𝑖𝑠 − 𝐿𝑖𝑠 − 𝐴𝑟𝑔 − 𝐻𝑖𝑠 − 𝑉𝑎𝑙 − 𝐼𝑙𝑒 − 𝐿𝑖𝑠 − 𝑃𝑟𝑜 − 𝐻𝑖𝑠 − 𝐼𝑙𝑒 − 𝐶𝑖𝑠
− 𝐴𝑟𝑔 − 𝐿𝑖𝑠 − 𝐼𝑙𝑒 − 𝐶𝑖𝑠 − 𝐺𝑙𝑖 − 𝐿𝑖𝑠 − 𝐴𝑠𝑛 − 𝑁𝐻2
235
Secapin
Peptide composed of 25 amino acids (Figure 5), which exhibits antibacterial, antifungal,
antifibrinolytic, and anti-elastolytic biological activity(39,40). Its administration in mice causes
a hyperalgesic and edematous response, producing inflammation and pain(41).
Figure 5: Amino acid composition of secapin(42)

𝑇𝑖𝑟 − 𝐼𝑙𝑒 − 𝐼𝑙𝑒 − 𝐴𝑠𝑝 − 𝑉𝑎𝑙 − 𝑃𝑟𝑜 − 𝑃𝑟𝑜 − 𝐴𝑟𝑔 − 𝐶𝑖𝑠 − 𝑃𝑟𝑜 − 𝑃𝑟𝑜 − 𝐺𝑙𝑖 − 𝑆𝑒𝑟 − 𝐿𝑖𝑠 − 𝐹𝑒𝑛
− 𝐼𝑙𝑒 − 𝐿𝑖𝑠 − 𝐴𝑠𝑛 − 𝐴𝑟𝑔 − 𝐶𝑖𝑠 − 𝐴𝑟𝑔 − 𝑉𝑎𝑙 − 𝐼𝑙𝑒 − 𝑉𝑎𝑙 − 𝑃𝑟𝑜
Adolapin
Peptide made up of 103 amino acids; it is the only component that has been shown to possess
antinociceptive effects, in addition to a strong anti-inflammatory, antipyretic, and inhibitory
activity of phospholipase A2. Its properties are due to the fact that it inhibits the synthesis of
prostaglandins by inhibiting cyclooxygenase(10,17).
Hyaluronidase
Hyaluronidases are enzymes widely distributed in nature, normally involved in pathological

