RMCP Vol. 10, Num. 2 (2019): April-June [english version] by Revista Mexicana de Ciencias Pecuarias

Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 10 Núm. 2, pp. 267-521, ABRIL-JUNIO-2019

ISSN: 2448-6698

CONTENIDO CONTENTS Pags. Replacement of alfalfa with Tithonia diversifolia in lambs fed sugar cane silage-based diets and rice polishing Evaluación de dos aceites acidulados de soya en la producción y calidad de huevo en gallinas Bovans

Evaluation of two soybean soapstocks in egg production and quality in Bovans hens Jennifer Pérez Mar�nez, Juan Manuel Cuca García, Gustavo Ramírez Valverde, Silvia Carrillo Domínguez, Arturo Pro Mar�nez, Ernesto Ávila González, Eliseo Sosa Montes............283

Fermentación ruminal y producción de metano usando la técnica de gas in vitro en forrajes de un sistema silvopastoril de ovinos de Chiapas, México

Quantifying ruminal fermentation and methane production using the in vitro gas technique in the forages of a sheep silvopastoral system in Chiapas, Mexico Ángel Jiménez-San�ago, Guillermo Jiménez-Ferrer, Armando Alayón-Gamboa, Esaú de Jesús Pérez-Luna, Ángel Trinidad Piñeiro-Vázquez, Samuel Albores-Moreno, Ma. Guadalupe Pérez-Escobar, Ricardo Castro-Chan.................................................................................................................................................................298

Evaluation of nutritional methods to reactivate preserved ruminal inoculum assessed through in vitro fermentation kinetics and forage digestibility

Evaluación de métodos nutricionales para reactivar inóculo ruminal preservado analizado a través de cinética de fermentación y digestibilidad de forrajes in vitro María G. Domínguez-Ordóñez, Luis A. Miranda-Romero, Pedro A. Mar�nez-Hernández, Maximino Huerta-Bravo, Ezequias Cas�llo-Lopez.................................................................315

Productive and economic response to partial replacement of cracked maize ears with ground maize or molasses in supplements for dual-purpose cows

Respuesta productiva y económica del reemplazo parcial de mazorca de maíz quebrado con maíz molido o melaza para vacas de doble propósito Isela G. Salas-Reyes, Carlos M. Arriaga-Jordán, Julieta G. Estrada-Flores, Anastacio García-Mar�nez, Rolando Rojo-Rubio, José F. Vázquez Armijo, Benito Albarrán-Por�llo.............335

Rendimiento de alfalfa (Medicago sativa L.) a diferentes edades de la pradera y frecuencias de defoliación

Alfalfa (Medicago sativa L.) biomass yield at different pasture ages and cutting frequencies José Alfredo Gaytán Valencia, Rigoberto Castro Rivera, Yuri Villegas Aparicio, Gisela Aguilar Benítez, María Myrna Solís Oba, José Cruz Carrillo Rodríguez, Luís Octavio Negrete Sánchez.......................................................................................................................................................353

Propiedades tecnológicas y fisicoquímicas de la leche y características fisicoquímicas del queso Oaxaca tradicional

Technological and physicochemical properties of milk and physicochemical aspects of traditional Oaxaca cheese Eric Montes de Oca-Flores, Angélica Espinoza-Ortega, Carlos Manuel Arriaga-Jordán.....................................................................................................................................................367

Evaluación de las condiciones de bienestar animal de camélidos sudamericanos ingresados al camal municipal de Huancavelica, Perú

Evaluation of animal welfare conditions of South American camelids admitted to the Huancavelica municipal slaughterhouse, Peru Carlos Eduardo Smith Davila, Galy Juana Mendoza Torres, Claudio Gustavo Barbeito, Marcelo Daniel Ghezzi...............................................................................................................379

REVISION DE LITERATURA Ácidos hidroxicinámicos en producción animal: farmacocinética, farmacodinamia y sus efectos como promotor de crecimiento. Revisión

Hydroxycinnamic acids in animal production: pharmacokinetics, pharmacodynamics and growth promoting effects. Review Edgar Fernando Peña-Torres, Humberto González-Ríos Leonel Avendaño-Reyes, Nidia Vanessa Valenzuela-Grijalva, Araceli Pinelli-Saavedra, Adriana Muhlia-Almazán, Etna Aida Peña-Ramos..............................................................................................................................................................................................................391

Efecto de la radiación ultravioleta (UV) en animales domésticos. Revisión

Effects of ultraviolet radiation (UV) in domestic animals. Review Maricela Olarte Saucedo, Sergio Hugo Sánchez Rodríguez, Carlos Fernando Aréchiga Flores, Rómulo Bañuelos Valenzuela, María Argelia López Luna..............................................416

Estrés oxidativo y el uso de antioxidantes en la producción in vitro de embriones mamíferos. Revisión

Oxidative stress and antioxidant use during in vitro mammal embryo production. Review Viviana Torres-Osorio, Rodrigo Urrego, José Julián Echeverri-Zuluaga, Albeiro López-Herrera........................................................................................................................................433

NOTAS DE INVESTIGACIÓN DL-malic acid supplementation improves the carcass characteristics of finishing Pelibuey lambs

La suplementación con DL-ácido málico mejora las características de la canal de borregos Pelibuey en finalización José Lenin Loya-Olguin, Fidel Ávila Ramos, Sergio Mar�nez Gonzalez, Iván Adrián García Galicia, Alma Delia Alarcón Rojo, Francisco Escalera Valente ..........................................460

Prediction of carcass characteristics of discarded Pelibuey ewes by ultrasound measurements

Predicción de las características de la canal en ovejas Pelibuey de desecho por medio de ultrasonido Alfonso J. Chay-Canul, Juan José Pineda-Rodriguez, Jaime Olivares-Pérez, Francisco G. Ríos-Rincón, Ricardo García-Herrera, Ángel T. Piñeiro-Vázquez, Fernando Casanova-Lugo.473

Estudio de asociación genómica para resistencia a Cooperia punctata en bovinos cruzados en el trópico subhúmedo de México

Genome association with Cooperia punctata resistance in crossbreed cattle in the sub-humid tropics of Mexico Adriana García-Ruíz, Felipe de Jesús Ruíz-López, Miguel Alonso-Díaz, Elke Von-Son-de-Fernex, Sara Olazarán-Jenkins, Vicente Eliezer Vega-Murillo, Maria Eugenia López-Arellano..........................................................................................................................................................................................482

Similarity in plant species consumed by goat flocks in the tropical dry forest of the Cañada, Oaxaca

Similitud de especies de plantas consumidas por rebaños de cabras en el bosque tropical seco de la Cañada, Oaxaca Salvador Mandujano, Ariana Barrera-Salazar, Antonio Vergara-Castrejón......................................................................................................................................................................490

Evidencia serológica de infección por herpesvirus caprino tipo 1 en cabras en México

Serological evidence of caprine herpesvirus type 1 infection in goats in Mexico Montserrat E. García-Hernández, Rosa E. Sarmiento-Silva, Liliana M. Valdés-Vázquez, Laura Cobos-Marín.................................................................................................................506

Análisis de la presencia de Rotavirus en conejos del Estado de México

Analysis of rotavirus in rabbits in the State of Mexico Emmanuel Reynoso Utrera, Linda Guiliana Bau�sta Gómez, José Simón Mar�nez Castañeda, Camilo Romero Núñez, Virginia Guadalupe García Rubio, Gabriela López Aguado Almazán, Pedro Abel Hernández García, Enrique Espinosa Ayala............................................................................................................................................511

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 10 Núm. 2, pp. 267-521, ABRIL-JUNIO-2019

Reemplazo de alfalfa con Tithonia diversifolia en corderos alimentados con ensilado de caña de azúcar y pulidura de arroz Esteban Vega Granados, Leonor Sanginés García, Agapito Gómez Gurrola, Antonio Hernández-Ballesteros, Lourdes Solano, Francisco Escalera-Valente, José Lenin Loya-Olguin.....267

Rev. Mex. Cienc. Pecu. Vol. 10 Núm. 2, pp. 267-521, ABRIL-JUNIO-2019

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 10 Número 2, AbrilJunio, 2019. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 04-2016-060913393200-203. ISSN: 2448-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en abril de 2019. Cunicultura en la región sur-oriente del Estado de México. Fotografía tomada por: Coordinación de Investigación y Estudios Avanzados. CU UAEM Amecameca

DIRECTORIO FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITOR EN JEFE Arturo García Fraustro

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, México Dra. Maria Cristina Schneider, PAHO, Estados Unidos Dra. Elisa Margarita Rubí Chávez, UNAM, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dr. Martin Talavera Rojas, Universidad Autónoma del Estado de México, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dra. Silvia Elena Buntinx Dios, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México. Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México. Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México. Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México. Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México.

TIPOGRAFÍA Y FORMATO Nora del Rocío Alfaro Gómez Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria. Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados. Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

total por publicar es de $ 5,600.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx. La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research. The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products. All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 325.00 per article in both printed languages.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

REVISTA MEXICANA DE CIENCIAS PECUARIAS REV. MEX. CIENC. PECU.

VOL. 10 No. 2

ABRIL-JUNIO-2019

CONTENIDO ARTÍCULOS

Pág. Replacement of alfalfa with Tithonia diversifolia in lambs fed sugar cane silage-based diets and rice polishing Reemplazo de alfalfa con Tithonia diversifolia en corderos alimentados con ensilado de caña de azúcar y pulidura de arroz Esteban Vega Granados, Leonor Sanginés García, Agapito Gómez Gurrola, Antonio HernándezBallesteros, Lourdes Solano, Francisco Escalera-Valente, José Lenin Loya-Olguin .......................... 267

Evaluación de dos aceites acidulados de soya en la producción y calidad de huevo en gallinas Bovans Evaluation of two soybean soapstocks in egg production and quality in Bovans hens

Jennifer Pérez Martínez, Juan Manuel Cuca García, Gustavo Ramírez Valverde, Silvia Carrillo Domínguez, Arturo Pro Martínez, Ernesto Ávila González, Eliseo Sosa Montes ................................ 283

Fermentación ruminal y producción de metano usando la técnica de gas in vitro en forrajes de un sistema silvopastoril de ovinos de Chiapas, México Quantifying ruminal fermentation and methane production using the in vitro gas technique in the forages of a sheep silvopastoral system in Chiapas, Mexico Ángel Jiménez-Santiago, Guillermo Jiménez-Ferrer, Armando Alayón-Gamboa, Esaú de Jesús PérezLuna, Ángel Trinidad Piñeiro-Vázquez, Samuel Albores-Moreno, Ma. Guadalupe Pérez-Escobar, Ricardo Castro-Chan ......................................................................................................................... 298

Evaluation of nutritional methods to reactivate preserved ruminal inoculum assessed through in vitro fermentation kinetics and forage digestibility Evaluación de métodos nutricionales para reactivar inóculo ruminal preservado analizado a través de cinética de fermentación y digestibilidad de forrajes in vitro María G. Domínguez-Ordóñez, Luis A. Miranda-Romero, Pedro A. Martínez-Hernández, Maximino Huerta-Bravo, Ezequias Castillo-Lopez ............................................................................................. 315

Productive and economic response to partial replacement of cracked maize ears with ground maize or molasses in supplements for dual-purpose cows Respuesta productiva y económica del reemplazo parcial de mazorca de maíz quebrado con maíz molido o melaza para vacas de doble propósito Isela G. Salas-Reyes, Carlos M. Arriaga-Jordán, Julieta G. Estrada-Flores, Anastacio García-Martínez, Rolando Rojo-Rubio, José F. Vázquez Armijo, Benito Albarrán-Portillo............................................ 335

III

Rendimiento de alfalfa (Medicago sativa L.) a diferentes edades de la pradera y frecuencias de defoliación Alfalfa (Medicago sativa L.) biomass yield at different pasture ages and cutting frequencies José Alfredo Gaytán Valencia, Rigoberto Castro Rivera, Yuri Villegas Aparicio, Gisela Aguilar Benítez, María Myrna Solís Oba, José Cruz Carrillo Rodríguez, Luís Octavio Negrete Sánchez ...................... 353

Propiedades tecnológicas y fisicoquímicas de la leche y características fisicoquímicas del queso Oaxaca tradicional Technological and physicochemical properties of milk and physicochemical aspects of traditional Oaxaca cheese Eric Montes de Oca-Flores, Angélica Espinoza-Ortega, Carlos Manuel Arriaga-Jordán ..................... 367

Evaluación de las condiciones de bienestar animal de camélidos sudamericanos ingresados al camal municipal de Huancavelica, Perú Evaluation of animal welfare conditions of South American camelids admitted to the Huancavelica municipal slaughterhouse, Peru Carlos Eduardo Smith Davila, Galy Juana Mendoza Torres, Claudio Gustavo Barbeito, Marcelo Daniel Ghezzi ............................................................................................................................................... 379

REVISION DE LITERATURA

Ácidos hidroxicinámicos en producción animal: farmacocinética, farmacodinamia y sus efectos como promotor de crecimiento. Revisión Hydroxycinnamic acids in animal production: pharmacokinetics, pharmacodynamics and growth promoting effects. Review Edgar Fernando Peña-Torres, Humberto González-Ríos, Leonel Avendaño-Reyes, Nidia Vanessa Valenzuela-Grijalva, Araceli Pinelli-Saavedra, Adriana Muhlia-Almazán, Etna Aida Peña-Ramos .... 391

Efecto de la radiación ultravioleta (UV) en animales domésticos. Revisión Effects of ultraviolet radiation (UV) in domestic animals. Review Maricela Olarte Saucedo, Sergio Hugo Sánchez Rodríguez, Carlos Fernando Aréchiga Flores, Rómulo Bañuelos Valenzuela, María Argelia López Luna ............................................................................... 416

Estrés oxidativo y el uso de antioxidantes en la producción in vitro de embriones mamíferos. Revisión Oxidative stress and antioxidant use during in vitro mammal embryo production. Review Viviana Torres-Osorio, Rodrigo Urrego, José Julián Echeverri-Zuluaga, Albeiro López-Herrera ....... 433

NOTAS DE INVESTIGACIÓN

DL-malic acid supplementation improves the carcass characteristics of finishing Pelibuey lambs La suplementación con DL-ácido málico mejora las características de la canal de borregos Pelibuey en finalización José Lenin Loya-Olguín, Fidel Ávila Ramos, Sergio Martínez González, Iván Adrián García Galicia, Alma Delia Alarcón Rojo, Francisco Escalera Valente ................................................................................ 460

Prediction of carcass characteristics of discarded Pelibuey ewes by ultrasound measurements Predicción de las características de la canal en ovejas Pelibuey de desecho por medio de ultrasonido Alfonso J. Chay-Canul, Juan José Pineda-Rodriguez, Jaime Olivares-Pérez, Francisco G. Ríos-Rincón, Ricardo García-Herrera, Ángel T. Piñeiro-Vázquez, Fernando Casanova-Lugo ................................. 473

Estudio de asociación genómica para resistencia a Cooperia punctata en bovinos cruzados en el trópico subhúmedo de México Genome association with Cooperia punctata resistance in crossbreed cattle in the subhumid tropics of Mexico Adriana García-Ruíz, Felipe de Jesús Ruíz-López, Miguel Alonso-Díaz, Elke Von-Son-de-Fernex, Sara Olazarán-Jenkins, Vicente Eliezer Vega-Murillo, Maria Eugenia López-Arellano .............................. 482

Similarity in plant species consumed by goat flocks in the tropical dry forest of the Cañada, Oaxaca Similitud de especies de plantas consumidas por rebaños de cabras en el bosque tropical seco de la Cañada, Oaxaca Salvador Mandujano, Ariana Barrera-Salazar, Antonio Vergara-Castrejón ...................................... 490

Evidencia serológica de infección por herpesvirus caprino tipo 1 en cabras en México Serological evidence of caprine herpesvirus type 1 infection in goats in Mexico Montserrat E. García-Hernández, Rosa E. Sarmiento-Silva, Liliana M. Valdés-Vázquez, Laura CobosMarín .......................................................................................................................................................... 506

Análisis de la presencia de Rotavirus en conejos del Estado de México Analysis of rotavirus in rabbits in the State of Mexico Emmanuel Reynoso Utrera, Linda Guiliana Bautista Gómez, José Simón Martínez Castañeda, Camilo Romero Núñez, Virginia Guadalupe García Rubio, Gabriela López Aguado Almazán, Pedro Abel Hernández García, Enrique Espinosa Ayala ....................................................................................... 511

Actualización: abril, 2018 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

indican, empezando cada uno de ellos en página aparte. Página del título Resumen en español Resumen en inglés Texto Agradecimientosy conflicto de interés Literatura citada Cuadros y gráficas

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes).

Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo.

El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y formato de derechos patrimoniales disponibles en el propio sitio oficial de la revista.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección.

apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda los autores deberán mencionar si existe algún conflicto de interés. 12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como referencias, aunque pueden insertarse en el texto (entre paréntesis).

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus. Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”). I)

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in

VII

pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No se indica el autor. IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista. V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

Libros y otras monografías

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Autor de capítulo. IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX

Tesis. XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989. XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984. XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996. XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990. XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988. XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003. XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003. XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003. 13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos

VIII

necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales.

km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las gráficas y figuras se deberán elaborar en Word, Power Point, Corel Draw y enviadas en archivo aparte (nunca insertarlas como imágenes en el texto). Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados. 18. Abreviaturas de uso frecuente: cal cm °C DL50 g ha h i.m. i.v. J kg

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s) hectárea (s) hora (s) intramuscular (mente) intravenosa (mente) joule (s) kilogramo (s)

versus

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s). 19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

Updated: April, 2018 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts).

All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt.

Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the â&#x20AC;&#x153;Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuariasâ&#x20AC;?. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables). At the time of submission, the application form, must be filled out, as well as a letter of originality and no duplication and patrimonial rights format, available on the official website of the journal.

References Tables and Graphics 7.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary

works and may show partial or final results of research. The text of the article must include the following parts: Introduction Materials and Methods Results Discussion Conclusions and implications

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

b) Technical Notes. They should be brief and be

evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of t he research article but without section titles.

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

c) Reviews. The purpose of these papers is to

Title page Abstract Text Acknowledgments

summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as

needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. References. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

Key rules for references a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one.

III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given

b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article).

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

Organization, as author

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the names(s), the number of the edition, the country, the printing house and the year.

VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

In press

e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000.

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Books and other monographs

Author(s)

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Electronic publications XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003.

Chapter in a book IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003.

Conference paper X)

XI)

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols. 13. Final version. This is the document in which the authors have incorporated all the corrections and modifications asked for by the editors. Graphs and figures should be submitted separately in Microsoft Word, MS Power Point, or Corel Draw. Figures must not be inserted as images within the text. In Tables do not use internal horizontal or vertical lines.

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989. XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

Organization as author XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines. 16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

17. List of abbreviations:

XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

cal cm °C

XII

calorie (s) centimeter (s) degree Celsius

DL50 g ha h i.m. i.v. J kg km L log Mcal MJ m Âľl Âľm mg ml mm min ng

lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s) mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s)

probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

versus

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XIII

https://doi.org/10.22319/rmcp.v10i2.4455 Artícle

Replacement of alfalfa with Tithonia diversifolia in lambs fed sugar cane silage-based diets and rice polishing

Esteban Vega Granados a Leonor Sanginés García b Agapito Gómez Gurrola c Antonio Hernández-Ballesteros c Lourdes Solano b Francisco Escalera-Valente c José Lenin Loya-Olguin c*

Universidad Autónoma de Nayarit. Posgrado en Ciencias Biológico Agropecuarias. Tepic, Nayarit, México.

Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán. Departamento de Nutrición Animal, Ciudad de México, México. c

Unidad Académica de Medicina Veterinaria y Zootecnia, Compostela Nayarit, México.

* Corresponding author: joselenin28@hotmail.com

Abstract: The aim was to evaluate the effect of replacing alfalfa (AA) with Tithonia diversifolia (TD) in sugar cane silage (SCS) based lamb diets, both with or without supplementation with rice polishings (RP), on in vitro digestibility, nitrogen retention and productive performance. The experimental diets (D) contained the following: D1) 68.6 % of SCS and 29.4 % of TD; D2) 63.7 % of SCS and 34.3 % of AA; D3) 46 % of SCS, 22.6 % of TD and 29.4 % of RP; and, D4) 44.1 % of SCS, 24.5 % of AA and 29.4 % of RP. Diets were isoproteinic and isocaloric. The in vitro digestibility of dry matter and organic matter were greater (P<0.05) with D2 compared to D1 and increased (P<0.05) with RP supplementation, with no difference between D3 and D4. Similarly, productive 267

Rev Mex Cienc Pecu 2019;10(2):267-282

performance was not different (P>0.05) between diets containing TD or AA. Nevertheless, RP improved (P<0.01) dry matter intake, average daily gain and total body gain with both forages. In conclusion, in sugar cane silage based diets, the replacement of alfalfa with Tithonia diversifolia has no effect on DM digestibility, N retention or productive performance. Complementation with rice polishings improves DM digestibility, N retention and productive performance in animals fed forage rich diets such as those utilized in this study. Key words: Tithonia diversifolia, Digestibility, Productive performance, Nitrogen retention.

Received: 31/03/2017 Accepted: 20/02/2018

Introduction

In tropical regions, sugar cane forage is frequently utilized by farmers in ruminant feed(1). Due to its low cost of dry matter produced and harvest concur with the poor availability of forage, although daily cut is a common practice may not be economical because of the labor implied(2). The ensiling of sugar cane is a forage conservation method that can increase NDF digestibility(3) and soluble carbohydrates(2,4,5). Some positive effects on digestion and productive performance encourage its research, for example, crude protein of ensiled sugar(6) and feed efficiency was higher in dairy cows fed with inoculated sugar cane silage respect fresh sugar cane(7). However, its TDN value is low and the N content of sugar cane silage is insufficient to maintain N equilibrium due to its poor N content(8). The shrub commonly called “gold button” or “wild sunflower” (Tithonia diversifolia) contains between 14 and 28 % of crude protein, and has high ruminal degradability of dry matter and low phenol and tannin content(9). Crude protein of Tithonia diversifolia is similar to alfalfa but the former is higher in rusticity. Moreover, the price of alfalfa is high because of its low availability in these regions. As a cheap source of protein, Tithonia diversifolia may be utilized up to a 30 % level of inclusion without negative effect(10,11) on productive performance and digestibility. Energy and N supplements increase the efficiency of ruminal microorganisms in forage fed ruminants(12). Nevertheless, nitrogen digestibility may be altered by the energy source because of the different site of the digestion(13). Rice polishing is a byproduct with similar

268

Rev Mex Cienc Pecu 2019;10(2):267-282

metabolizable energy and greater protein values respect high used grains such as sorghum and corn(14) because of its elevated protein and lipid content(15) . Positive N-balance has been observed with diets that include 25 to 50 % of rice polishings in the concentrate mixture of lactating goats(16) and cows(17). Also, rice polishing inclusion in diets based on sugarcane has improved the productive performance of cattle(18,19), but there is no evidence about the influence of rice polishing supplementation in diets based on sugar cane silage. The objective of this study was to evaluate the effect of the replacement of alfalfa with Tithonia diversifolia in sugar cane silage based lamb diets with and without rice polishings complementation.

Material and methods

Animal management procedures were conducted within the guidelines of locallyapproved techniques for animal use and care NOM-051-ZOO-1995; technical specifications for the care and use of laboratory animals. This experiment was conducted at the Unidad Académica de Medicina Veterinaria y Zootecnia of the Universidad Autónoma de Nayarit located in Compostela, Nayarit, Mexico (21° 17´46´´N and 104° 54´ W). The T. diversifolia was harvested at the university 60 d after the last cut. The forage was then chopped to obtain a particle size of between 2 and 3 cm and sun dried for 72 h and turned every 24 h. The sugar cane silage was prepared utilizing whole sugar cane plants harvested (24 mo after sowing) at a farm with clay soil near the experiment location. Sugar cane (SC) plants were chopped to obtain a particle size of between 2 and 6 cm. Three (3) percent of homemade inoculum (10 % of sugar cane molasses, 0.5 % of urea, 5 % of poultry waste, 1 % of yogurt and 83.5 % of water) (20,21), 1 % of urea, 0.1 % of ammonium sulfate and 0.25 % of diammonium phosphate (on wet basis) were added to SC by spraying it on each layer of sugar cane during ensiling. Sugar cane forage was compacted with a tractor at each 30 cm layer, with the compacted SC forage then covered with polyethylene and 15 cm of soil during 45 d.

269

Rev Mex Cienc Pecu 2019;10(2):267-282

Chemical analyses

The experimental diets (Table 1) and their ingredients were analyzed for dry matter (DM), crude protein (CP), ash and ether extracts (EE) determination(22) Also, the neutral detergent fiber (NDF) and the acid detergent fiber (ADF) were determined(23). Gross energy was determined by calorimetric bomb(24). The digestibility of the dry and organic matter were determined in vitro(25). Table 1: Ingredients, chemical composition and gross energy of experimental diets Item Ingredient (%): Sugar cane silage T. diversifolia Alfalfa Rice polishing Mineral premix Salt Composition (%): DM CP Ash EE NDF ADF Lignin GE,(Mcal/kg

AA+RP

TD+RP

63.73 34.31 0.98 0.98

68.63 29.41 0.98 0.98

44.12 24.51 29.41 0.98 0.98

46.08 22.55 29.41 0.98 0.98

91.33 17.44 9.14 1.01 50.55 32.16 16.54 3.76

93.12 17.5 9.8 1.05 52.85 34.65 14.71 3.76

91.14 17.1 8.59 3.92 49.84 27.16 18.65 3.97

92.71 17.47 10.3 3.47 44.75 26.19 11.4 3.86

TD= sugar cane silage plus Tithonia diversifolia, AA= sugar cane silage plus alfalfa, TD+RP= sugar cane silage, Tithonia diversifolia, and rice polishing, AA+RP= sugar cane silage plus alfalfa, and rice polishing, DM= dry matter, CP= crude protein, EE= ether extract, NDF= neutral fiber detergent, ADF= acid detergent fiber, GE= gross energy. Mineral premix contains P (30%), Co (30 ppm), I (13 ppm), 26 ppm of Se (organic plus organic), Cu (230 ppm), 1170 ppm of Zn (organic plus organic), Mn (150 ppm), Cu (150 ppm), Cr (110 ppm), Fe 80 (ppm), Mg (0.9 ppm), buffer (60%), NaCl (1.35%), Vitamin (A 200,000 UI), Vitamin D (100,000,000 UI), Vitamin E (100,000 UI), Ionophore (1200 ppm) and Ca (3%).

270

Rev Mex Cienc Pecu 2019;10(2):267-282

Animals and diets

Four (4) Blackbelly uncastrated male sheep (35 Âą1.2 kg of body weight) with cannulas in the rumen were assigned to a 4 x 4 latin square design to determine N retention. These animals were utilized as donors of rumen fluid to determine in vitro digestibility of dry matter and organic matter. Housed in individual metabolic cages (60 x 180 cm) with steel mesh flooring. The experiment consisted of four experimental periods of 21 d, 14 for diet adaptation and 7 for urine and feces collection. On adaptation period, feed was offered at 110 % of that consumed the previous day so sheep had ad libitum access. During the samples collection period, sheep received the 90 % of the feed offered ad libitum. Each animal received a different experimental diet (Table 1) in each period. Two experimental diets included alfalfa because of its similar protein content range respect to T. diversifolia and the proved high nutritive value of alfalfa. The urine from each animal was collected in a bucket placed at the bottom of the metabolism cage while the feaces were collected in a bag collocated in the animal. A sample of 10 % of the urine and faeces collected were taken and frozen at -4 Â°C. Twenty (20) Blackbelly x Pelibuey male lambs (2 mo old) with a mean body weight of 11.5 Âą 2.99 kg were used in the feeding trial. Animals were allotted in individual pens (0.95 x 1.1 m) with a rice straw bed that was turned every other day and replaced every 2 wk to keep them dry. Each lamb was provided individual feed and waterers. The experimental diets were formulated to meet nutrient requirements of hair breed lambs(26) recommendations (Table 1). These were assigned randomly to each lamb were both isocaloric and isoproteinic. Each diet was provided to 5 lambs. Animals were fed ad libitum once daily at 0800 h. The first 7 d were for adaptation to treatment followed by 119 trial days. Initial and final body weights were obtained after the morning meal using an electronic scale. Body weight gains were calculated by subtracting the previous weight from the current weight. The average daily body weight gains were calculated by dividing body weight gain by the number of days between two weighing days.

271

Rev Mex Cienc Pecu 2019;10(2):267-282

Statistical analyses

The data obtained from the trial to nitrogen balance was analyzed as a 4 x 4 Latin square, while the data from the feeding experiment was analyzed as a completely randomized design using the GLM procedure of SAS(27). Comparisons between treatment means were analyzed with Tukey test (P<0.05) when significant treatment differences were detected.

Results

Chemical composition of the feeds The chemical composition and gross energy of the ingredients comprising the experimental diets are presented in Table 2. The crude protein, NDF, and ADF of Tithonia diversifolia were 30.7, 21 and 30 % higher than alfalfa, respectively. However, the lignin content calculated for alfalfa is 15.9 % higher compared to T. diversifolia. The silage pH enabled optimal conservation and was reflected in terms of odor and color.

Table 2: Chemical composition (%) of diet ingredients on dry matter basis

DM CP Ash EE NDF ADF Lignin GE, Mcal/kg pH

T. diversifolia

Alfalfa

SCS

28.31 23.54 16.82 1.32 56.20 37.14 19.10 3.65

93.71 18.01 10.94 1.63 46.41 28.70 22.13 3.73

29.44 13.36 8.72 1.09 49.71 31.30 13.42 3.89 3.57

89.99 14.37 7.08 4.99 13.66 6.55 3.21 4.2

SCS= sugar cane silage; RP= rice polishing; DM= dry matter; CP= crude protein; EE= ether extract; NDF= neutral detergent fiber; ADF= acid detergent fiber; GE= gross energy.

272

Rev Mex Cienc Pecu 2019;10(2):267-282

The chemical composition and gross energy of the experimental diets are presented in Table 1. Fractions (NDF and ADF) of the diets decreased while ether extracts increased with the addition of the rice polishings.

In vitro digestibility of dry matter

The in vitro digestibility of dry matter (DDM) and organic matter (OMD) are shown in Table 3. The inclusion of the rice polishings increased (P<0.05) DDM and OMD levels in the TD diet only. The lowest digestibility level was observed with the TD diet, despite the similar NDF and ADF content compared to AA diet.

Table 3: In vitro dry (DDM) and organic matter (OMD) digestibility of the experimental diets (%) Item DDM OMD

AA 63.91 b 67.74 b

TD 59.82 c 62.29 c

AA+RP 65.13 b 68.09 b

TD+RP 68.93 a 73.27 a

SEM 0.3 0.19

P-value <0.001 <0.001

TD= sugar cane silage plus Tithonia diversifolia; AA= sugar cane silage plus alf alfa, TD+RP; sugar cane silage, Tithonia diversifolia, and rice polishing; AA+RP= sugar cane silage plus alfalfa, and rice polishing SEM= standard error of the mean. ab Means in the same row that do not have a common letter differ (P<0.05).

Nitrogen balance

Nitrogen (N) intake, N absorption and N retention (% and g of intake) increased (P<0.05) with RP complementation, while urinary levels of N increased with no RP (Table 4). N retention as a percentage of the N absorbed was 30% greater with T. diversifolia compared to alfalfa when no RP was added to diets. Nitrogen retention as a percentage of the N absorbed increased with RP supplementation in both alfalfa and TD diets.