activities, such as the diffusion of toxins, inflammation, allergies, etc., and physiological
activities, such as fertilization, wound healing, embryogenesis, and angiogenesis. The
enzyme found in bee venom belongs to the EC group 3.2.1.35. It is the major allergen present
in the venom of honeybees, wasps, hornets, and scorpions, because it stimulates the systemic
anaphylactic response mediated by IgE.
It is an enzyme with a molecular weight ranging from 33 to 100 kDa, made up of 349 amino
acids, and is active at pH 4 to 6. It is considered a propagation factor because it hydrolyzes
the hyaluronic acid of the interstitium, causes dilation and an increase in the permeability of
blood vessels, increasing blood circulation, which facilitates the diffusion of the other
components of HBV, causing the spread of inflammation and the entry of pathogens found
at the site of the injury(8,26,43,44).
236
Biological amines
They are the main neurotransmitters present in HBV; they include histamine, dopamine, 5-
hydroxytryptamine, adrenaline, and noradrenaline. These components have inflammatory,
vasoactive properties, in addition to being associated with pain. The histamine present in the
HBV has the ability to increase capillary permeability, favoring the inflammatory response,
promotes smooth and skeletal muscle contraction, and is the first mediator of the
inflammatory cascade in anaphylactic shock(45,46). Catecholamines (noradrenaline and
dopamine) increase cardiac output, which helps to improve the distribution of HBV(17).
Other components
The presence of carbohydrates, proteins, volatile compounds, amines, and hormones, among
others, has been reported. Some authors consider the presence of carbohydrates in the HBV
as contamination caused by pollen and nectar at the time of collection(15). The presence of
the major royal jelly proteins PMJR8 and PMJR9 has been detected, and in addition to the
fact that they have a nutritional function, their glycosylation has the potential to cause IgE
sensitization in patients hypersensitive to HBV. The presence of more than 20 volatile
compounds has been identified, including isopentyl acetate and (Z)-11-eicosen-1-ol,
pheromones that serve bees to warn other members of the colony of danger and stimulate
stinging(16,17).
Therapeutic effect
In traditional and alternative medicine, HBV has been used for several years for various
therapeutic purposes in a complementary or alternative way to conventional medical
methods. Its application to reduce pain and swelling in persistent inflammatory problems,
such as rheumatoid arthritis or multiple sclerosis, and its use for bursitis, tendonitis, shingles,
and gout, among others, stand out(47,48). Its use is due to its chemical composition, made up
of a wide variety of pharmacologically active molecules. The techniques used for its
application vary from creams, liniment, unguents, ointments, and subcutaneous injections
into acupuncture points (diluted HBV), or through the direct sting of the live bee(6,27).
237
Anti-inflammatory effect
The best-known use of HBV is for the control of pain, edema, and inflammation in arthritis,
where it acts with an antinociceptive effect. Studies carried out with animals and that used a
model of induced arthritis have shown that the use of HBV reduces the presence of
inflammatory mediators, the clinical signs of arthritis (localized swelling), and does not cause
liver damage(49). In another study, it was reported that the use of HBV produces an anti-
inflammatory effect, in addition to presenting an effective response in the repair and
regeneration of tissues in joints(50). Kwon et al(51) conclude in their study that the application
of the HBV at specific acupuncture points produces an analgesic effect on pain caused by
arthritis significantly greater compared to the application at distant points. In an experiment
conducted directly with patients in which the HBV was applied to acupuncture points over a
period of 8 weeks, patients reported a decrease in joint tenderness and inflammation, and
morning stiffness(52).
The anti-inflammatory effect of HBV has also been analyzed in spinal cord injuries in animal
models. In a study conducted with Wistar rats subjected to spinal cord injury, researchers
reported improved locomotor performance and a decrease in injury size when the HBV was
applied to specific acupuncture points(53).
In atopic dermatitis or eczema, the use of a moisturizing emollient is one of the main
treatments; in a study carried out with 136 patients who were offered an emollient containing
HBV among its ingredients, a decrease in the area where eczema occurs and a decrease in
pain according to the visual analog scale were reported; improvements in patients were
mainly attributed to the anti-inflammatory activity of the HBV(54).
Anti-cancer application
Among the strategies used to control or cure cancer is the research of new drugs from natural
sources, such as plants or toxins from animals(55). HBV has been shown to have a potential
effect against different types of cancer because it inhibits the proliferation of cancer cells
through several cytotoxic mechanisms, such as the induction of apoptosis, necrosis, effects
on the inhibition of growth and proliferation of malignant cells, and alterations in the cell
cycle. It has also been observed that it can decrease the number of metastatic cells, most
likely due to the stimulation of the immune cellular response in lymph nodes(19).
Pancreatic cancer is one of the most aggressive and deadly types of cancer in people. In a
study conducted with pancreatic cancer cell lines, HBV suppressed cell proliferation through
238
cell cycle arrest, promoting apoptosis and inhibiting cancer cell migration; the results suggest
an antitumor effect of HBV against pancreatic cancer(56).
Glioblastoma is one of the most common malignant brain tumors; it has a poor prognosis,
with the possibility of resistance to therapy and a wide possibility of metastasis. A study
conducted with cell lines evaluated the effect of HBV on the expression and activity of the
matrix metalloprotein-2 because an increase in its expression and activity has been reported
in many types of cancer. The results obtained showed that HBV inhibits the viability of
glioblastoma cells through the induction of apoptosis, in addition to reducing the expression
of metalloproteins, suggesting that it may cause an inhibition in tumor metastasis(57).
Breast cancer is the most common malignant cancer in women around the world. For its
treatment and control, in vitro studies have been carried out with breast cancer cell lines,
where the components present in the HBV have demonstrated a cytotoxic effect on cell lines,
in addition to apoptotic effects, controlling metastasis and decreasing the viability of cancer
cells(58).
Antibacterial effect
Antibiotic resistance presented by the bacteria that cause infectious diseases has led to the
search for new alternatives to control them. In different studies, HBV has been shown to have
an antibacterial effect, positioning it as an option in research for the development of new
drugs against pathogenic bacteria. In in vitro studies, HBV was shown to be effective against
the causative agent of Lyme disease, the bacteria Borrelia burgdorferi(21). A similar response
was obtained when analyzing the effect of HBV against methicillin-resistant bacteria
Staphylococcus aureus, where a synergistic effect was also observed in combination with
oxacillin, an antibiotic used to control S. aureus(22). Its effect against different strains of the
bacteria Salmonella enterica and Listeria monocytogenes makes HBV a potential alternative
for the control of foodborne pathogens(59).
In another study, a significant effect on cell wall deformation was demonstrated in the
bacteria Escherichia coli, Pseudomonas putida, and Pseudomonas fluorescens, and the
researchers concluded that the mechanism of action of HBV against bacteria is cell wall
destruction, membrane permeability change, cell content leakage, inactivation of metabolic
activity, and cell death(60).
239
Effects on wound healing
Wound healing involves a tissue repair process involving different molecular and cellular
factors, starting with an inflammatory response, re-epithelialization, and ending with a
permanent scar. The anti-inflammatory, antimicrobial, analgesic, and antioxidant properties
present in HBV give it great potential to aid in healing processes. In a study with Wistar rats,
the authors tested the effect of 0.1 g of HBV diluted in 10 mL of saline solution on wounds
made in the oral mucosa of the rodents. The researchers concluded that HBV stimulated the
proliferation of epithelial cells, increasing re-epithelialization, improving wound closure, and
decreasing inflammation in the injured area(61). In another study also conducted with Wistar
rats, chitosan films with HBV were used, where the healing of wounds induced in the rodents
was satisfactory and rapid compared to the rats that did not receive treatment(62).
Despite the positive responses, most authors recommend further research on the use of HBV
to evaluate its efficacy in vivo, and safe and effective administration, before recommending
its direct use.
Adverse effects of HBV
It has been scientifically proven that the components present in the HBV can offer health
benefits to organisms; however, there are also reports of how its use can cause unfavorable
effects in individuals. Allergy to HBV is dangerous and can be deadly; depending on the
number of stings the individual receives, clinical manifestations can range from mild to
severe. Variables such as age, weight, diseases present in the individual and how quickly
medical attention is obtained also affect the response.
The main effects observed locally at the site where the stinger injured the skin are: pain,
swelling, pruritus, erythema, and urticaria(63). The reactions can decrease and disappear after
a long time of contact with HBV, a situation that occurs mainly in people who work directly
with insects, such as beekeepers; nonetheless, in individuals who overreact to a bee’s sting
and who also do not have continuous contact with the insect, one option to prevent moderate
to severe systemic reactions is venom immunotherapy. This treatment is used to improve
quality of life, as opposed to having the fear of a severe reaction or premature death caused
by a bee attack. Immunotherapy should always be performed by a health professional with
experience in the area(64,65).
240
In some cases, HBV can cause serious medical, immunological, and neurological
complications, and even death. A common complication is anaphylaxis(66). Anaphylaxis
occurs when the body is hypersensitive to HBV and is not dependent on the amount of
venom. It results from the release of inflammatory mediators, such as histamine, and occurs
after re-exposure to the antigen, such as proteins present in HBV, which act as specific
antigens and trigger early or late manifestations of hypersensitivity. Anaphylactic shock can
be divided into four categories: mucocutaneous, respiratory, cardiovascular, and
gastrointestinal reactions. Signs and symptoms that may occur most often in anaphylaxis
caused by HBV may include skin problems such as erythema, pruritus, hives, or angioedema;
the respiratory system such as laryngeal edema and bronchospasm; the cardiovascular system
such as myocardial depression, hypotension; and the gastrointestinal system with nausea,
vomiting, and incontinence(45,67).
Other types of reported complications, which are not so common, are: immune
thrombocytopenia(68), lymphedema(69), Guillain-Barré syndrome(70), optic neuropathy(71),
pontine and thalamic infarction(72), acute kidney injury(73), Wolff-Parkinson-White
syndrome(74), Kounis syndrome(75), pemphigus foliaceus(76), to name a few. These
complications are mainly due to the immunostimulatory action and the presence of multiple
protein allergens with enzymatic activity and IgE inducers present in the HBV(18).
According to Ali(6), the LD50% of the HBV is 2.8 mg per kilogram of weight. If it is
considered that a bee can inject 0.3 mg of venom, 560 bees would be needed to reach the
LD50% in an adult person with an average weight of 60 kg; however, the sensitivity to the
components in each organism can vary. The incidence of death due to bee stings is
approximately 0.03-0.48/1’000,000 individuals per year, and several risk factors are
associated, such as sex (men are three times more at risk than women), age (people over 40
yr of age are at greater risk, probably due to the greater presence of cardiovascular diseases),
and the place of the body where the bee stinged (the neck and head are the areas of greatest
problem)(64). Honeybees are social insects, therefore, the possibility of mass attacks occurring
when they are attacked is high. The most recommended way to avoid problems is prevention,
focusing mainly on minimizing exposure to attacks by avoiding places where the presence
of these insects is known(8).
Studies are currently being conducted on people to evaluate the dose and effectiveness of
drugs that counteract the different effects caused by bee stings. Although the study groups
have been small and tests and analyses are still ongoing, the responses to the drugs are
promising(17,77).
241
Conclusions
HBV is a defense mechanism that helps bees care for and protect their colony; the
components that make it up are a source of resources that can help against some pathologies;
nevertheless, it is always necessary to consider that each organism may respond differently
to the use of HBV and that reactions can range from moderate to lethal, so it is necessary to
carry out more studies on the use of HBV and its compounds in order to make better use of
them, and above all to avoid the possible adverse effects of its use on organisms. The use of
HBV, either directly or indirectly, should always be done with caution and under the
recommendation and support of a health professional with experience in the area.
Literature cited:
1. Atlas Nacional de las abejas y derivados apícolas (s.f.). La apicultura como actividad
económica. Secretaría de Agricultura y Desarrollo Rural. 2023. https://atlas-
abejas.agricultura.gob.mx/cap2.html .
2. SIAP. Servicio de Información Agroalimentaria y Pesquera. Información. Datos Abiertos.