273

Rev Mex Cienc Pecu 2019;10(2):267-282

Table 4: Nitrogen balance of lambs fed sugar cane silage based diets supplemented either Tithonia diversifolia or alfalfa and rice polishing Item N intake, g Fecal N, g N absorbed, % Urinary N, g d-1 Retention, g d-1 N Retention, %

AA+RP

TD+RP

SEM

P-value

14.35 b 1.77 87.71 b 9.94 a 3.12 b 21.54 b

13.16 b 1.72 86.96 b 7.98 b 3.46 b 26.28 b

19.64 a 1.66 91.50 a 8.11 b 7.74 a 38.86 a

17.38 a 1.65 90.48 a 7.86 b 7.87 a 45.24 a

1.06 0.16 0.77 0.4 1.24 4.91

<0.01 >0.05 <0.01 <0.01 <0.05 <0.05

AA= sugar cane silage plus alfalfa; TD= sugar cane silage plus Tithonia diversifolia; TD+RP= sugar cane silage, T. diversifolia, and rice polishing; AA+RP= sugar cane silage plus alfalfa, and rice polishing SEM= standard error of the mean. ab Means within each row followed by different letter differ significantly (P<0.05).

Productive performance

The productive performance of lambs fed different experimental diets is shown in Table 5. Feed intake, average daily weight gain, and total weight gain increased (P<0.05), while feed conversion decreased (P=0.02), with the inclusion of rice polishings in diets with either TD or alfalfa. No difference was observed between alfalfa and TD, either with or without RP complementation.

274

Rev Mex Cienc Pecu 2019;10(2):267-282

Table 5: Productive performance of lambs fed sugar cane silage plus either alfalfa or Tithonia diversifolia with or without rice polishing Item Initial BW, kg

AA 10.5 a

TD 11.9 a

AA+RP 10.9 a

TD+RP 12.4 a

SEM 2.76

P-value >0.05

Final BW, kg

13.3 b

14.35 ab

19.5 a

18.5 ab

3.37

>0.05

DMI, g d-1 ADG, g d-1 Total gain, kg F:G

336.5 b 23.7 b 2.82 b 16.5 ab

341.5 b 20.8 b 2.47 b 19.04 a

512.1 a 72.5 a 8.62 a 7.5 c

443.7 a 51.7 a 6.15 a 8.71 bc

45.98 15.07 1.79 5.19

<0.001 <0.05 <0.001 <0.05

AA= sugar cane silage plus alfalfa; TD= sugar cane silage plus Tithonia diversifolia; TD+RP= sugar cane silage, Tithonia diversifolia, and rice polishing; AA+RP= sugar cane silage plus alfalfa, and rice polishing BW = body weight, DMI= dry matter intake, ADG= average daily gain in grams per day; F:G= feed conversion. abc Means in the same row followed by different letter differ significantly (P<0.05).

Discussion

The ADF content of T. diversifolia in this study is greater than the values reported by different authors(10), who utilized T. diversifolia leaves only, while the CP content concurred with others(10,28). The nutrient content of T. diversifolia depends on age and plant part(29) while the higher ash content of T. diversifolia compared to alfalfa may be explained by its elevated concentration of minerals(30) such as Ca, P, and Mg(31). Higher NDF and ADF content in the non-RP diets reflect the higher fiber fraction concentration in T. diversifolia and alfalfa compared to RP, while EE content increased with the addition of RP. Concurs with the higher ether extracts in rice polish based concentrate compared to concentrate with wheat bran observed(17). The crude protein content of sugar cane silage (13.36 %) was higher than that without the addition of inoculums(8). Silage pH value reflected good fermentation(8) and was around to those reported in pure sugar cane and sugar cane plus 0.5 and 1 % of formic acid(32). The protein solubility (40 %) of T. diversifolia fodder(33) is one limitation for the use of high levels of this forage in lamb diets(28), a limitation that may be avoided by including rapidly fermentable carbohydrates(34). There is a synergy between protein and sugar supplementation because the microbial population is improved to a greater extent when protein is supplied in addition to sugar rather than when they are supplied separately(35).

275

Rev Mex Cienc Pecu 2019;10(2):267-282

Rice polishings facilitated the digestion of the TD diet due to the increased energy caused by the increment in ether extract and highly fermentable carbohydrates in the rice polishings. Moreover, the lower NDF content in the diets containing RP led to greater digestibility due to the negative relationship between NDF and digestibility. While complementation have increased the total diet digestibility of organic matter, the fiberbased energy have presented greater digestibility levels than a grain based supplement(36). In order to maintain an acceptable intake and digestion of low quality forages requires the synchronization of the degradable protein and carbohydrate supply from the energy supplement(12). Similarly, dry matter digestibility values between 60 and 66 %, and values of between 64 and 68 % for organic matter digestibility when T. diversifolia leaves were supplemented at levels of 10 and 40 % have been observed(37). In contrast, with the lower in vivo digestibility (41 to 53 %) in diets with 20, 35 and 50 of T. diversifolia combined with Taiwan grass and concentrate(28). The utilization of different diet composition and techniques for digestibility determination may explain the variable results observed in different trials. The Taiwan grass(28) contained a similar percentage of NDF to the levels for sugar cane silage recorded in this study. However, the protein in sugar cane silage is twice that of Taiwan grass. There is a close relationship between in vitro digestibility and rumen undegradable protein digestibility (r2=0.090) and a moderate relationship between rumen undegradable protein and CP (r2= 0.48 and 0.42)(38). Similar N retention as a percentage of N intake to diets with greater digestibility (80 %) caused by a greater amount of concentrate in the diet have been mentioned(39). In dairy cattle, NDF content is inversely related to N digestibility(40). Although the NDF content of T. diversifolia is greater than alfalfa, N retention as a percentage of absorbed N is 30 % greater in TD compared to AA diet, which can be attributed to the higher essential amino acid content of T. diversifolia(41), compared to alfalfa(42) which could be mobilized for tissue deposition or the synchrony between the degradation of energy and the protein contained in the ingredients of the diet. Similarly, greater concentration of serum protein have been found when animals, fed with threshed sorghum top, were supplemented with plant foliage(43). The high amino acid content in T. diversifolia enhances its N availability(9), which concurs with the fact that protein supplements with sufficient essential amino acid content, such as fish meal, have recorded high digestion and absorption levels(44). Rumen undegradable protein digestibility may not be similar for all forages. Improved N retention is desirable since it has a favorable impact on both the environment and the production economy because of the reduction of N loss through urine and feces. Based on the present results, supplementation with forage with high quality protein may improve N retention with rice polishings complementation. On the other hand, greater N retention with lower levels of T. diversifolia in concentrate had been attributed to the anti-nutritive components of this

276

Rev Mex Cienc Pecu 2019;10(2):267-282

forage(9). Nevertheless, no difference in N retention was observed when with alfalfa diets were compared to those with T. diversifolia diets in this study. Dry matter intake was improved by RP supplementation in both alfalfa and TD diets. Similarly, higher total dry matter intakes when concentrate was added to the whole sugar cane plant diets of goats and lambs (11 kg live weight) compared to those without concentrate were observed; however, they did report live weight losses(45). Also, average daily gains (26.1 g/d) similar to those recorded in this study have been found in goats fed diets based on Panicum maximum plus 30 % of T. diversifolia and concentrate(11). The DMI observed coincides with that of diets with dry matter digestibility between 64 and 68 %(9). Although the in vitro digestibility of the DM and OM in TD+RP was the highest, the ADG was similar (P>0.05) to that in AA+RP in response to the same dry matter intake. Intake is positively related to production(46) and depends on the ability of the feed to provide the nutrients needed(9). The RP diets contained a lower NDF percentage due to the fact that the rice polishings contained around one third of the NDF of alfalfa or T. diversifolia. The NDF content of all the experimental diets was higher than the 25 % which promotes digestibility, intake and weight gain(47,48). The elevated levels of forage in the diet may limit energy intake and ADG(49). Nevertheless, the similar performance of animals fed AA and TD encourages the further study of the effect of T. diversifolia supplementation in diets with higher energy and rumen undegradable protein content and lower fiber content on the performance of young animals. The superior N retention and DMI of lambs supplemented with RP was reflected in increased ADG. Rice polishings improved ADG, since its inclusion decreases fiber fraction percentage and increases the energy content of diets. The energy supplements influence animal performance and forage utilization, potentially increasing the opportunities for nutrient synchrony in the diet(12). The substitution of alfalfa with T. diversifolia reduced the feed cost with and without rice polishings complementation, 133 % ($1.02 vs $2.38 MXN) and 49 % ($1.97 vs $2.93 MXN), respectively. The sugar cane silage-based diet supplemented with T. diversifolia and complemented with rice polishing showed the lowest cost per kg of weight gain.

277

Rev Mex Cienc Pecu 2019;10(2):267-282

Conclusions and implications

Alfalfa can be replaced by Tithonia diversifolia in fiber rich diets with no effect on dry matter intake, average daily gain and feed conversion. The inclusion of rice polishings in sugar cane silage based diets improves digestibility, N retention and productive performance because it increases energy and decreases the fiber content.

Literature cited: 1. Bernardes TF, Rêgo AC. Study on the practices of silage production and utilization on Brazilian dairy farms. J Dairy Sci 2014;(97):1852-1861. 2.

Menezes GCC, Valadares Filho SC, Magalhães FA, Valadares RFD, Prados LF, Detmann E, et al. Intake and performance of confined bovine fed fresh or ensilaged sugar cane based diets and corn silage. Rev Bras de Zootecn 2011;(40):1095-1103.

Sousa DO, Mesquita BS, Diniz-Magalhães J, Bueno ICS, Mesquita LG, Silva LFP. Effect of fiber digestibility and conservation method on feed intake and the ruminal ecosystem of growing steers. J Anim Sci 2014;(92):5622–5634.

Pedroso AF, Nussio LG, Paziani SF, Loures DRS, Igarasi MS, Coelho RM, et al. Fermentation and epiphytic microflora dynamics in sugarcane silage. Sci Agric 2005;(62):427-432.

Carvalho MV, Rodrigues PHM, Lima MLP, dos Anjos IA, Landell MGA, Silva LFP. Chemical composition and digestibility of sugarcane harvested at two periods of the year. Braz J Vet Res Anim Sci 2010;(47):298–306.

Montañez-Valdez OD, Reyes-Gutiérrez JA, Guerra-Medina CE, Abdel-Fattah ZMS. Rumen dry matter degradability of fresh and ensiled sugarcane. Afr J Biotechnol 2013;(12):2743-2747.

Pedroso AF, Nussio LG, Rodrigues AA, Santos FAP, Mourão GB, Barioni Júnior W. Performance of dairy cows fed rations produced with sugarcane silages treated with additives or fresh sugarcane. Rev Bras Zootecn 2010;(39):1889-1893.

Kung L, Stanley RW. Effect of stage of maturity on the nutritive value of wholeplant sugar cane preserved as silage. J Anim Sci 1982;(54):689-696.

278

Rev Mex Cienc Pecu 2019;10(2):267-282

Rosales M. In vitro assesment of the nutritive value of mixtures of leaves from tropical fodder trees [doctoral thesis]. Oxford,UK: Oxford University; 1996.

10. Wambui CC, Abdulrazak SA, Noordin Q. Performance of growing goats fed urea sprayed maize stover and supplemented with graded levels of Tithonia diversifolia. Asian-Autralas J Anim Sci 2006;(19):992-996. 11. Odedire JA, Oloidi FF. Feeding wild sunflower (Tithonia diversifolia Hemsl., A. Gray) to West African Dwarf goats as a dry season forage supplement. World J Agri Res 2014;(2):280-284. 12. Hersom MJ. Opportunities to enhance performance and efficiency through nutrient synchrony in forage-fed ruminants. J Anim Sci 2008;(86):306-317. 13. Owens FN, Zinn RA. Metabolismo de la proteína en los rumiantes. En: Church DC editor. El ruminate fisiología digestiva y nutrición. 1a ed. Zaragoza, España: ACRIBIA; 1993:255-281. 14. NRC. Nutrient requirements of Small Ruminants. Washington, DC, USA: National Research Council. 2007. 15. Salinas-Chavira, J, Guerrero VI, Robles CA, Montaño-Gómez MF, MontañezValdez OD. Effect of tallow and rice polishings in feedlot rations on growth and carcass characteristics of lambs. J Appl Anim Res 2008;(34):45-48. 16. Dutta N, Sharma K, Naulia U. Rice Polishing as an economic substitute to wheat bran as a supplement to wheat straw diet for lactating goats. Anim Nutr Feed Techn 2006;(6):57–63. 17. Dutta N, Sharma K, Dey A, Singh M, Singh A. Effect of replacing wheat bran with rice polishings on the lactation performance of crossbred cows. Indian J Anim Sci 2010;(80):1259-1262. 18. Preston TR, Carcaño C, Alvarez FJ, Gutíerrez DG. Rice polishings as a supplement in a sugar cane diet effect of level of rice polishings and of processing the sugar cane by derinding or chopping. Trop Anim Prod 1976;(1):150-162. 19. Lopez JM, Preston TR, Sutherland TM, Wilson A. Rice polishings as a supplement in sugar cane diets: effect of level of rice polishings in wet and dry season conditions. Trop Anim Prod 1976;(3):15-23. 20. Palma JM. Ensilaje de caña “Alimento sano, económico y nutritivo para el ganado”. Tríptico informativo. Colima, México. 2003. 21. Reyes GA, Montañez VO, Rodríguez MR, Ruíz LM, Salcedo PE, Avellaneda CJ. Efecto de la adición de inóculo y aditivo en la digestibilidad in situ de la materia seca del ensilado de caña de azúcar. Ciencia y Tecnología 2012;(5):13-16. 279

Rev Mex Cienc Pecu 2019;10(2):267-282

22. AOAC. Official Methods of Analysis. 18th ed. Washington, DC, USA: Association of Official Analytical Chemists. 2005. 23. Goering HK, Van Soest PJ. Forage fiber analyses (apparatus, reagents, procedures and some applications). Washington, DC, USA: United States Department of Agriculture; 1970. 24. Agϋero AC, Pisa JR, Agϋero CJ, Bugeau AT. Poder Calorífico del bagazo de caña de azύcar. Rev Cienc Exactas Ingen 2004;(13):33-37. 25. Tilley JM, Terry RA. A two-stage technique for the in vitro digestion of forage crops. Grass Forage Sci 1963;(18):104-111. 26. Carrera CJM, Ortiz HJU, Gutiérrez BH. Formulación de raciones para ovinos. Primera edición. Guadalajara, Jalisco, México: Centro de Investigación y Fomento Ovino de Zacatecas; 2012. 27. SAS. SAS/STAT user’s guide: version 9.1. Cary NC, USA: SAS Inst. Inc. 2004. 28. Ramírez-Rivera U, Sanginés-García JR, Escobedo-Mex JG, Cen-Chuc F, RiveraLorca JA, Lara-Lara PE. Effect of diet inclusion of Tithonia diversifolia on feed intake, digestibility and nitrogen balance in tropical sheep. Agroforest Syst 2010;(80):295-302. 29. Jama B, Palm CA, Buresh RJ, Niang A, Gachengo C, Nziguheba AB. Tithonia diversifolia as a green manure for soil fertility improvement in western Kenya: A review. Agroforest Syst 2000;(49):201-221. 30. Tendonkeng F, Zogang BF, Sawa C, Boukila B, Pamo BF. Inclusion of Tithonia diversifolia in multinutrient blocks for West African dwarf goats fed Brachiaria straw. Trop Anim Health Prod 2014;(46):981-986. 31. Pérez A, Montejo I; Iglesias JM, López O, Martín GJ, García DE, et al. Tithonia diversifolia (Hemsl.) Gray. Pastos y Forrajes 2009;(32):1-15. 32. Van Cleef EHCB, Rêgo AC, Patiño RM, Scarpino FO, Ezequiel JMB. Use of acids as additives in sugarcane silage. Rev Col Cienc Pecu 2015;(28):356-359. 33. Mahecha L, Rosales M. Valor nutricional del follaje de botón de oro Tithonia diversifolia (Hemsl.) Gray, en la producción animal en el trópico. Livestock Research for Rural Development. 2005;(17). http://www.lrrd.org/lrrd17/9/ mahe17100.htm. Accessed: May 30, 2015. 34. Pathoummalangsy K, Preston TR. Effects of supplementation with rumen fermentable carbohydrate and sources of bypass protein on feed intake, digestibility and N retention in growing goats fed a basal diet of foliage of Tithonia diversifolia.

280

Rev Mex Cienc Pecu 2019;10(2):267-282

Livest Res Rural Develop 2008;(20). http://www.lrrd.org/lrrd20/supplement/kham20076.htm. Accessed: 25 feb, 2015. 35. Castillo-González AR, Burrola-Barraza ME, Domínguez-Viveros J, ChávezMartínez A. Rumen microorganisms and fermentation. Arch Med Vet 2014;(46):349-361. 36. Bodine TN, Purvis II HT, Lalman DL. Effects of supplement type on animal performance, forage intake, digestion, and ruminal measurements of growing beef cattle. J Anim Sci 2001;(79):1041-1051. 37. Wambui CC, Abdulrazak SA, Noordin Q. The effect of supplementing urea treated maize stover with Tithonia, Calliandra and Sesbania to growing goats. Livest Res Rural Develop 2006;(18):64. 38. Buckner CD, Klopfenstein TJ, Rolfe KM, Griffin WA, Latnothe MJ, Watson AK, et al. Ruminally undegradable protein content and digestibility for forages using the mobile bag in situ technique. J Anim Sci 2013;(91):2812-2822. 39. PhillipsWA, Rao SC, Fitch JQ, Mayeux HS. Digestibility and dry matter intake of diets containing alfalfa and kenaf. J Anim Sci 2002;(80):2989-2995. 40. Van Soest PJ. Nutritional ecology of the ruminant. New York, USA: Cornell University Press; 1994. 41. Barrita RV. Caracterización química e inclusión de la harina de Tithonia diversifolia como fuente de pigmento en raciones para gallinas de postura de primer ciclo [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 2015. 42. NRC. National Research Council. Nutrient Requirements of Swine. 10th revised edition. Washington, DC, USA: National Academy Press; 1988. 43. Adewale OS, Ajike IO, Atanda OM, Ayobami OO, John MO. Effects of supplementation of threshed sorghum top with selected browse plant foliage on haematology and serum biochemical parameters of Red Sokoto goats. Trop Anim Health Prod 2016;(48):979-984. 44. Sheikh IU, Barman K. Effect of fishmeal supplementation on economy of feeding crossbred Jersey calves. Indian J Anim Sci 2010;(80):683-685. 45. Van DTT, Ledin I, Mui NT. Feed intake and behavior of kids and lambs fed sugar cane as the sole roughage with or without concentrate. Anim Feed Sci Tech 2002;(100):79-91. 46. Zinn RA, Barreras A, Owens FN, Plascencia A. Performance by feedlot steers and heifers: daily gain, mature body weight, dry matter intake, and dietary energetic. J Anim Sci 2008;(86):2680-2689. 281

Rev Mex Cienc Pecu 2019;10(2):267-282

47. Norton B. The nutritive value of tree legumes. In: Gutteridge RC, Shelton HM editors. Forage tree legumes in tropical agriculture. 1rst ed. Wallinford, Oxon, UK: CAB International; 1994. 48. Allen MS. Effects of diet on short-term regulation of feed intake by lactating dairy cattle. J Dairy Sci 2000;(83):1598-1624. 49. Ware RA, Zinn RA. Influence of forage source and NDF level on growth performance of feedlot cattle. Proc 2004 Western Section. Am Soc Anim Sci. Corvalis Oregon. 2004:424-425.

282

https://doi.org/10.22319/rmcp.v10i2.4363 Article

Evaluation of two soybean soapstocks in egg production and quality in Bovans hens

Jennifer Pérez Martíneza* Juan Manuel Cuca Garcíaa Gustavo Ramírez Valverdea Silvia Carrillo Domínguezb Arturo Pro Martíneza Ernesto Ávila Gonzálezc Eliseo Sosa Montesd

Colegio de Postgraduados, Campus Montecillo. Carretera México-Texcoco km 36.5, Montecillo, 56230, Texcoco, Estado de México. México.

Instituto de Nutrición Salvador Zubirán. CDMX, México.

Universidad Nacional Autónoma de México. CDMX. México.

Universidad Autónoma Chapingo. Texcoco de Mora, México.

* Corresponding author: jeanbodin_@hotmail.com

Abstract: Crude soybean oil (CSO) is used to increase metabolizable energy (ME) content in diets for laying hens. Also used in human food, its price is consequently high. Oil soapstocks are byproducts of the oil extraction process and therefore cost less. An evaluation was done of the effect of two soybean soapstocks (SS) on egg production, quality and lipid composition, and the cost of 1 kilogram of eggs. Soapstock ME and lipid composition were quantified. An experiment was done using 240 hens in six treatments, with five replicates and eight hens per replicate. Diets were formulated using CSO, or one of the 283

Rev Mex Cienc Pecu 2019;10(2):283-297

soapstocks, at 2 or 4% concentrations. The evaluated productive variables were feed intake, feed conversion, egg weight, egg mass, laying percentage and egg quality parameters. Egg lipid composition was described and the cost per one kilogram calculated. Replacement of CSO with the soapstocks did not affect poultry production variables (P>0.05), but did improve Haugh unit values (P<0.05). Egg fatty acids composition changed in response to oil composition (P<0.05), and inclusion concentration affected the levels of specific fatty acids. Use of the soapstocks resulted in a lower cost per kilogram of eggs than with CSO (P<0.05). Substitution of crude soy oil with the evaluated soapstocks had no effect on productive variables, improved egg quality and lowered overall feed costs. Key words: Soybean oil, Level, Energy, Fatty acids, Costs.

Received: 06/02/2017 Accepted: 18/06/2018

Introduction

Concentrated components such as fats and oils are added to poultry diets to meet energy requirements(1). In laying hens these additives can strongly affect feed costs. Because of its high energy content and unsaturated fatty acids concentration crude soy oil (CSO) is used in poultry feeds(2,3). These fatty acids are more digestible for poultry than saturated fatty acids (SFA)(4). However, CSO is expensive since it is also used in human diets. A less costly fatty acids source is soybean soapstock (SS), a byproduct of the oil refining process. This oil contains free fatty acids (58.6%)(1), phospholipids, non-saponifiable chemical ingredients, oxidation compounds, carotenoids and xanthophylls(5,6,7). Potential use of SS in poultry culture could be limited by two factors. First, its fatty acid content can vary(8) in response to refining method and storage conditions(5); this is vital since fatty acids content may be the most important factor influencing egg weight (EW) and egg lipids concentration(9). Second, SSâ&#x20AC;&#x2122;s metabolizable energy (ME) content is lower than that of CSO, a property that depends on free fatty acids content(10). The present study objective study was to evaluate two SS from different sources in substitution of CSO at two inclusion levels (2% and 4%), and their effects on egg production, quality and lipid composition, and the production cost of one kilo of egg in Bovans White laying hens.

284

Rev Mex Cienc Pecu 2019;10(2):283-297

Material and methods True metabolizable energy (TME)

Oil true metabolizable energy (TME) was analyzed according to Sibbald(11) (Table 1). Experimental animals were twenty-four Bovans White line roosters of 33 weeks of age with an average individual weight per bird of 2.06 Âą 0.06 kg. Animals were randomly distributed in three treatments, eight per treatment, with each rooster representing a replicate. Administration of pure oil causes poultry to regurgitate(12), and its liquid state prevents quantification of dry matter (DM)(13). Due to these physical characteristics, the oils were mixed with ground sorghum at a 90:10 proportion. Sorghum DM was therefore quantified simultaneously with the treatments using six roosters.

Table 1: Oil true metabolizable energy Oils Crude soy oil (CSO) Soybean soapstock T (SST)

Kcal-1kg 8337 8296

Soybean soapstock Y(SSY)

8528

Metabolic and endogenous energy were measured. The roosters were allowed to rest for five days and then fasted for 24 hours. Total manure (endogenous and metabolic material) was collected from each animal to ensure that the endogenous portion used in the calculations came from the same animal(14). Ingredient and excreta gross energy (GE) were measured in two replicates using a isoperibolic calorimetric pump (Parr 1266, model Moline, Illinois, USA).

Production variables and egg quality

A total of 240 Bovans White hens, 30 wk old, were used in this assay. Animals were distributed into six treatments, five replicates per treatment, and eight animals per replicate. Hens were placed two per cage (30 x 45 cm), with linear feeders and automatic drinking troughs in a conventional hut. Photoperiod was 16 h daylight-1, provided by artificial lighting. The experimental period was 16 wk. Diets were isoenergetic and based on a sorghum-soybean paste (Table 2). They met the laying hen nutritional requirements of the NRC(15) and Cuca et al(16). The diets were kept

285

Rev Mex Cienc Pecu 2019;10(2):283-297

isoenergetic by varying proportions of sorghum, soybean paste and sand (sterilized in autoclave). Crude soy oil (CSO), soybean soapstock T (SST) and soybean soapstock Y (SSY) were evaluated at two inclusion levels (2 and 4 %), resulting in six treatments: 2%CSO; 4%CSO; 2%SST; 4%SST; 2%SSY; and 4%SSY. During the growth period hens had been vaccinated against newcastle, smallpox, gumboro, bronchitis, encephalomyelitis and infectious coryza. Water and food were freely available. Table 2: Diet composition and calculated analysis Ingredients (%) Oil concentration Sorghum (8.3% CP) Soy paste (45.8% CP) Sand DL- methionine (99%)1 Threonine (98.5%)1 CaCO3 (38%)2 Dicalcium phosphate (18/21)3 Vitamins and minerals4 Pigment Salt

CSO

SST

SSY

2% 63.49 22.32 0.52 0.32 0.04 10.05

4% 57.45 22.97 3.89 0.33 0.04 10.04

2% 64.08 22.26 0 0.32 0.04 10.06

4% 58.63 22.84 2.84 0.33 0.04 10.04

2% 64.08 22.26 0 0.32 0.04 10.06

4% 58.63 22.85 2.84 0.33 0.04 10.04

0.49

0.53

0.49

0.52

0.49

0.52

0.25 0.15 0.35

Feed cost ($ kg-1)5

5.02

5.19

4.95

5.06

4.91

4.98

Calculated analysis ME, Kcal-1 kg Crude protein, % Calcium, % Available phosphorous, % Lysine, % Methionine + Cysteine, % Tryptophan, % Threonine, % Linoleic acid, %

2800 15.53 4.00 0.25 0.83 0.78 0.19 0.61 1.88

2800 15.23 4.00 0.25 0.83 0.78 0.19 0.61 2.90

2800 15.55 4.00 0.25 0.82 0.78 0.19 0.61 1.42

2800 15.37 4.00 0.25 0.83 0.78 0.19 0.61 1.98

2800 15.55 4.00 0.25 0.82 0.78 0.19 0.61 0.94

2800 15.37 4.00 0.25 0.83 0.78 0.19 0.61 1.02

Purification percentage. 2 38%= calcium. 3 18%= phosphorous; 21%= calcium. 4 Contents per kilogram feed: vit A, 9000 UI; vit D3, 2,500 UI; vit E, 20 UI; vit K, 3.0 mg; vit B2, 8.0 mg; vit B12, 0.015 mg; pantothenic acid, 10 mg; nicotic acid, 60 mg; niacin, 40 mg; folic acid, 0.5 mg; choline, 300 mg; D-biotin, 0.055 mg; thiamin, 2.0 mg; iron, 65.0 mg; zinc, 100 mg; manganese, 100 mg; copper, 9.0 mg; selenium, 0.3 mg; iodine, 0.9 mg. 5 FND = Financiera Nacional de Desarrollo Agropecuario, Rural, Forestal y Pesquero. Market prices as of 26 August 2016 in Mexico(17). CSO= crude soy oil; SST= soybean soapstock T; SSY= soybean soapstock Y; ME= metabolizable energy; CP= crude protein.

286

Rev Mex Cienc Pecu 2019;10(2):283-297

Data were collected weekly on five production variables: food intake (FI, g/bird/d); laying percentage (LP, %); egg weight (EW, g/d); feed conversion (FC); and egg mass (EM, g). Egg quality was measured using twenty eggs (four per replicate) from each treatment at the beginning of the period and at wk 4, 8 and 12. Four parameters were used to characterize egg quality: albumin height (AH); Haugh units (HU); yolk color (YC) using an Egg Multi Tester (QCM System, Technical Services and Supplies, Dunnington, United Kingdom) which measures yolk color based on the DSM range; and eggshell thickness (ET), taken with a micrometric screw.

Fatty acids analysis

Oil fatty acid profile (Table 3) was analyzed using the AOAC total lipids technique(18). Egg fatty acids composition was measured using the same eggs used to measure egg quality. These were manually mixed with a blender to create a pooled sample. Lipid extraction was done using the AOAC total lipids technique(19) (923.07), with a gas chromatographer (model 3380 CX, Varian) equipped with a DB23 column (30 m x 0.25 mm id), a CP8400 Autosampler and a flame ionization detector (FID)(USA).

Table 3: Fatty acids profiles in soy oil, soapstocks and experimental diets (%) CSO Fatty acids Myristic (C14:0) Palmitic (C16:0) Stearic (C18:0) Palmitoleic (C16:1) Oleic (C18:1) Linoleic (C18:2) α-Linolenic (C18:ω3) Arachidic (C20:0) EPA (C20:5 ω3) Other fatty acids Total saturated, % Total monounsaturated, % Total polyunsaturated, %

0.11 11.74 4.17 0.18 22.3 51.09 7.52 0.32 .36 0.86 16.50 23.67 58.97

SST (%) 0.47 11.47 3.34 0.33 43.67 28.01 6.59 ND ND 0.94 16.97 47.17 34.92

SSY 2.78 18.22 19.88 1.53 38.88 3.95 0.23 0.51 ND 3.09 42.49 49.54 4.88

CSO 2% 4% 0.19 0.19 0.57 0.80 0.81 0.90 0.15 0.16 3.44 3.88 1.88 2.90 0.37 0.52 0.09 0.09 0.02 0.02 0.02 0.03 0.33 0.66 0.47 0.95 1.18 2.36

SST 2% 4% 0.20 0.21 0.57 0.80 0.80 0.86 0.16 0.16 3.86 4.74 1.42 1.98 0.35 0.48 0.08 0.08 0.01 0.01 0.02 0.04 0.34 0.68 0.94 1.89 0.70 1.40

SSY 2% 4% 0.25 0.30 0.70 1.06 1.13 1.53 0.18 0.21 3.77 4.55 0.94 1.02 0.22 0.23 0.09 0.10 0.01 0.01 0.06 0.12 0.85 1.70 0.99 1.98 0.10 0.20

CSO= crude soy oil; SST= soybean soapstock T; SSY= soybean soapstock Y; EPA= eicosapentaenoic acid.

287

Rev Mex Cienc Pecu 2019;10(2):283-297

Cost per kilogram of eggs

The cost of each diet was calculated by multiplying the price of each ingredient by the quantity of each in each feed formula. The cost of one kilo of eggs per feed was calculated based on the FI of each treatment and multiplied by the feed cost. Ingredient prices (/kilo) were sorghum, $3.58; soy paste, $7.96; CSO, $16.00; SST, $12.00; SSY, $10.00; DLmethionine, $70.00; threonine, $30.00; CaCO3, $1.50; dicalcium phosphate, $16.00; vitamins, $75.00; minerals, $20.00; salt, $3.50; and pigment, $30.00.

Statistical analyses

Data were analyzed with a completely random design employing a 3x2 factorial arrangement in five replicates: oils (CSO, SST and SSY), and inclusion levels (2 and 4%). Using the SAS statistics package(20), the MIXED procedure was applied and differences between the treatment means compared with a Tukey test (P<0.05).

Results and discussion

Values for the productive variables FI, LP, EW, EM and FC did not differ (P>0.05) in response to the different oils and levels (Table 4). This coincides with a previous study in which addition of sunflower soapstock did not modify production variables because the diets were isoenergetic and isoproteic(21). Other studies have also found that inclusion of different oils in laying hen diets does not modify productive variables(22,23).

288

Rev Mex Cienc Pecu 2019;10(2):283-297

Table 4. Effect of soy oil and soapstocks on production variables during 16 weeks in Bovans White hens Oils CSO SST SSY SE Concentrations (%) 2 4 SE

FI g/bird/d 103.04 102.54 101.91 0.63

LP (%) 94.66 95.35 93.83 0.88

EW (g) 59.66 59.36 59.08 0.25

EM (g) 56.41 56.60 55.35 0.54

1.82 1.81 1.82 0.01

95.04 94.10 0.72

95.04 94.1 0.21

59.20 59.53 0.44

56.20 56.03 0.52

1.83 1.82 0.01

FI= feed intake; LP= laying percentage; EW= egg weight; EM= egg mass; FC= feed conversion (kg feed / kg egg). CSO= crude soy oil; SST= soybean soapstock T; SSY= soybean soapstock Y. SE= standard error of the mean. (P>0.05).