Estadística de producción ganadera. 2023.
http://infosiap.siap.gob.mx/gobmx/datosAbiertos.php.
3. Asis M. Propóleo de origen Apis para primeros auxilios en veterinaria [Trabajo en

extenso]. 27° Congreso Internacional de Actualización Apícola. Ciudad de México,
México 2021.
4. COFEPRIS. 22 de marzo 2023. Aviso de Riesgo sobre el uso y consumo de apitoxina.

https://www.gob.mx/cms/uploads/attachment/file/810962/Aviso_de_Riesgo_Apitoxin
a_22032023.pdf.
5. Zlotkin E. The role of Hymenopterous venoms in nature. In: Mizrahi A, Lensky Y. editors.
Bee products. Springer, Boston, MA. 1997:185-201.
6. Ali M. Studies on bee venom and its medical uses. Int J Adv Res Technol 2012;1(2):1-15.
7. Faux CM. Honey bee anatomy. In: Kane TR, Faux CM editors. Honey bee medicine for
the veterinary parctitioner. Wiley Blackwell. 2021:33-40.
8. Roodt AR, Salomón OD, Orduna TA, Robles OLE, Paniagua SJF, Alargón CA.
Envenenamiento por picaduras de abeja. Gac Med Mex 2005;141(3):215-222.
9. Bachmayer H, Kreil G, Suchanek G. Synthesis of promelittin and melittin in the venom

gland of queen and worker bees: Patterns observed during maturation. J Insect Physiol
1972;18:1515-1521.
242
10. Okwesili FCN, Ogugua VN. Therapeutic effect of honey bee venom. J Phram Chem Biol
Sci 2016;4(1):48-53.
11. Pucca MB, Cerni FA, Oliveira IS, Jenkins TP, Argemi L, Sorensen CV, et al. Bee update:
Current knowledge on bee venom and bee envenoming therapy. Front Immunol
2019;10:2090.
12. Abdela N, Jilo K. Bee venom and its therapeutic values: A review. Adv Life Sci Technol
2016;44:18-22.
13. Kim W. Bee venom and its sub-components: Characterization, pharmacology, and
therapeutics. Toxins 2021;13(3):191.
14. Carpena M, Nuñez-Estevez B, Soria-Lopez A, Simal-Gandara J. Bee venom: an updating