Feed intake (FI) was unaffected because the diets were isoenergetic. Poultry adjust feed intake according to diet energy concentration since they eat to cover energy requirements (24,25). Laying percentage (LP) is also controlled by poultry feed energy content(1). Since all the treatment diets contained 2,800 kcal/kg, LP remained unchanged. Egg weight (EW) did no vary in response to the different concentrations of soybean soapstock, which agrees with a study where substitution of CSO (3.5%) with 25%, 50%, 75% and 100% soybean soapstock had no effect on this variable(26). Addition of oils increases diet energy content and consequently EW (27), which is attributed to the fatty acids, particularly linoleic acid (LA)(28,29). Content of LA in the present diets ranged from 0.94 to 2.9 % (Table 2), which did not affect EW. This coincides with a study in which diets containing from 0.7 to 2.1% LA did not affect EW(30). Egg mass (EM) responds to diet ME(1); the present diets had the same ME levels and therefore did not modify EM. Because FI and EW were unaffected by inclusion of the soybean soapstocks or inclusion levels, feed conversion (FC) did not change between treatments; this coincides with previous reports(26).

Egg quality

Inclusion of both SST and SSY increased HU values (P<0.05), but no differences were observed between different inclusion levels (Table 5). This contrasts with a study in which substitution of CSO (2.6%) with sunflower soapstock (25, 50, 75 and 100%) tended to lower HU values as inclusion level increased(21). However, another study reported that use of soybean soapstock in hen diets had no effect on HU values(26). Neither oil type (CSO, SST, SST) nor level (2 and 4%) affected AH or ST (P>0.05); this agrees with previous studies(21,26).

289

Rev Mex Cienc Pecu 2019;10(2):283-297

Table 5: Effect of soy oil and soapstocks on egg quality variables in hens during sixteen weeks

65.65c 68.82ab 68.97a 0.76

AH (mm) 5.02 5.24 5.29 0.09

ST (mm) 0.36 0.36 0.35 0.04

YC (Roche) 7.17b 7.81a 7.07b 0.05

67.89 67.73 0.62

5.15 5.22 0.07

3.5 0.36 0.03

7.30 7.40 0.04

Oils

CSO SST SSY SE Concentrations (%) 2 4 SE

HU= Haugh units; AH= albumin height; ST= shell thickness; YC= yolk color (DSM range). CSO= crude soy oil; SST= soybean soapstock T; SSY= soybean soapstock Y. SE= standard error of mean. abc Different letters in the same column indicate difference (P<0.05).

Yolk color (YC) was modified by oil type (P<0.05) but not by oil inclusion level. Addition of SST improved yolk color, whereas no changes were observed with the CSO and SSY treatments (Table 5). How an added oil affects YC depends on the xanthophyll content of the seeds from which it was extracted, and the process used to produce the soapstock since bleaching of soybean soapstocks can eliminate xanthophylls(6). The present results coincide with a study in which YC improved in response to replacement of CSO with sunflower soapstock, a phenomenon attributed to oil tocopherol content(21). Soy soapstock is also reported to be an important natural pigment in broilers(31). However, another study found CSO and sunflower soapstock to have no effect on skin pigmentation in chickens(32).

Egg fatty acid composition

Fatty acid composition was affected by oil type (P<0.05). Inclusion of SSY increased concentrations of C14:0 and C16:0 (P<0.05) in the egg (Table 6). In contrast, addition of SST lowered C14:0 by 14% and C16:0 by 2%, and CSO lowered C14:0 by 25% and C16:0 by 3%. This is to be expected because these fatty acids were deposited in the egg according to their levels in each oil (Table 3). Neither soybean soapstock modified egg C18:0 levels. Oil diet inclusion levels had no effect on C14:0 or C18:0 levels, but C16:0 (P<0.05) did increase at the 4% level. These results contrast with a previous report in which egg SFA (C14:0, C16:0 and C18:0) composition did not vary between treatments

290

Rev Mex Cienc Pecu 2019;10(2):283-297

containing different levels of soybean soapstocks(26). It is yet unclear why some fatty acids are more readily deposited in the egg. Some fatty acids are better metabolized than others, and high SFA content decreases when oils with lower SFA content are added to diets(33).

Table 6: Fatty acid content in eggs in response to oil type and diet inclusion level in Bovans hens ∑SFA

14:0

∑MUFA

16:0

18:0

16:1

∑PUFA

18:1

18:3 LLA α3

20:5 EPA 3

22:6 DHA 3

22:5 DPA 3

18:2 LA 6

18:3 LLA γ6

20:4 ARA 6

∑SFA ∑MUFA

∑PUFA ∑PUFA n-6:n-3 3 6

CSO

0.33b

25.12b

8.57

2.63b

38.92c

0.74a

0.04

0.93a 0.15a 16.70a 0.24a 1.71b

34.09

41.50

1.87a

18.49a

13.83a

SST

0.38b

25.33ab

7.84

2.76b

41.50b

0.57b

0.07

0.84a 0.11b 12.60b 0.23ab 1.79b

32.13

42.74

1.57b

13.85b

12.58b

SSY

0.44a

25.84a

8.24

3.38a

44.32a

0.29c

0.06

0.60b 0.08c 10.05b 0.10c

1.97a

32.80

45.14

1.00c

11.36c

12.55b

0.01

0.31

0.22

0.06

0.77

0.02

0.03

0.06

0.55

0.02

0.06

0.88

1.34

0.08

0.40

0.51

Concen tration % 2

0.37

25.07b

8.23

3.20a

41.80

0.46b

0.06

0.75

0.10b 12.72

0.19

1.89

33.27

43.73

1.38b

14.08b

13.04

0.39

25.89a

8.20

2.65b

41.36

0.60a

0.05

0.83

0.12a 13.51

0.19

1.76

32.75

42.52

1.58a

15.03a

12.93

0.01

0.29

0.24

0.04

0.72

0.02

0.03

0.05

0.01

0.05

0.70

1.07

0.04

0.32

0.27

0.58

SFA= saturated fatty acids; MFA = monounsaturated fatty acids; P= polyunsaturated fatty acids. CSO= crude soy oil; SST= soybean soapstock T; SSY= soybean soapstock Y; αLLA= α linolenic acid; EPA= eicosapentaenoic acid; DHA= docosahexaenoic acid; DPA= docosapentaenoic acid; LA= linoleic acid; γLLA= γ linolenic acid; ARA= arachidonic acid. SE= standard error of mean. abc Different letters in the same column indicate difference (P<0.05).

Inclusion of SSY increased concentrations of the monounsaturated fatty acids (MUFA) C16:1 and C18:1 (P<0.05). Addition of SST decreased C16:1 by 18% and C18:1 by 6%, while CSO reduced C16:1 by 22% and C18:1 by 12%. Concentrations of C16:1 responded to oil inclusion level since levels were higher at the 2% level (P<0.05); C18:1 concentration was unaffected by inclusion level. These results differ somewhat from those of a study in which no changes were observed in C16:1 and C18:1 concentrations in eggs when CSO was substituted by soybean soapstock at 25, 50, 75 and 100%(26). Content of the polyunsaturated fatty acid (PUFA) C18:3 ω3 was higher (P<0.05) with addition of CSO in the diet and decreased with inclusion of SST (23%) and SSY (61%). This is to be expected since yolk PUFA composition, and especially C18:3 ω3, is influenced by feed oil profile(34,35,36). Levels of C18:3 ω3 increased at the 4% oil inclusion level (P<0.05). This is consistent with a reported increase in C18:3 ω3 when diet oil content was raised from 1.5 to 3%(23). Eicosapentaenoic acid (EPA) levels did not change (P>0.05) in response to addition of different oils or inclusion level. However, docosahexaenoic acid (DHA) and docosapentaenoic (DPA) acid levels tended to increase in the egg (P<0.05) when CSO and SST were added to the diet, whereas they decreased with addition of SSY. This was probably due to the high C18:3 ω3 content in the CSO and SST (Table 3), which desaturase and elongase enzymes transform into EPA and subsequently DHA and 291

Rev Mex Cienc Pecu 2019;10(2):283-297

DPA(37,38). Soapstock inclusion level had no effect on DHA levels (P>0.05), but DPA levels did increase at the 4% level (P<0.05). Levels of the PUFA C18:2 ω6 in the CSO treatment were 25 % higher than with SST and 40 % higher than with SSY (P<0.05); this was probably due to the respective contents of this acid in each oil. The content of C18:2 ω6 was not affected by oil inclusion level (P>0.05). Addition of CSO and SST reduced (P<0.05) C20:4 ω6 content in the egg, but SSY increased it. This may be because the SSY contained 0.23% C18:3 ω3 while the CSO had 7.52 % and the SST 6.59 % (Table 3). High C18:3 ω3 concentrations are known to limit synthesis of C20:4 ω6 since both acids use the Δ-desaturase enzyme(39) due to competition between n-3 and n-6 for the same enzymes for biosynthesis(34,40). Total egg SFA and MUFA contents were unaffected by oil type and inclusion level (P>0.05). This was not true for the PUFA n-3, which decreased 16 % with SST and 47 % with SSY, and n-6, which decreased 27 % with SST and 38 % with SSY (P<0.05). Higher oil inclusion level increased (P<0.05) both n-3 and n-6 contents (Table 6). Both n-6 and n-3 fatty acids are important in human nutrition, and maintaining a 4:1 n6/n-3 ratio is vital to overall human health(41,42). During gestation n-3 fatty acids function as structural components in the brain and retina, and contribute to normal growth and development in the infant(43). High levels of n-6 promote cardiovascular diseases, and an adequate n-6/n-3 balance can diminish and prevent obesity(44). Addition of oils rich in n3 (e.g. flax seed) to hen diets can raise n-3 levels in the egg and help to improve the n6/n-3 ratio(33). Compared to eggs from the CSO treatment, those from the soybean soapstock treatments had a lower n-6/n-3 (P<0.05); these eggs had a lower n-3 content as well as a lower n-6 content. Diet oil inclusion level did not influence the n-6/n-3 ratio, which agrees with previous findings of no effect on this ratio in response to addition of CSO (11.90) and soybean soapstock (13.75)(26).

Cost per kilogram of eggs

Compared to the cost per one kilogram of eggs in the CSO treatment, the cost in the SST dropped 2.68% and that in the SSY by 2.03% (P<0.05) (Table 7). At the 4% inclusion level the cost per one kilogram increased by 1.8 % over the 2% level (P<0.05).

292

Rev Mex Cienc Pecu 2019;10(2):283-297

Table 7: Production cost of one kilogram of eggs by oil addition treatment Oil

Cost per 1 kg eggs

CSO SST SSY SE Concentrations (%) 2 4 SE

9.32a 9.07b 9.13b 0.07 9.09b 9.26a 0.04

CSO= crude soy oil; SST= soybean soapstock T; SSY= soybean soapstock Y. SE= standard error of mean. ab Different letters in the same column indicate significant difference (P<0.05).

Conclusions and implications

The evaluated soybean soapstocks have different fatty acid profiles and metabolizable energy contents. Both can be used in laying hen diets as an alternative metabolizable energy source to costlier crude soy oil. They do not affect productive variables and improve egg quality (Haugh units). The type and concentration of oil added to the diet modified egg fatty acid profile. Inclusion of soybean soapstocks in laying hen diets decreased the production cost of one kilogram of eggs.

Acknowledgements

The research reported here was financed by the Consejo Nacional de Ciencia y TecnologĂa (CONACYT).

Literature cited: 1.

Leeson S, Summers JD. Commercial Poultry Nutrition. 3th ed. Ontario Canada: University Books; 2005.

Pesti G, Bakalli R, Qiao M, Sterling K. 2002. A Comparison of eight grades of fat as broiler feed ingredients. Poult Sci 2002;81:382-390.

Omidi M, Rahimi S, Ali M. Modification of egg yolk fatty acids profile by using different oil sources. Vet Res Forum 2015;6(2):137-141.

293

Rev Mex Cienc Pecu 2019;10(2):283-297

Sklan D. Digestion and absorption of lipids in chicks feed triglycerides of free fatty acids: Synthesis of monoglyceridos in the intestine. Poult Sci 1979;58:885-889.

Dumont MJ, Narine SS. Soapstock and deodorizer distillates from North American vegetable oils: Review on their characterization, extraction and utilization. Food Res Int 2007;40:957-974.

Dumont MJ, Narine SS. Characterization of soapstock and deodorizer distillates of vegetable oils usinggas chromatography. Lipid Tech 2008;20(6):136-138.

Kessler A, Lubisco D, Vieira M, Ribeiro A, Penz A. Fatty-acid composition of freechoice starter broiler diets. Br Poult Sci 2009;11:31-38.

Haasa MJ, Bloomerb S, Scotta K. Simple, high-efficiency synthesis of fatty acid methyl esters from soapstock. J Am Oil Chem Soc 2000;77(4):373-379.

Ribeiro BC, Lara LJ, Baião NC, Lopez CA, Fiuza MA, Cançado SV, Silva GM. Effect of linoleic acid level in the diets on the weight, composition and eclodibility of broiler breeders eggs. Arq Bras Med Vet Zootec 2007;59(3):789-796.

10. Haas MJ. Improving the economics of biodiesel production through the use low value lipids as feedstocks: vegetable oil soapstock. Fuel Process Technol 2005;86:1087-1096. 11. Sibbald IR. The T.M.E. system of feed evaluation: methodology, feed composition data and bibliography. Thech Bull 1986-4E, Res Brach Agric. Canada 1986. 12. Sibbald IR. A bioassay for true metabolizable energy in feeding stuffs. Poult Sci 1976;55:303-308. 13. Wiseman J, Salvador F. The influence of free fatty acid content and degree of saturation on the apparent metabolizable energy value of fats fed to broilers. Poult Sci 1991;70:573-582. 14. Bustillo PR, Cuca GM, Cervantes MR, Pro MA. Determinación de la calidad nutritiva de pastas de soya y soya integral mediante pruebas de laboratorio y biológicas en pollos de engorda y gallos Leghorn. Agrociencia 1991;1(3):57-70. 15. NRC. National Research Council. The nutrient requirements of poultry. 9th ed. Washington, DC, USA: National Academy Press; 1994. 16. Cuca GM, Pró MA, Ávila GE. Alimentación de las aves. México: Universidad Autónoma Chapingo; 2009. 17. FNDARFP. (Financiera Nacional de Desarrollo Agropecuario Rural, Forestal y Pesquero). 2016. Precio de Sorgo y Pasta de soya. http://www.financierarural. gob.mx/informaciónsectorrural/Precios%20Lateral/PreciosNacionales.pdf. Consultado 20 Oct, 2016.