review of its bioactive molecules and its health applications. Nutrients
2020;12(11):3360.
15. Nainu F, Masyita A, Bahar MA, Raihan M, Prova SR, Mitra S, et al. Pharmaceutical
prospects of bee products: special focus on anticancer, antibacterial, antiviral and
antiparasitic properties. Antibiotics 2021;10(7):82.
16. Schmidt JO, Morgan ED, Oldham NJ, Do Nascimento RR. (Z)-11-Eicosen-1-ol, A major
component of Apis cerana Venom. J Chem Ecol 1997;23(8):1929-1939.
17. Abd El-Wahed AA, Khalifa SAM, Sheikh BY, Farag MA, Saeed A, Larik FA, et al.
Chapter 13. Bee Venom Composition: From chemistry to biological activity. In: Atta-
ur-Rahman editor. Studies in natural products chemistry. Elsevier. 2019;60:459-484.
18. Wehbe R, Frangieh J, Rima M, El Obeid D, Sabatier J, Fajloun Z. Bee venom: overview
of main compounds and bioactivities for therapeutic interests. Molecules 2019;24:2997.
19. Rady I, Siddiqui IA, Rady M, Mukhtar H. Melittin, a major peptide component of bee
venom, and its conjugates in cancer therapy. Cancer Lett 2017;402:16-31.
20. Merck. (s.f.). Melittin from honey bee venom. Merck-Sigma Aldrich.
https://www.sigmaaldrich.com/MX/es/product/sigma/m2272. Accessed Oct 2, 2023
21. Socarras KM, Theophilus PA, Torres JP, Gupta K, Sapi E. Antimicrobial activity of bee
venom and melittin against Borrelia burgdorferi. Antibiotics 2017;6(4):31.
22. Marques PAF, Albano M, Bérgamo AFC, Murbach TABF, Furlanetto A, Mores RVL, et
al. Influence of apitoxin and melittin from Apis mellifera bee on Staphylococcus aureus
strains. Microb Pathog 2020;141:104011.
243
23. Hood JL, Jallouk AP, Campbell N, Ratner L, Wickline SA. Cytolytic nanoparticles
attenuate HIV-1 infectivity. Antivir Ther 2013;18:95-103.
24. Lee JE, Shah VK, Lee EJ, Oh MS, Choi JJ. Melittin – A bee venom component –
Enhances muscle regenation factors expression in a mouse model of skeletal muscle
contusion. J Pharmacol Sci 2019;140:26-32.
25. Lee G, Bae H. Bee venom phospolipase A2: Yesterday´s enemy becomes today´s friend.
Toxins 2016;8(2):48.
26. Hossen MS, Shapla UM, Gan SH, Khalil MI. Impact of bee venom enzymes on diseases
and immune response. Molecules 2016;22(1):25.
27. Baek H, Jang HI, Jeon HN, Bae H. Comparison of administration routes on the protective
effects of bee venom phospholipase A2 in a mouse model of Parkinson´s disease. Front
Aging Neurosci 2018;10:179.
28. Chung ES, Lee G, Lee C, Ye M, Chung HS, Kim H, et al. Bee venom phospholipase A2,
a novel Foxp3+ regulatory T cell inducer, protects dopaminergic neurons by modulating
neuroinflammatory responses in a mouse model of Parkinson’s disease. J Immunol
2015;195(10):4853-4860.
29. Prutz T, Ramoner P, Gander H, Rahm A, Bartsch G, Thurnher M. Antitumor action and
inmune activation through cooperation of bee venom secretory phospholipase A2 and
phosphatidylinositol-(3,4)-bisphosphate. Cancer Inmunol Inmunother 2006;55:1374-
1383.
30. Boutrin MCF, Foster HA, Pentreath VW. The effects of bee (Apis mellifera) venom
phospholipase A2 on Trypanosoma brucei brucei and enterobacteria. Exp Parasitol
2008;119:246-251.
31. Silva LFCM, Ramos ERP, Ambiel CR, Correia-de-Sá P, Alves-Do-Prado W. Apamin
reduces neuromuscular transmission by activating inhibitory muscarinic M2 receptors
on motor nerve terminals. Eur J Pharmacol 2010;629:239-243.
32. Alvarez-Fischer D, Noelker C, Vulinović F, Grünewald A, Chevarin C, Klein C, et al.

Bee venom and its component apamin as neuroprotective agents in a Parkinson disease
mouse model. PLoS One 2013;8(4):e61700.
33. Lee YM, Cho SN, Son E, Song CH, Kim DS. Apamin from bee venom suppresses
inflammation in a murine model of gouty arthritis. J Ethnopharmacol 2020;257:112860.
34. Kim JY, Leem J, Park KK. Antioxidative, antiapoptotic, and anti-inflammatory effects
of apamin in murine model of lipopolysaccharide-induced acute kidney injury.
Molecules 2020;25(23):5717.
244
35. Merck. (s.f.). Apamin. Merck-Sigma Aldrich..

https://www.sigmaaldrich.com/MX/es/product/sigma/a1289. Accessed Oct 2, 2023
36. Banks BEC, Dempsey CE, Vernon CA, Warner JA, Yamey J. Anti-inflammatory activity
of bee venom peptide 401 (mast cell degranulating peptide) and compound 48/80 results
from mast cell degranulation in vivo. Br J Pharmacol 1990;99(2):350-354.
37. Reza ZM, Russek S, Hsuei-Chin W, Beer B, Blume AJ. Mast cell degranulating peptide:
A multi-functional neurotoxin. J Pharm Pharmacol 1990;42(7):457-461.
38. Gauldie J, Hanson JM, Shipolimi A, Vernon CA. The structures of some peptides from
bee venom. Eur J Biochem 1978;83(2):405-410.
39. Lee KS, Kim BY, Yoon HJ, Choi YS, Jin BR. Secapin, a bee venom peptide, exhibits
anti-fibrinolytic, anti-elastolytic, and anti-microbial activities. Dev Comp Immunol
2016;63:27-35.
40. Hou C, Guo L, Lin J, You L, Wu W. Production of antibacterial peptide from bee venom
via a new strategy for heterologous expression. Mol Biol Rep 2014;41(12):8081-8091.
41. Mourelle D, Brigatte P, Bringanti LDB, De-Souza BM, Arcuri HA, Gomes PC, et al.
Hyperalgesic and edematogenic effects of Secapin-2, a peptide isolated from africanized
honeybee (Apis mellifera) venom. Peptides 2014;59:42-52.
42. Vlasak R, Kreil G. Nucleotide sequence of cloned cDNAs coding for preprosecapin, a
major product of queen-bee venom glands. Eur J Biochem 1984;145(2):279-282.
43. Bordon KCF, Wiezel GA, Amorim FG, Arantes EC. Arthropod venom hyaluronidases:
biochemical properties and potential applications in medicine and biotechnology. J
Venom Anim Toxins Incl Trop Dis 2015;21:43.
44. Abdel-Monsef MM, Zidan HA, Darwish DA, Masoud HM, Helmy MS, Ibrahim MA.
Biochemical isolation and characterization of hyaluronidase enzyme from venom of
Egyptian honey bee Apis mellifera Lamarckii. J Apic Sci 2020;64(1):153-164.
45. Contreras ZE, Zuluaga SX, Casas QIC. Envenenamiento por múltiples picaduras de
abejas y choque anafiláctico secundario: Descripción de un caso clínico y revisión de
literatura. Acta Toxicol Argent 2008;16(2):27-32.
46. Zhang W, Wang X, Yang S, Niu Q, Wu L, Li Y, et al. Simultaneous quantification of

five biogenic amines based on LC-MS/MS and its application in honeybee venom from
different subspecies. Biomed Chromatogr 2020;34(2):e4740.
47. Chen J, Larivieri WR. The nociceptive and anti-nociceptive effects of bee venom
injection and therapy: a double-edged sword. Prog Neurobiol 2010;92(2):151-183.
245
48. Ebrahimi Y, Ramírez-Coronel AA, Al-Dhalimy AMB, Alfilm RHC, Al-Hassan M.,
Obaid RF, et al. Effects of honey and bee venom on human health. Casp J Environ Sci
2023;21(1):245-249.
49. Tekeoğlu I, Akdoğan M, Çelik I. Investigation of anti-inflamatory effects of bee venom

in experimentally induced adjuvant arthritis. Reumatologia 2020;58(5): 265-271.
50. Da-Silva MFM, Rondon WP, Costa BFR, Da-Silva MMJM. Ultrasound wave transports
apitoxin in arthritic joint. – Experimental study. Res Soc Dev
2022;11(7):e53311730386.
51. Kwon YB, Lee JD, Lee HJ, Han HJ, Mar WC, Kang SK, et al. Bee venom injection into
an acupuncture point reduces arthritis associated edema and nociceptive responses. Pain
2001;90(3):271-280.
52. Lee SH, Hong SJ, Kim SY, Yang HI, Lee JD, Choi DY, Lee DI, Lee YH. Randomized
controlled double blind study of bee venom therapy on rheumatoid arthritis. J Kor Acu
Mox Soc 2003;20(6):80-88.
53. Nascimento de Souza R, Silva FK, Alves de Medeiros M. Bee Venom acupuncture
reduces interlukin-6, increases interleukin 10 and induced locomotor recovery in a
model spinal cord compression. J Acupunct Meridian Stud 2017;10(3):204-210.
54. You CE, Moon SH, Lee KH, Kim KH, Park CW, Seo AJ, et al. Effects of emollient
containing bee venom on atopic dermatitis: A double-blinded, randomized, base-
controlled, multicenter study of 136 patients. Ann Dermatol 2016;28(5):593-599.
55. Moga MA, Dimienescu OG, Arvătescu CA. Anticancer activity of toxins from bee and
snake venom-an overview on ovarian cancer. Molecules 2018;23(3):692.
56. Zhao J, Hu W, Zhang Z, Zhou Z, Duan J, Dong Z, et al. Bee venom protects against
pancreatic cancer via inducing cell cycle arrest and apoptosis with suppression of cell
migration. J Gastrointest Oncol 2022;13(2):847-858.
57. Sisakht M, Mashkani B, Bazi A, Ostadi H, Zare M, Avval FZ, et al. Bee venom induces
apoptosis and suppresses matrix metaloprotease-2 expression in human glioblastoma
cells. Rev Bras Pharmacog 2017;27(3):324-328.
58. Kwon NY, Sung SH, Sung HK, Park JK. Anticancer activity of bee venom components
against breast cancer. Toxins 2022;14(7):460.
59. Lamas A, Arteaga V, Regal P, Vázquez B, Miranda JM, Cepeda A, et al. Antimicrobial
activity of five apitoxins from Apis mellifera on two common foodborne pathogens.
Antibiotics (Basel) 2020;9(7):367.
246
60. Haktanir I, Masoura M, Mantzouridou FT, Gkatzionis K. Mechanism of antimicrobial