294

Rev Mex Cienc Pecu 2019;10(2):283-297

18. AOAC. Official methods of analysis. 17th ed. Association of Official Analytical Chemists Inc., Arlington. Va. USA. 2000. 19. AOAC. Official methods of analysis. 18th ed. Association of Official Analytical Chemists Inc., Arlington. Va. USA. 2002. 20. SAS Institute. Statistical Analysis System. The SAS system for Windows release 8.0. USA; 1999. 21. Göçmen R, Kanbur G, Cufadar Y. Yumurta Tavuğu Rasyonlarına Soya Yağı, Ayçiçek Asit Yağı ve Kombinasyonlarının İlavesinin Performans, Yumurta Kalitesi ve Yumurta Sarısı Yağ Asidi Kompozisyonuna Etkileri. Tavuk Araşt Enstit Müdürl 2015;12(1):16-19. 22. Lelis G, Silva M, Tavernari F, Albino L, Rostagno H. Performance of layers fed diets containing different oils. Braz J Poultry Sci 2009;11(4):235-240. 23. Ceylan N, Ciftçi I, Mızrak C, Kahraman Z, Efil H. Influence of different dietary oil sources on performance and fatty acid profile of egg yolk in laying hens. J Anim Feed Sci 2011;20:71–83. 24. Veldkamp T, Kwakkel RP, Ferket PR, Verstegen WA. Growth responses to dietary energy and lysine at high and low ambient temperature in male turkeys. Poult Sci 2005;84:273-282. 25. Pérez-Bonilla A, Novoa S, García J, Mohiti-Asli M, Frikha M, Mateos G. Effects of energy concentration of the diet on productive performance and egg quality of brown egg-laying hens differing in initial body weight. Poult Sci 2012;91:31563166. 26. Pardío V, Landín L, Waliszewski K, Pérez F, Díaz L, Hernández B. The effect of soybean soapstock on the quality parameters and fatty acid composition of the hen egg yolk. Poult Sci 2005;84:148-157. 27. Bouvarel I, Nys Y, Panheleux M, Lescoat P. Comment l’alimentation des poules influence la quite des oeufs. INRA. Product Anim 2010;23:167-182. 28. Whitehead C, Bowman A, Griffin H. The effects of dietary fat and bird age on the weights of eggs and egg components in the laying hens. Br Poult Sci 1991;32:565574. 29. Wiseman J. Full fat soya, oils and fats in poultry nutrition. Am Soybean Assoc. Bruselas, Bélgica, 1994. 30. Pérez-Bonilla A, Frikha M, Mirzaie S, García J, Mateos G. Effects of the main cereal and type of fat of the diet on productive performance and egg quality of brown-egg laying hens from 22 to 54 weeks of age. Poult Sci 2011;90: 2801-2810.

295

Rev Mex Cienc Pecu 2019;10(2):283-297

31. Pardío V, Landín L, Waliszewski K, Badillo C, Pérez F. The effect of acidified soapstocks on feed conversion and broiler skin pigmentation. Poult Sci 2001;80:1236-1239. 32. Pekel A, Demirel G, Midilli M, Yalcintan H, Ekiz B, Alp M. Comparison of broiler meat quality when fed diets supplemented with neutralized sunflower soapstock or soybean oil. Poult Sci 2012;91:2361-2369. 33. Souza J, Costa F, Queiroga R, Silva J, Schuler A, Goulart C. Fatty Acid Profile of Eggs of Semi-Heavy Layers Fed Feeds containing Linseed Oil. Braz J Poult Sci 2008;10(1):37-44. 34. Mazalli M, Faria D, Salvador D, Ito D. A comparison of the feeding value of different sources of fats for laying hens: 2. Lipid, cholesterol and vitamin E profiles of egg yolk. J Appl Poult Res 2004;13:280-290. 35. Celebi S, Macit M. The effects of sources of supplemental fat on performance, egg quality, and fatty acid composition of egg yolk in laying hens. J Sci Food Agr 2008;88:2382-2387. 36. Ranil C, Novinda A, Williams H, Jayasena V. Omega-3 fatty acid profile of eggs from laying hens fed diets supplemented with chia, fish oil, and flaxseed. J Food Sci 2015; 80:180-187. 37. Goyens P, Spilker M, Zock P, Katan M, Mensink R. Conversion of α-linolenic acid in humans is influenced by the absolute amounts of α-linolenic acid and linoleic acid in the diet and not by their ratio. Am J Clin Nutr 2006;84:44-53. 38. Nain S, Renema R, Korver D, Zuidhof M. Characterization of the n-3 polyunsaturated fatty acid enrichment in laying hens fed an extruded flax enrichment source. Poult Sci 2012;91:1720-1732. 39. Cachaldora P, García-Rebollar P, Álvarez C, Méndez J, de Blas JC. Effect of conjugated linoleic acid,high-oleic sunflower oil and fish oil dietary supplementation on laying hen egg quality. Span J Agric Res 2005;3(1):74-82. 40. da Silva W, Elias A, Aricetti J , Sakamoto M, Murakami A, Gomes S, J. Visentainer J, de Souza N, Matsushita M. Quail egg yolk (Coturnix coturnix japonica) enriched with omega-3 fatty acids. Food Sci Technol 2009;42:660-663. 41. Wood J, Enser M, Scollan N, Gulati S, Richardson I, Nute G. The effects of ruminally protected dietary lipid on the lipid composition and quality of beef muscle. Proc 47th Int Cong Meat Sci Technol. Warszawa: Meat and Fat Research Institute. 2001:Vol 1:186–187. 42. Simopoulos AP. The importance of the omega-6/omega-3 fatty acid ratio in cardiovascular disease and other chronic diseases. Exp Biol Med 2008;233:674-688.

296

Rev Mex Cienc Pecu 2019;10(2):283-297

43. Connor WE, Lowensohn R, Hatcher L. Increased docosahexaenoic acid levels in human newborn infants by administration of sardines and fish oil during pregnancy. Lipids 1996;31:S183-S187. 44. Simopoulos AP. An increase in the Omega-6/Omega-3 fatty acid ratio increases the risk for obesity. Nutrients 2016;8:1-17.

297

https://doi.org/10.22319/rmcp.v10i2.4529 Article

Quantifying ruminal fermentation and methane production using the in vitro gas technique in the forages of a sheep silvopastoral system in Chiapas, Mexico

Ángel Jiménez-Santiagoa Guillermo Jiménez-Ferrera* Armando Alayón-Gamboab Esaú de Jesús Pérez-Lunac Ángel Trinidad Piñeiro-Vázquezd Samuel Albores-Morenob Ma. Guadalupe Pérez-Escobara Ricardo Castro-Chand

ECOSUR (El Colegio de la Frontera Sur, Unidad SCLC), Departamento de Agricultura, Sociedad y Ambiente. Carr. Panamericana s/n, San Cristóbal de las Casas, Chiapas, México. b

ECOSUR (Unidad Campeche). Campeche, México.

UNACH (Universidad Autónoma de Chiapas), Facultad de Agronomía. Chiapas, México. d

Tecnológico Nacional de México. IT Conkal. Yucatán, México.

ECOSUR (Unidad Tapachula). Chiapas, México.

* Corresponding author: gjimenez@ecosur.mx

298

Rev Mex Cienc Pecu 2019;10(2):298-314

Abstract: Ruminal fermentation and methane production in a sheep silvopastoral system were quantified with the in vitro gas production technique. Evaluations were done of local energy sources (molasses, Zea mays L. and Musa paradisiaca L.), of the base forage (Panicum maximum cv. Tanzania), of forage tree foliage (Gliricidia sepium (Jacq.) and Leucaena leucocephala cv. Cunningham), and diets combining these elements. Ruminal fluid was collected from five sheep (Pelibuey x Katahdin; 40 ± 3 kg). Five treatments (diets) containing different mixtures of forage tree foliage, energy sources and the base forage were analyzed in a completely random experimental design. Maximum gas volume production (V) was observed in M. paradisiaca (544 ml/g-1 DM) and Z. mays (467 ml/g1 DM) (P≤0.05). The lowest V values were for the foliage of G. sepium (253 ml/g-1 DM) and L. leucocephala (180 ml/g-1 DM) (P≤0.05). Of the diets, D4GMP (48% P. maximum, 30% G. sepium, 7% Z. mays, 15% M. paradisiaca) had the highest V value. Methane production ranged from 6.31 to 9.60 L/Kg digested DM, and did not differ between treatments (P>0.05). Data were used to generate a potential fermentable gases emission index, which suggested that the diets containing slow fermenting carbohydrates resulted in higher gas emission rates. Inclusion of forage trees and local energy sources in sheep silvopastoral management systems can improve diet quality and contribute to reducing CH4 emissions. Key words: Mitigation, Climate Change, Energy, Agroforestry.

Received: 13/06/2017 Accepted: 29/05/2018

Introduction Livestock are key to the survival of more than 800 million of the world’s poor(1). However, animal production also contributes to natural resource degradation, environmental pollution and climate change(2), mainly through greenhouse gas (GHG) emissions(3). Tropical livestock farming in Latin America is primarily based on grazing native and introduced grasses in extensive systems(4), with little or no supplementation, minimal infrastructure and low capital investment(5). In this context, silvopastoral systems and use of local forage trees and shrubs have been shown to improve livestock production systems, reduce their environmental impact and contribute to GHG mitigation(6-9). In silvopastoral systems, the protein in the foliage of multiple-use trees (e.g. the genera Leucaena, Gliricidia and Erythrina, among others) degrades rapidly in the rumen. Addition of ingredients providing energy to the diet are therefore required to improve 299

Rev Mex Cienc Pecu 2019;10(2):298-314

rumen fermentation efficiency, synchrony and nutrient balance(10,11). High-quality commercial energy byproducts for use in livestock meat and dairy systems can be costly(12), highlighting the need to search for energy supplements among local resources that are both easily accessible and provide adequate nutritional value(13). The foliage of many forage trees contains secondary metabolites(14), and many of these can mitigate enteric methane emissions in ruminants(15,16). Indeed, the foliage from some forage trees is known to reduce rumen populations of protozoa and methanogenic archaea(17,18,19), leading to lower enteric CH4 synthesis and production(20). The present study objective was to evaluate the effect of addition of local energy sources on ruminal fermentation and methane emissions parameters when combined with forages in a sheep silvopastoral system involving P. maximum supplemented with Gliricidia sepium and Leucaena leucocephala foliage.

Materials and methods

Study area

Materials were obtained from a sheep ranch managed with silvopastoral techniques and located in the municipality of Chiapa de Corzo, in the state of Chiapas, Mexico (16°42’ N; 93°00' W). Altitude at the ranch ranges from 400 to 450 m asl, average annual precipitation in the region is 900 mm, and average annual temperature is 26.0 °C. Soils in the area are mainly clay loam, with 2.4 % organic matter content, 7.0 pH, and slightly poor nitrogen content (0.15 %)(21). Ranch surface area is 12 ha and average herd size is 55 Pelibuey x Katahadin sheep. Of the total area 10 ha is covered with Tanzania grass (P. maximum) with living fences consisting of the trees L. leucocephala, G. sepium and Cordia dentata (Vahl). Several paddocks (3 ha) contain L. leucocephala in alleys, and trees such as Enterolobium cyclocarpum (Jacq) and Ceiba pentandra L. are scattered across 7 ha of grazing areas. A nature reserve of dry tropical forest covers 2 ha. No chemical fertilization of pastures is done. Paddocks are managed in a rotation controlled by electric fences, and pastures are irrigated in the dry season. Animal production is focused on lamb meat for sale in regional and national markets.

Feed chemical analysis

Dry matter (DM) content of the forages and supplements was determined by drying in a forced air stove at 55 °C for 48 h (constant weight) and processing following the 300

Rev Mex Cienc Pecu 2019;10(2):298-314

regulation NOM-116-SSA1-1994. Crude protein content was measured by an internal method (ECOSUR-ET-BR04) based on the standard NMX-F-608-NORMEX-2002. Organic matter (OM) content was measured by incineration in a muffle oven at 550 Â°C for 3 h according to the standard NMX-F-607-NORMEX-2002. Neutral detergent fiber (NDF) and acid detergent fiber (ADF) were quantified following Van Soest(22), using the sequential procedure, with alpha-amylase and no ash correction in all samples (AOAC)(23). Condensed tannins were measured with the acidified vanillin method (1% w/v vanillin in methanol)(24).

In vitro gas production

An in vitro gas assay was done following the cumulative gas technique suggested by Theodorou(25) and Williams(26). Five diets (treatments) were designed using six raw materials, (Table 1): P. maximum as base forage (control); G. sepium and L. leucocephala foliage as protein sources; and molasses, Zea mays and M. paradisiaca as energy sources. Diets were isoenergetic and isoproteic, and formulated to meet the demands of adult sheep in the evaluated silvopastoral unit: 2,200 kcal/kg, 14% crude protein (CP). Table 1: Treatments and percent ingredients used in in vitro gas experiment

P. maximum

G. sepium

L. leucocephala

M. paradisiaca

Z. mays

Molasses

100 0

0 100

0 0

L100

100

MP100

100

Z100

100

M100

100

D1LM

D2LMP

D3GM

D4GMP

D5GLMPM

Feed P100 (control) G100

Treatments

P100 (control) = P. maximum; G100= G. sepium; L100= L. leucocephala; MP100 = M. paradisiaca; Z100= Z. mays; M100 = molasses; D1LM= 47% P. maximum, 30% L. leucocephala, 8% Z. mays, 15% molasses; D2LMP= 47% P. maximum, 30% L. leucocephala 8% Z. mays, 15% M. paradisiaca; D3GM= 47% P. maximum, 30% G. sepium, 8% Z. mays, 15% molasses ; D4GMP= 48% P. maximum, 30% G. sepium, 7% Zea mays, 15% M. paradisiaca; D5GLMPM= 47% P. maximum, 16% G. sepium 17% L. leucocephala, 5% M. paradisiaca, 5% Z. mays, 10% molasses.

Sheep were managed and ruminal fluid extracted from them according to Alexander and McGowan(27) and Blummel and Orskov(28), and following the animal welfare norms of the ECOSUR Sustainable Livestock Production Research Group. Ruminal fluid was extracted from five ewes in the experimental area; all had a live weight of 40.0 Âą 3.0 kg, 301

Rev Mex Cienc Pecu 2019;10(2):298-314

were of similar ages and good body condition. An esophageal probe was used to extract 300 ml ruminal fluid from each animal, for a total of 1.5 L ruminal fluid. All ruminal fluid samples were stored at 39 Â°C and protected from sunlight. In vitro fermentation of each treatment was done by introducing 0.5 Âą 0.001 g substrate in 90 ml amber glass vials and evaluating fermentation as represented by gas production at different times (0, 2, 4, 6, 8, 10, 12, 16, 20, 24, 30, 36, 48, 60, 72 h). Three replicates were done per treatment. The pressure generated in each vial was monitored with an analog manometer (Metron Mod. 63100, Range: 0-1 kg/cm2), and the resulting data used to calculate six response variables: maximum gas volume (V); gas production rate (S); lag phase (L); rapid fermentation fractional gas volume generated in first eight hours (V8); intermediate fermentation volume generated from eight to 24 h (V24); and slow fermentation volume generated from 24 to 72 h (V72). Two batches were incubated simultaneously, each comprised of three replicates (vials) per feed and treatment. In the first batch total accumulated gas production at 72 h was evaluated in each fermentable fraction: rapid, intermediate and slow. For each fraction three groups of fermentable carbohydrates were estimated (monosaccharides, starch and cellulose) based on the gas volumes recorded in three time intervals: 0 to 8 h incubation (Vf0-8); 8 to 24 h (Vf8-24); and 24 to 72 h (Vf24-72). These volumes were used to estimate the rapid (FR), intermediate (FI) and slow (FS) fermentable fractions using the linear regression equations proposed by Miranda et al(29): FR = Vf0-8/0.4266, FI = Vf8-24/0.6152, and FL = Vf24-72/0.3453). Values for accumulated gas production were fit to the model of Menke and Steingas(30):

Y= v/ (1+exp (2-4*s*(t-L))), Where: Y = Total volume of gas produced; v = Maximum production volume; s = Constant gas production rate; t = Time; L = Lag or delay phase.

In vitro dry matter digestibility (IVDMD) was measured by gravimetric analysis, considering initial dry matter weight, and final weights at 24 and 72 h fermentation. Dry matter (DM) weight was measured by recovering the matter with a 200 Îźm filter and drying at 65 Â°C to constant weight. Calculation of IVDMD was done with the formula: % đ?&#x2018;°đ?&#x2018;˝đ?&#x2018;Ťđ?&#x2018;´đ?&#x2018;Ť =

đ?&#x2018;°đ?&#x2018;žâ&#x2C6;&#x2019;đ?&#x2018;đ?&#x2018;ž

302

đ?&#x2018;°đ?&#x2018;ž

â&#x2C6;&#x2014; đ?&#x;?đ?&#x;&#x17D;đ?&#x;&#x17D;,

Rev Mex Cienc Pecu 2019;10(2):298-314

Where: % IVDMD = percentage in vitro dry matter digestibility; IW = initial weight incubated dry matter in grams; FW = final weight incubated dry matter in grams.