activity of honeybee (Apis mellifera) venom on Gram-negative bacteria: Escherichia
coli and Pseudomonas spp. AMB Express 2021;11(1):54.
61. Shalaby LS, Salama AH, Shawkat SM, Fares AE, Hegazi AG. Comparison of the healing
potential of propolis and bee venom on surgically induced wound in rat´s buccal mucosa.
Int J Adv Res 2018;6(3):1268-1275.
62. Amin MA, Abdel-Raheem IT, Madkor HR. Wound healing and anti-inflammatory
activities of bee venom-chitosan blend films. J Drug SCI Tech 2008;18(6):424-430.
63. Rosman Y, Nashef F, Cohen-Engler A, Meir-Shafrir K, Lachover-Roth I, Confino-Cohen

R. Exclusive bee venom allergy: risk factors and outcome of immunotherapy. Int Arch
Allergy Immunol 2019;180(2):128-134.
64. Antonicelli L, Bilò MB, Bonifazi F. Epidemiology of Hymenoptera allergy. Curr Opin
Allergy Clin Immunol 2002;2(4):341-346.
65. Sturm GJ, Varga EM, Roberts G, Mosbech H, Biló MB, Akdis CA, et al. EAACI
guidelines on allergen immunotherapy: Hymenoptera venom allergy. Allergy
2018;73(4):744-764.
66. Hizli DZ, Yücel E, Sipahi CS, Süleyman A, Özdemir C, Kara A, et al. Venom allergy
and knowledge about anaphylaxis among beekeepers and their families. Allergol
Immunopathol 2020;48(6):640-645.
67. Valderrama HR. Aspectos toxinológicos y biomédicos del veneno de las abejas Apis
mellifera. Iatreia 2003;16(3):217-227.
68. Abdulsalam MA, Ebrahim BE, Abdulsalam AJ. Inmune thrombocytopenia after bee
venom therapy: a case report. BMC Complement Altern Med 2016;16:107.
69. Seo YJ, Jeong YS, Park HS, Park SW, Choi JY, Jung KJ, et al. Late-Onset post-radiation
lymphedema provoked by bee venom therapy: A case report. Ann Rehabil Med
2018;42(4): 626-629.
70. Lee HJ, Park IS, Lee JI, Kim JS. Guillain-Barré syndrome following bee venom
acupuncture. Intern Med 2015;54(8):975-978.
71. Maltzman JS, Lee AG, Miller NR. Optic neuropathy occurring after bee and wasp sting.
Ophthalmology 2000;107(1):193-195.
72. Huh SY, Yoo BG, Kim MJ, Kim JK, Kim KS. Cerebral infarction after honey bee venom
acupuncture. J Korean Geriatr Soc 2008;12(1):50-52.
247
73. Silva GBD, Vasconcelos AG, Rocha AMT, Vasconcelos VR, Barros JN, Fujishima JS,
et al. Acute kidney injury complicating bee stings - a review. Rev Inst Med Trop São
Paulo 2017;59:e25.
74. Santhosh MSR, Viswanathan S, Kumar S. The bee sting related Wolff-Parkinson-White
syndrome. J Clin Diagn Res 2012;6(9):1541-1543.
75. Gopinath B, Kumar G, Nayaka R, Ekka M. Kounis syndrome and atrial fibrillation after
bee sting: a case report. J Family Med Prim Care 2022;11(11):7460-7462.
76. Yoo SA, Park HE, Kim M. A case of newly developed pemphigus foliaceus and possible
association with alternative bee-venom therapy. Ann Dermatol 2021;33(5):467-469.
77. Barbosa AN, Ferreira RS, de Carvalho FCT, Schuelter-Trevisol F, Mendes MB,
Mendonça BC, et al. Single-arm, multicenter phase I/II clinical trial for the treatment of
envenomings by massive africanized honey bee stings using the unique apilic
antivenom. Front Immunol 2021;12:653151.
248
Revista Mexicana de Ciencias Pecuarias
Edición Bilingüe
Rev. Mex. Cienc. Pecu. Vol. 15 Núm. 1, pp. 1-248, ENERO-MARZO-2024 Bilingual Edition
ISSN: 2448-6698
CONTENIDO
CONTENTS
ARTÍCULOS / ARTICLES Pags.

Generación de nuevas ecuaciones para estimar la biomasa aérea a partir de variables
morfológicas obtenidas de pastos en agostaderos de Nuevo León, México
Generation of new equations to estimate aerial biomass based on morphological variables obtained from grasses in rangelands of Nuevo León, Mexico
Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 15 Núm. 1, pp. 1-248, ENERO-MARZO-2024
Juan Emmanuel Segura Carmona, José Israel Yerena Yamallel, Hugo Bernal Barragán, Eduardo Alanís Rodríguez, Luis Gerardo Cuéllar Rodríguez, Javier Jiménez Pérez..........…..........…...................….........1
Índice de área foliar e indicadores de productividad forrajera de Lotus corniculatus L.