Using the data for IVDMD24/72 and emitted gas volumes a potential fermentable gas emission index (PFGEI) was generated. This refers to the amount of gas that can be produced by a substrate per gram of fermented DM or OM in the rumen(31).

Methane and carbon dioxide production

Production of CO2, CH4 and minor gases was analyzed during the first 24 hours of fermentation in samples from the second incubation batch. Following Bartha and Pramer(32) as modified by Miranda(29), CO2 separation was done using a trap (hermetically sealed glass jar with rubber stopper and aluminum ring) containing 90 ml 1 M potassium hydroxide (KOH) and a dilution of 56.10 g KOH in 1 L deionized water. Samples were taken and placed in sterile vials under a vacuum for later analysis with gas chromatography and quantification of CH4 for each substrate. Analysis of CH4 production was done in a gas chromatographer (Clarus 500, Perkin Elmer; Software version 6.3.2.0646; 0.530 mm column diameter; 50 m length; 35 °C injection temperature). Analysis was done of a total of 36 samples collected during the 24 h in vitro fermentation, in the second incubation run; 20 µl of sample were used in each assay. Correction of CH4 concentrations was done for each treatment by subtracting average methane production from the three blanks. For the purposes of calculating CH4 concentration and the effect of the treatments on CH4 production, it was expressed as L CH4/kg DMDIG.

Statistical analysis

Gas production parameters, IVDMD and methane production were analyzed with an ANOVA in a completely random design. The mathematical model was:

Yij    Ti   ij Where: Yij= Response variable in j-th replicate (flasks) of i-th treatment; μ= overall mean of all experimental data; 303

Rev Mex Cienc Pecu 2019;10(2):298-314

Ti = Effect of treatment I;

Îľij = experimental error associated with j under treatment i. Data from all the response variables were processed with an ANOVA(33), and differences between treatment means compared with a Tukey test (Pâ&#x2030;¤0.05) using the PROC GLM procedure in the SAS statistics package(34).

Results and discussion

Analysis of forage, energy source and treatment (diet) chemical composition showed crude protein (CP) content to be high in the G. sepium and L. leucocephala foliage (Table 2); indeed, it was higher than reported elsewhere(32,33). As expected, the energy sources had low CP and NDF contents. The grass P. maximum (control) had a CP higher than the 7 to 9 % average in many tropical grasses. This relatively high grass CP may be linked to natural fertilization via sheep feces in the studied controlled grazing management system. The P. maximum also had high NDF and ADF contents. Compared with previous reports(35,36), the L. leucocephala leaves analyzed in the present study contained very little tannins (CT). This discrepancy could be due to variability in the nutritional value of foliage from the same fodder tree species in response to site conditions, management, phenological stage and specific characteristics of the study area(37). Lignin content in L. leucocephala was high but within the range suggested by the FAO. This lignin content very probably affected the digestibility of L. leucocephala, and ration components, reducing energy use(38,39).

304

Rev Mex Cienc Pecu 2019;10(2):298-314

Table 2: Chemical composition (g/Kg DM) of forages, energy sources, and treatments used in in vitro gas experiment DM

Lignin

NDF

ADF

CHO

P. maximum (control)

933

853

124

103

712

490

231

G. sepium

930

889

367

133

353

250

269

L. leucocephala

932

883

261

207

462

308

352

M. paradisiaca

925

953

137

763

Z. mays

866

984

795

Molasses

788

866

600

D1LM

906

874

149

111

481

324

368

D2LMP

926

887

149

111

501

329

392

D3GM

905

876

181

448

307

343

D4GMP

926

888

182

474

317

361

D5GLMPM

914

877

172

105

482

326

349

DM= dry matter; OM = organic matter; CP= crude protein; NDF= neutral detergent fiber; ADF = acid detergent fiber; CT= condensed tannins; CHO= carbohydrates; NA = not analyzed. * https://www.feedipedia.org/01/05/2018. ; D1LM= 47% P. maximum, 30% L. leucocephala, 8% Z. mays, 15% molasses; D2LMP= 47% P. maximum, 30% L. leucocephala, 8% Z. mays, 15% M. paradisiaca, D3GM= 47% P. maximum, 30% G. sepium, 8% Z. mays, 15% molasses; D4GMP= 48% P. maximum, 30% G. sepium, 7% Z. mays, 15% M. paradisiaca; D5GLMPM= 47% P. maximum, 16% G. sepium, 17% L. leucocephala. 5% M. paradisiaca, 5%, Z. mays, 10% molasses.

Gas production data at 8, 24 and 72 h fermentation showed the highest gas volumes (V) to be 544.0 ml/g-1 DM in MP100 (M. paradisiaca), 467.3 ml/g-1 DM in Z100 (Z. mays) and 325.7 ml/g-1 DM in M100 (molasses)(Table 3). These levels differed (P<0.05) between each other and from the diets. This behavior is typical of foods containing carbohydrates such as monosaccharides and starches(40). Both G. sepium (G100) and L. leucocephala (L100) had relatively low gas production volumes (V), which differed from each other (P<0.05) (Figure 1). These low production levels may be due to the presence of secondary metabolites (tannins) in L. leucocephala(40), and/or the high lignin and fiber contents in both speciesâ&#x20AC;&#x2122; leaves (111 g/kg DM), all of which can result in lower gas production compared to higher carbohydrate content diets(41). Treatments with energyprotein mixtures had higher gas production (V) (P<0.05) due to the additive effect of the carbohydrates to L. leucocephala and G. sepium leaves (Figure 2). Overall, gas production rate (S) was similar among the treatments although slight differences were present (P<0.05).

305

Rev Mex Cienc Pecu 2019;10(2):298-314

Table 3: Total gas production parameters and fractional volumes in feed ingredients and treatments in in vitro gas production experiment Fractional volumes (ml g-1 DM)

Parameters Feed ingredients

V (ml / g-1 DM)

S (ml h-1)

L (h)

V24

V72

266.3de 253.0e 180.8f 544.9a 467.3b 325.7c

0.03ab 0.03ab 0.03ab 0.03ab 0.04a 0.04a

11.2a 9.0b 2.7f 3.7ef 6.2c 2.6f

15.1e 28.7ed 40.6cd 117.7a 44.1cd 71.6b

100.5d 85.9de 63.2e 250.0a 271.2a 166.9b

159.7b 144.8bcd 81.9e 206.4a 194.7a 119.5d

299.8cd 308.9cd 293.6cde 337.4c 292.3cde

0.03b 0.03ab 0.03ab 0.03ab 0.03ab

4.7cde 5.7cd 4.5de 5.6cd 3.6fe

51.7c 46.8c 54.0c 52.6c 57.5cb

105.0c 119.7cd 115.6cd 147.1bc 122.2cd

149.9bc 152.4bc 134.3bcd 151.5cb 128.7cd

P100 (control) G100 L100 MP100 Z100 M100 Treatments D1LM D2LMP D3GM D4GMP D5GLMPM

V = maximum gas production volume; S = constant gas production rate; L = Lag phase (h); V 8 = fractional volume generated in rapid fermentation fraction (0-8 h); V24 = fractional volume generated in intermediate fermentation fraction (8-24 h); V72 = fractional volume generated in slow fermentation fraction (24-72 h). P100 (control)= P. maximum; G100= G. sepium; L100= L. leucocephala; MP100= M. paradisiaca; Z100= Z. mays; M100 = molasses; D1LM= 47% P. maximum, 30% L. leucocephala, 8% Z. mays, 15% molasses; D2LMP= 47% P. maximum, 30% L. leucocephala, 8% Z. mays, 15% M. paradisiaca; D3GM= 47% P. maximum, 30% G. sepium, 8% Z. mays, 15% molasses; D4GMP= 48% P. maximum, 30% G. sepium, 7% Z. mays, 15% M. paradisiaca; D5GLMPM= 47% P. maximum, 16% G. sepium, 17% L. leucocephala, 5% M. paradisiaca, 5% Z. mays, 10% molasses. abcdef

Different letter superscripts in the same column indicate significant differences between treatments (Îą= 0.05).

Figure 1: Gas volume over time in control treatment and raw material ingredients in in vitro gas production trial 80

Raw Materials

Gas Volume (ml g/ g DM)

P100 (control) G100 L100 MP100 Z100 M100

60 50 40 30 20 10 0

Incubation

(h-1)

P100 (control)= Panicum maximum; G100= Gliricidia sepium; L100= Leucaena leucocephala; MP100= Musa paradisiaca; Z100= Zea mays; M100= molasses.

306

Rev Mex Cienc Pecu 2019;10(2):298-314

Figure 2: In vitro gas production (ml gas/h) of five diets used in sheep in a silvopastoral system in Chiapas, Mexico.

Gas Volume (ml g/h)

50 45

D1LM

D2LMP

D3GM

D4GMP

D5GLMPM

20 15 10 5 0 0

12 16 20 24 30 36 42 48 60 72 Incubation (h-1)

P100 (control)= P. maximum; D1LM= 47% P. maximum, 30% L. leucocephala, 8% Z. mays, 15% molasses; D2LM= 47% P. maximum, 30% L. leucocephala, 8% Z. mays, 15% M. paradisiaca; D3GM= 47% P. maximum, 30% G. sepium, 8% Z. mays, 15% molasses; D4GMP= 48% P. maximum, 30% G. sepium, 7% Zea mays, 15% M. paradisiaca; D5GLMPM= 47% P. maximum, 16% G. sepium, 17% L. leucocephala, 5% M. paradisiaca, 5% Z. mays, 10% molasses.

The fermentation profiles clearly varied between the energy sources, forages and treatments. Energy sources such as bananas (MP100) and molasses (M100) began to ferment quickly, increased gas production during the intermediate incubation phase and then declined rapidly. In the treatments containing mixtures of forages with energy sources gas production and fermentation rate were initially slow but increased notably in the intermediate phase and remained higher for longer (Figure 2). During fermentation the substrate is hydrated and colonized by ruminal microorganisms. The quantity and type of carbohydrates present in the substrate influence gas volume and its effect on DM digestibility(42,43). In vitro dry matter digestibility (IVDMD) was lowest at 72 h with P. maximum (50.9 %) and L. leucocephala (29.9 %), which differed from G. sepium and the diets (P≤0.05) (Table 4). The IVDMD values for L. leucocephala were lower than reported in other in vitro and in vivo studies(34,42,43), probably due to the maturity of the forage tree foliage used in the present study and its consequently high lignin content. At both 24 and 72 h IVDMD was highest (P≤0.05) in M100 (Z. mays), Z100 (molasses) and MP100 (M. paradisiaca). The treatments (D1LM, D2LMP, D3GM, D4GMP and D5GLMPM) exhibited a range of values between these highs and lows (P<0.05). The linear increases observed in the treatments resulted from the contributions of G. sepium and L. leucocephala foliage to fermentation and digestibility (Figure 1). Inclusion of energy sources (D3GM and D4GMP) improved digestibility (P≤0.05) compared to D2LMP, and 307

Rev Mex Cienc Pecu 2019;10(2):298-314

P100 and L100 (P≤0.05). The digestibility observed for G. sepium was similar to that reported elsewhere(43). The energy sources’ (MP100, Z100 and M100) high digestibility was due to their high soluble sugars contents. When diets are balanced with high G. sepium and molasses contents, digestibility and utilization are higher due to the synchrony between protein and energy contents(44).

Table 4: CH4, CO2, IVDMD, PFGEI and Total CH4 produced by fermentation of treatments in in vitro gas production experiment Treatments P100 (control) G100 L100 MP100 Z100 M100

CH4 (%)

CO2 (%)

IVDMD 24 h (%)

IVDMD 72 h (%)

22.5bcd

77.5abc

33.7f

50.9e

791.0a

523.5cd

1.55d

bcd

abc

1.68d

1.94d

15.75b

28.59a

9.03c

8.82c

23.2

30.8

a,b

18.1

16.4

17.9

d a

76.8

69.2

81.9

83.6

82.1

68.1

51.0

28.8

77.0

80.1

92.7

44.4

60.1

29.9

83.6

87.0

92.4 56.6

PFGEI/DM PFGEI/DM 24 h 72 h

496.8 628.1

bcd

708.1 583.6

cde

351.4 678.6

420.9 606.6

652.1 537.2

352.5 529.7

CH4 (L CH4/kg DMDIG)

D1LM

31.9

D2LMP

27.0abc

73.0bcd

44.9de

50.9e

690.0b

606.5ab

8.83c

D3GM

24.2abcd

75.8abcd

55.1c

61.9c

533.0de

474.2de

6.32cd

D4GMP

21.9cd

78.1ab

54.5c

61.1cd

619.4bcd

552.1bc

9.60c

D5GLMPM

22.3bcd

77.7abc

51.7c

56.6d

565.5de

516.9cd

6.31cd

CH4= in vitro methane + minor gases; CO2= in vitro carbon dioxide; IVDMD 24 h= in vitro dry matter digestibility at 24 h; IVDMD 72 h= in vitro dry matter digestibility at 72 h; PFGEI/DM 24 h= potential fermentable gas emission index at 24 h; PFGEI/DM 72 h= potential fermentable gas emission index at 72 h; CH4= methane concentration at 24 h. P100 (control)= P. maximum; G100= G. sepium; L100= L. leucocephala; MP100= M. paradisiaca; Z100= Z. mays; M100= molasses; D1LM= 47% P. maximum, 30% L. leucocephala, 8% Z. mays, 15% molasses; D2LMP= 47% P. maximum, 30% L. leucocephala, 8% Z. mays, 15% M. paradisiaca; D3GM= 47% P. maximum, 30% G. sepium, 8% Z. mays, 15% molasses; D4GMP= 48% P. maximum, 30% G. sepium, 7% Z. mays, 15% M. paradisiaca; D5GLMPM= 47% P. maximum, 16% G. sepium, 17% L. leucocephala, 5% M. paradisiaca, 5% Z. mays, 10% molasses. abcdef Different letter superscripts in the same column indicate significant differences between treatments (α= 0.05).

Total CH4 production (L/Kg DMDG) was highest in the Z. mays (Z100) and M. paradisiaca (MP100) energy sources (P≤0.05) (Table 4). The lowest production values were in the control (P100), G. sepium (G100) and L. leucocephala (L100), which did not differ (P>0.05). The diet treatments (D5GLMPM, D3GM, D1LM, D2LMP and D4GMP) exhibited intermediate values (P>0.05). Of the treatments containing mixed energy source and protein, D5GLMPM had the lowest CH4 production, highlighting the importance of associating forages with carbohydrates(45,46). These authors emphasize that carbohydrate type determines transit time, thus affecting CH4 production per gram of digested substrate. Carbohydrate type appears to be a determining factor in CH4 production(47), since it can be mediated by lower availability of digestible 308

Rev Mex Cienc Pecu 2019;10(2):298-314

carbohydrates(48). Concentrations of 550 g kg-1 DM surpass the concentration which negatively affects voluntary consumption of feed and nutrient digestibility in animals(49). In addition, tree and shrub foliage contains low concentrations of structural fractions(44), making them more susceptible to degradation and bacterial action, resulting in increased transit time, which decreases total gas production and therefore results in lower enteric CH4 production(36,50). Both research and development agencies have been focusing on quantification of GHG from ruminal fermentation, creation of indices to evaluate the potential for environmental pollution from ruminal GHG, and design of sustainable animal management strategies(51,52). In the present results wide variation (P<0.001) was apparent in the PFGEI/DM, both at 24 and 72 h, and in the evaluated energy sources and treatments (Table 4). Of note is that the lowest PFGEI rates at 24 and 72 h correspond to M100 (496.8 ml.g-1/IVDMD) and G100 (420.9 ml.g-1/IVDMD), whereas the highest rates occurred with MP100 at 24 h (708.1 ml.g-1/IVDMD) and 72 h (652.1 ml.g-1/IVDMD). Of the treatments including tree foliage and energy sources, the lowest index corresponded to the D3GM mixture. The present data suggest that the type of foliage from forage trees, in association with carbohydrate type, can affect ruminal GHG production, especially if the carbohydrate exhibits slow fermentation, as is the case with starches(53).