en diferentes contenidos de humedad del suelo y estaciones del año
Leaf area index and forage productivity indicators of Lotus corniculatus L. at different soil moisture contents and seasons of the year
Aurelio Pedroza Sandoval, Sahara Xolocotzi Acoltzi, Ricardo Trejo Calzada, Gabino García de los Santos, Perpetuo Álvarez Vázquez, Jesús Guadalupe Arreola Ávila..............................................................17
Microsilages elephant grass BRS Capiaçu added with commercial microbial consortium on different days of regrowth
Microensilados de pasto elefante BRS Capiaçu adicionados con consorcio microbiano comercial en diferentes días de rebrote
Allan Stênio da Silva Santos, Daniel Louçana da Costa Araújo, Ivone Rodrigues da Silva, Matheus Sousa Araújo, Arnaud Azevêdo Alves,
Henrique Nunes Parente, Maria Elizabete de Oliveira, João Ba�sta Lopes.......................................................................................................................................................................................................……. 32
Agronomic performance of palisade grass under different doses of liquid blood waste and chemical composition of soil
Comportamiento agronómico del pasto insurgente bajo diferentes dosis de residuos sanguíneos líquidos y composición química del suelo
Marcello Hungria Rodrigues, Clarice Backes, Alessandro José Marques Santos, Lucas Matheus Rodrigues, Arthur Gabriel Teodoro, Cinthya Cris�na Fernandes de Resende,
Adriana Aparecida Ribon, Pedro Rogerio Giongo, Patrick Bezerra Fernandes, Ana Beatriz Graciano da Costa..............….....……...................…….....…….....…….....…….....…...............…….....................................49
Efecto de aceites esenciales sobre la producción de metano en la fermentación in vitro de pasto llanero
Effect of essential oils on the production of methane in the in vitro fermentation of Koronivia grass
Paulino Sánchez-Santillán, Luis Antonio Saavedra-Jiménez, Nicolás Torres-Salado, Jerónimo Herrera-Pérez, Marco Antonio Ayala-Monter......................................................................….…..69
Effect of the administration of intraruminal selenium boluses in goat kids on biomarkers of oxidative stress in plasma
Efecto de la administración de bolos intrarruminales de selenio en cabritos sobre biomarcadores de estrés oxidativo en plasma
Gabriela Rodríguez Pa�ño, Víctor Manuel Díaz Sánchez, J. Efrén Ramírez Bribiesca, Arturo Aguirre Gómez, Alma Luisa Revilla Vázquez,
Patricia Ramírez Noguera, Jorge Luis Tórtora Pérez, Raquel López Arellano.………………………………………………………….…….……………….…………….…………….…………….…………........................................................... 83
Prevalencia e intensidad de varroosis y nosemosis de las abejas melíferas (Apis mellifera) en seis regiones del estado de Jalisco, México
Prevalence and intensity of varroosis and nosemosis of honey bees (Apis mellifera) in six regions of the state of Jalisco, Mexico
Ana K. Ramos-Cuellar, Álvaro De la Mora, Francisca Contreras-Escareño, Nuria Morfin, José M. Tapia-González, José O. Macías-Macías,
Ta�ana Petukhova, Adriana Correa-Benítez, Ernesto Guzman-Novoa............................................................................................................................................................................................................…...... 98
Relación entre el desarrollo corporal y la respuesta reproductiva de vaquillas a protocolos de sincronización

de estros en el sistema lechero de pequeña escala
Relationship between body development and reproductive response of heifers to estrus synchronization protocols in the small-scale dairy system
Eliab Estrada-Cortés, Fernando Villaseñor-González, Héctor Raymundo Vera-Ávila, Héctor Jiménez- Severiano, Eugenio Villagómez-Amezcua Manjarrez, Mario Alfredo Espinosa-Mar�nez....….......….....115
The effect of age, sex and postmortem aging on meat quality traits and biochemical profile of different muscles from Brangus cattle
El efecto de la edad, el sexo y la maduración post mortem sobre la calidad de la carne y el perfil bioquímico de músculos de bovinos Brangus
Julieta Fernández Madero, Laura Pouzo, Darío Pighín, Jorge Alejandro Navarro, Fernando Ailán, César Federico Guzmán, Enrique Paván…..…..…….…….…….….......................................…..……..…..……..….....130
Construcción y validación de cuestionarios para evaluar el riesgo de los antibióticos veterinarios

en el consumo de huevo e impacto en la seguridad alimentaria
Construction and validation of questionnaires to assess the risk of veterinary antibiotics in egg consumption and their impact on food safety
Eriberto Joel Tejada Rodríguez, Andrea Arreguín.........................................................……..…..…......…......…..........…..........….........…..........….........…..........….........…..........….......…..........…..................….……….. 149
Estudio del impacto de las ganaderías de bovino de lidia en la dehesa española

José Manuel Sanes, Juan Seva, María Jesús Gamón, Inmaculada Torrego, Eliana Abellán…………........……....……....……....……....……....……....……....……....……....……....……....……....……....……....……....…….........…176
Análisis in silico de genes diana de miRNAs posiblemente inducidos por la infección con tuberculosis
In silico analysis of miRNA target genes possibly induced by tuberculosis infection
Elba Rodríguez-Hernández, Laura Itzel Quintas-Granados, Feliciano Milian Suazo, Ana María Anaya Escalera....................…...........….........….........….........….........….........….........….........….........….....……....... 192
NOTAS DE INVESTIGACIÓN / TECHNICAL NOTES
El sistema alfalfilla-Sinorhizobium meliloti como interacción útil para la fijación de nitrógeno y mejorador de suelo. Revisión
The sweet clover-Sinorhizobium meliloti system as a useful interaction for nitrogen fixation and as a soil improver. Review
Gabriel Gallegos Morales, Omar Jiménez Pérez, Juan Manuel Sánchez Yañes, Perpetuo Álvarez Vázquez, Francisco Cas�llo Cas�llo.……....……....…………....…………....…………....…………....….……....…….........…208
Principales componentes bioactivos y propiedades terapéuticas del veneno de abeja (Apis mellifera L.). Revisión
Main bioactive components and therapeutic properties of bee (Apis mellifera L.) venom. Review
Karla Itzél Alcalá-Escamilla, Yolanda Beatriz Moguel-Ordóñez.....…...........….........….........….........…........….......….......….......….......….......….......….......….......….........….........….........….........….........….....……....... 230
Rev. Mex. Cienc. Pecu. Vol. 15 Núm. 1, pp. 1-248, ENERO-MARZO-2024

RMCP Vol. 15 Num. 1 (2024) : January-March (English Version)

Cargado por

Información del documento

Derechos de autor

Formatos disponibles

Compartir este documento

Compartir o incrustar documentos

Opciones para compartir

¿Le pareció útil este documento?

¿Este contenido es inapropiado?

Copyright:

Formatos disponibles

RMCP Vol. 15 Num. 1 (2024) : January-March (English Version)

Cargado por

Copyright:

Formatos disponibles

Edición Bilingüe

Rev. Mex. Cienc. Pecu. Vol. 15 Núm. 1, pp. 1-248, ENERO-MARZO-2024

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

VISITE NUESTRA PÁGINA EN INTERNET

REV. MEX. CIENC. PECU. VOL. 15 No. 1 ENERO-MARZO-2024

Generación de nuevas ecuaciones para estimar la biomasa aérea a partir de variables

Índice de área foliar e indicadores de productividad forrajera de Lotus corniculatus L.

Effect of the administration of intraruminal selenium boluses in goat kids on

Prevalencia e intensidad de varroosis y nosemosis de las abejas melíferas ( Apis

Relación entre el desarrollo corporal y la respuesta reproductiva de vaquillas a

Construcción y validación de cuestionarios para evaluar el riesgo de los antibióticos

Estudio del impacto de las ganaderías de bovino de lidia en la dehesa española

El sistema alfalfilla-Sinorhizobium meliloti como interacción útil para la fijación de

Principales componentes bioactivos y propiedades terapéuticas del veneno de abeja

INSTRUCTIONS FOR AUTHORS

Revista Mexicana de Ciencias Pecuarias is a scientific Title page

VIII) Steel RGD, Torrie JH. Principles and procedures of

Generation of new equations to estimate aerial biomass based on

Juan Emmanuel Segura Carmonaa

José Israel Yerena Yamallel a*

Hugo Bernal Barragán b

Eduardo Alanís Rodríguez a

Luis Gerardo Cuéllar Rodríguez a

Javier Jiménez Pérez a

* Corresponding author: israel.yerena@gmail.com

Keywords: Allometric equations, Cenchrus ciliaris, Native grasses, Compressed diameter.

Material and methods

A total of 19 independent variables (aerial diameter, basal diameter, compressed diameter,

AER= aerial; MAX= maximum.

Figure 2: Regression of predicted values and observed values

Table 2: General and specific allometric equations generated based on morphological

I Y= 0.9648 + 0.0026CON5 0.77 10.1 0.88 0.64 3469

II Y= 2.5343 + 0.0027CON5 + 0.0139CYL3 - 0.0295CACOV 0.87 7.8 0.93 0.49 3108

IV Y= 0.1213 * Cd1.6818 0.86 0.4 0.88 0.67 3530

V Y= 0.4473 * CYL30.7288 0.89 0.4 0.88 0.68 3553

VI Y= 0.8084 * CYL50.7078 0.90 0.4 0.88 0.67 3530

A.p. Y= -0.6641 + 0.1138CYL5 + 0.1257Ad + 0.0046CON2 - 0.92 1.5 0.96 0.27 87

An indirect estimation methodology implemented for grass species in Western Europe(21)

The development of allometric equations with application in rangelands is of utmost

Conclusions and implications

The importance of 19 variables related to the morphological characteristics of grasses present

6. Mundava C, Helmholz P, Schut T, Corner R, McAtee B, Lamb D. Evaluation of vegetation

7. Grüner E, Astor T, Wachendorf M. Biomass prediction of heterogeneous temperate

10. Fernández HH. Estimación de la disponibilidad de pasto. Cuadernillo clásico de forrajeras

17. Xu K, Su Y, Liu J, Hu T, Jin S, et al. Estimation of degraded grassland aboveground

18. Viljanen N, Honkavaara E, Näsi R, Hakala T, Niemeläinen O, Kaivosoja J. A novel

19- Marroquín-Castillo JJ, Alanís-Rodríguez E, Jiménez-Peréz J, Aguirre-Calderón O, Mata-

21. Pottier J, Jabot F. Non-destructive biomass estimation of herbaceous plant individuals: a

25. Sorensen GE, Wester DB, Rideout-Hanzak S. A nondestructive method to estimate

26. INEGI. Instituto Nacional de Estadística y Geografía. Prontuario de información

31. Siller-Clavel P, Badano EI, Villarreal-Guerrero F, Prieto-Amparán JA, Pinedo-Álvarez,

33. Soto-Bravo F, González-Lutz MI. Análisis de métodos estadísticos para evaluar el

36. INIFAP (Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias). Ajuste

Leaf area index and forage productivity indicators of Lotus corniculatus

Aurelio Pedroza Sandoval a

*Corresponding author: xolocotzi18@gmail.com

Material and methods

Geographical location of the study area

Experimental design and management

%𝑆𝑀 = 26.57 + 13.52x + 4.97X 2

255301 France Semi-erect

255305- Italy Semi-erect

202700 Uruguay Erect

226792 Canada Semi-erect