Conclusions and implications

The present results suggest that in silvopastoral systems the combination of foliage from forage trees with local energy sources, especially molasses and bananas, can improve diet nutritional value and animal production parameters while mitigating generation of greenhouse gases such as methane. The combination of 30% DM foliage from trees such as G. sepium and L. leucocephala with local energy sources such as molasses and bananas contributed to lowering CH4 emission in sheep. Management of forage trees (e.g. G. sepium and L. leucocephala) is recommended in silvopastoral systems because they improve diet quality, particularly when combined with local energy sources, and contribute to lowering CH4 emissions. Future research will need to address animal response (e.g. weight gain) and bio-economic balance in these systems to understand how to make them economically and socially viable, and to develop adaptation strategies that will improve animal production, contribute to producersâ&#x20AC;&#x2122; social welfare and mitigate greenhouse gas emission.

Acknowledgements

309

Rev Mex Cienc Pecu 2019;10(2):298-314

The research reported here was financed by the SEP-CONACYT through the project “Cuantificación de emisiones de metano entérico y óxido nitroso en ganadería bovina en pastoreo y diseño de estrategias para la mitigación en el sureste de México” (SEPCONACYT CB 2014-1 No. 242541).

Literature cited: 1.

FAO. Food and Agriculture: Key to Achieving in the 2030. Agenda for Sustainable Development. FAO, Rome. 2016.

IPCC. Climate Change 2014: Impacts, adaptation, and vulnerability report of the Intergovernmental Panel on Climate Change. Field C, et al. editors. Cambridge, UK 2014.

O´Mara FP. The significance of livestock in global greenhouse gas emissions today and in the near future. Anim Feed Sci Technol 2011;(166-167):7–15.

Ibrahim M, Chacón M, Cuartas C, Naranjo J, Ponce G, Vega P, Casasola F, Rojas J. Almacenamiento de carbono en el suelo y la biomasa arbórea en sistemas de usos de la tierra en paisajes ganaderos de Colombia, Costa Rica y Nicaragua. Agroforestería las Américas 2007;(45):27–36.

Avila-Foucalt V, Revollo FD. Análisis financiero y percepción de los servicios ambientales de un sistema silvopastoril: un estudio de caso en los Tuxtlas, México. Rev Iber Econ Ecol 2014;(21):17-33.

Solorio S, Wright M, Franco M, Basu S, Sarabia S, Ramirez L, et al. Silvopastoral systems: Best agroecological practice for resilient production systems under dryland and drought conditons. Ahmed M, Stockle C. editors. Quantificaction of climate variability, adaptation and mitigation for agricultural sutainability. Australis: Springer; 2002:233-250.

Murgueitio E, Chará J, Barahona R, Cuartas C, Naranjo J. Los Sistemas Silvopastoriles Intensivos (SSPI), herramienta de mitigación y adaptación al cambio climático. Trop Subtrop Agroecosystems 2014;(17):501–507.

Palmer L. A new climate for grazing livestock. Nat Clim Chang 2014;(4):321–323.

Ibrahim M, Villanueva C, Casasola F. Sistemas silvopastoriles como una herramienta para el mejoramiento de la productividad y rehabilitación ecológica de paisajes ganaderos en Centro América. Agroforesteria las Américas 2007;(15):1–34.

10. Kass ML. Determinación del nitrógeno en los alimentos. Ruiz, M, Ruiz A. editores. Nutrición de rumiantes, Guía Metodológica de Investigación. Costa Rica, ALPARISPAL 1990:49–58.

310

Rev Mex Cienc Pecu 2019;10(2):298-314

11. Sirohi SK. Mitigation options for enteric methane emissions from dairy animals: an evaluation for potential projects in India. Mitig Adapt Strateg Glob Chang 2007;(12):259–274. 12. Piñeiro-Vázquez A, Ayala-Burgos A, Chay-Canul A, Ku-Vera J. Dry matter intake and digestibility of rations replacing concentrates with graded levels of Enterolobium cyclocarpum in Pelibuey lambs. Trop Anim Health Prod 2013;(45):577–583. 13. Jiménez-Ferrer G, Mendoza-Martinez G, Soto-Pinto L, Alayón-Gamboa A. Evaluation of local energy sources in milk production in a tropical silvopastoral system with Erythrina poeppigiana. Trop Anim Health Prod 2015;(47):903–908. 14. Norton B. Anti-nutritive and toxic factors in forage tree legumes. Gutteridge R, Shelton H editors. Forage tree legumes in tropical agriculture. UK: Cab International; 1993:202–215. 15. Piñeiro-Vázquez A, Canul-Solís J, Alayón-Gamboa J, Chay-Canul A, Ayala-Burgos A, Aguilar-Pérez C, et al. Potential of condensed tannins for the reduction of emissions of enteric methane and their effect on ruminant productivity. Arch Med Vet 2015;(47):263–272. 16. Yáñez-Ruiz D, Hart K, Martin-Garcia A, Ramos S, Newbold C. Diet composition at weaning affects the rumen microbial population and methane emissions by lambs. Aust J Exp Agric 2008;(48):186–188. 17. Min B, Solaiman S, Shange R, Eun J. Gastrointestinal bacterial and methanogenic Archaea diversity dynamics associated with condensed tannin-containing pine bark diet in goats using 16S rDNA amplicon pyrosequencing. Int J Microbiol 2014; Article ID 141909, 11 pages. doi.org/10.1155/2014/141909 18. Herrera-López M, Rivera-Lorca J, Ortega-Reyes L, Escobedo-Mex J, Magaña M, Sanginés-García J, Sierra-Vázquez Á, Contenido nutritivo y factores antinutricionales de plantas nativas forrajeras del norte de Quintana Roo. Tec Pecu Mex 2008;(46):205–215. 19. Puchala R, Animut G, Patra A K, Detweiler G D, Wells J E, Varel V H, Sahlu T, Goetsch A. Methane emissions by goats consuming Sericea lespedeza at different feeding frequencies. Anim Feed Sci Technol 2012;(175):76–84. 20. Soltan YA, Morsy AS, Lucas RC, Abdalla AL. Potential of mimosine of Leucaena leucocephala for modulating ruminal nutrient degradability and methanogenesis. Anim Feed Sci Technol 2017; (223):30–41. 21. Pérez Esaú, Soca Mildrey, Díaz L, Corzo M. Comportamiento etológico de bovinos en sistemas silvopastoriles en Chiapas, Pastos y Forrajes 2008;(31):161-172.

311

Rev Mex Cienc Pecu 2019;10(2):298-314

22. Van-Soest, P, Robertson J, Lewis B. Methods for dietary fiber, neutral detergent fiber, and non-starch polysaccharides in relation to animal nutrition, J Dairy Sci 1991;74:3583–3597. 23. AOAC. Official Methods for Analysis. Association of Official Analysis Chemist, Gaitersburgh, MD, USA. 2006. 24. Price ML, Van SC, Butler L. A critical evaluation of the vanillin reaction as an assay for tannin in sorghum grain, J Agric Food Chem, 1978;26(5):1214-1218. doi: 10.1021/jf60219a031 25. Theodorou M K, Williams BA, Dhanoa M S, McAllan AB, France J. A simple gas production method using a pressure transducer to determine the fermentation kinetics of ruminant feeds. Anim Feed Sci Technol 1994;(48):185–197. 26. Williams, BA. Cumulative gas-production techniques for forage evaluation. In: Forage evaluation in ruminant nutrition. Givens, D et al., editors. UK : CABI, Pub; 2000:189-213. 27. Alexander RH, McGown M. The routine determination of in vitro digestibility of organic matter in forages-an investigation of the problems associated with continuos large-scale operation. J Brit Grass Soc 1966;(21):140-147. 28. Blummel M, Orskov ER. Comparison of in vitro gas production and nylon bag degradability of roughages in predicting food intake in cattle. Anim Feed Sci Technol 1993;(40):109-119. 29. Miranda LA, Vázquez MP, Améndola MR, Sandoval GL, González OR. Cuantificación de las fracciones fermentables de alfalfa y tuna por la técnica de producción de gas [resumen]. Congreso de la Asociación Latinoamericana de Producción Animal. Puerto Varas, Chile. 2015:575. 30. Menke K, Steingass H. Estimation of the energetic feed value obtained from chemical analysis and in vitro gas production using rumen fluid. Anim Res Dev 1988;(28):7–55. 31. Cáceres LM. Índice de contaminación atmosférica y productividad de vacas Jersey y sus cruzas con Holstein en pastoreo, [tesis maestría]. Texcoco, México. Universidad Autónoma Chapingo; 2016. 32. Bartha R, Pramer D. Features of flask and method for measuring the persistence and biological effects of pesticides in soil. Soil Sci. 1965; 100; (1): 68-70 33. Cochran WG, Cox GM. Diseños experimentales. 2ª ed. México: Trillas; 1991. 34. SAS. User´s Guide SAS/STAT. Sas Institute, Cary, NC, USA. 2015. 35. Abdulrazak S, Muinga R, Thorpe W, Ørskov ER. Supplementation with Gliricidia sepium and Leucaena leucocephala on voluntary food intake, digestibility, rumen 312

Rev Mex Cienc Pecu 2019;10(2):298-314

fermentation and live weight of crossbred steers offered Zea mays stover. Livest Prod Sci 1997;(49):53–62. 36. Morgavi D P, Archimède H, Marie-Magdeleine C, Popova M, Bousseboua H, Doreau M. Potential of tannin-rich plants for modulating ruminal microbes and ruminal fermentation in sheep. J Anim Sci 2015;(93):334-347. 37. Borel, R. Nutrición de rumiantes: Aspectos críticos de las metodologías de evaluación nutritiva de árboles y arbustos forrajeros. Guía metodológica de investigación. ALPA-IICA, Costa Rica 1990:21-31. 38. Piñeiro-Vázquez AT, Jiménez-Ferrer G, Chay-Canul AJ, Casanova-Lugo F, DíazEcheverría VF, Ayala-Burgos A, et al. Intake, digestibility, nitrogen balance and energy utilization in heifers fed low-quality forage and Leucaena leucocephala. Anim Feed Sci Technol 2017. Vol. 228, pag. 194-201. doi.org/10.1016/j.anifeedsci. 2017.04.009 39. Van Soest PJ. Development of a comprehensive system of feed analyses and its application to forages. J Anim Sci 1967;(26):119–128. 40. Van Soest PJ. Nutritional ecology of the ruminant. Corvallis, Oregon: O&B Books Inc; 1982. 41. Cárdenas J, Sandoval C, Solorio F. Composición química de ensilajes mixtos de gramíneas y especies arbóreas de Yucatán. Tec Pecu Méx 2003;(41):283–294. 42. Juárez F, Contreras J, Montero M. Tasa de cambios con relación a edad en rendimiento, composición química y digestibilidad de cinco pastos tropicales. Decima Cuarta Reun Cient Tecnol Forest Agropecu. Veracruz, Mex. 2001. 43. Williams BA. Cumulative gas-production technique for forage evaluation. Eds: Givens D, et al. editors. Forage Evaluation in Ruminant Nutrition, UK 2000; 189213. 44. Reed J. Nutritional toxicology of tannins and related polyphenols in forage legumes. J Anim Sci 1995;(73):1516-1528. 45. Molina-Botero C, Cantet J, Montoya S, Correa-Londoño G, Barahona-Rosales R. In vitro methane production from two tropical grasses alone or in combination with Leucaena leucocephala or Gliricidia sepium. CES Med Vet y Zootec 2013;(8):15– 31. 46. Archiméde H, Rira M, Barde D, Labirin F, Marie-Magdeleine C, et al. Potential of tannin-rich plants, Leucaena leucocephala, Glyricidia sepium and Manihot esculenta, to reduce enteric methane emissions in sheep. J Anim Physiol Anim Nutr 2016;(100):1149–1158.

313

Rev Mex Cienc Pecu 2019;10(2):298-314

47. Fernández-Mayer A. Efecto de la sincronización de energía-proteína sobre la performance animal. EEA INTA Bordenave 2001:7–13. 48. Eugene M, Archimèede H, Sauvant, D. Quantitative metanalysis on the effects of defaunation of the rumen on growth, intake and digestion in ruminants, Livestock Prod Sci 2004;85:81-97. 49. Van Soest PJ. Symposium on factors influencing the voluntary intake of herbage by ruminants: voluntary intake in relation to chemical composition and digestibility. J Anim Sci1965: 4(3):834-843. 50. Animut G, Puchala R, Goetsch AL, Patra AK, Sahlu T, Varel VH, Wells J. Methane emission by goats consuming diets with different levels of condensed tannins from lespedeza. Anim Feed Sci Technol 2008;(144):212-227. 51. Johnson KA, Johnson DE. Methane emissions from cattle. J Anim Sci 1995;73 (8):2483–2492. 52. McAllister TA, Cheng KJ, Okine EK y Mathison GW. Dietary, environmental and microbiological aspects of methane production in ruminants. Can J Anim Sci 1996;76(2):231-243. 53. Nunes L, Salomon S, Castro L, Robson E, Abdalla A. Chemical composition, degradability and methane emission potential of banana crop residues for ruminants. Trop Subtrop Agroecosyst 2014;(17):197–206.

314

https://doi.org/10.22319/rmcp.v10i2.4483 Article

Evaluation of nutritional methods to reactivate preserved ruminal inoculum assessed through in vitro fermentation kinetics and forage digestibility

María G. Domínguez-Ordóñez a Luis A. Miranda-Romero a Pedro A. Martínez-Hernández a Maximino Huerta-Bravo a Ezequias Castillo-Lopez b*

Universidad Autónoma Chapingo. Departamento de Zootecnia, 56220. Texcoco, Estado de México, México.

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán, Medicina Veterinaria y Zootecnia. Cuautitlán, Estado de México, México.

*Corresponding author: ezequias@huskers.unl.edu

Abstract: This study evaluated the effect of the media and pre-incubation time for reactivating preserved ruminal inoculum, assessed through in vitro fermentation kinetics and dry matter digestibility (IVDMD). In the first experiment, treatments were 1) CONTROL, fresh ruminal fluid, 2) LOW24, inoculum reactivated by 24 h pre-incubation in a basal culture solution, 3) MODE24, inoculum reactivated by 24 h pre-incubation in basal culture solution, yeast extract and peptone from casein; and 4) HIGH24, inoculum reactivated by 24 h pre-incubation in basal culture solution, yeast extract, peptone from casein and carbohydrates. In the second experiment, treatments evaluated were 1) CONTROL, fresh ruminal fluid, and 2) HIGH12, similar to HIGH24 but inoculum was pre-incubated for 12 h. Each experiment included three replicates. Maximum gas volume (Vm), lag phase (L), gas production rate (S) and IVDMD were measured using four fermentation substrates. Main effects of inoculum and fermentation substrate, and interactions, were analyzed. Compared to CONTROL, Vm, L and S were negatively affected (P<0.01) by preservation of inoculum. However, HIGH24 displayed an 315

Rev Mex Cienc Pecu 2019;10(2):315-334

improvement (P<0.01) in fermentation kinetics and IVDMD compared to MODE24 or LOW24. In the second experiment, HIGH12 displayed lower (P<0.01) IVDMD at 72 h compared to CONTROL. Alfalfa and orchardgrass had higher (P<0.01) Vm and IVDMD compared to cocuite and guinea grass. Overall, reactivation of preserved ruminal inoculum by pre-incubation for 24 h in a medium containing yeast extract, peptone from casein and carbohydrates performed better compared to reactivation by pre-incubation for 12 h; however, fermentation kinetics and IVDMD were still depressed compared to fresh ruminal fluid. Key words: Forage digestibility, Fermentation, Preservation, Ruminal inoculum.

Received: 09/05/2017 Accepted: 08/03/2018

Introduction In vitro techniques are commonly used to evaluate fermentation and digestibility of feed ingredients utilized in ruminant rations(1,2,3). However, the need for fistulated animals for ruminal fluid collection is an important limitation of these techniques(4,5,6). Thus, preservation of ruminal fluid might overcome this limitation as it allows the use of inoculum without having to keep donor animals(7,8,9). This is conducted by using glycerol to minimizes microbial cell damage(10,11,12) and maintain the microbial community(13,14). The appropriate reactivation of preserved inoculum before being used remains largely unknown. Lyophilized ruminal fluid underestimates in vitro fermentation and dry matter digestibility compared to fresh ruminal fluid when reconstituted in McDougallâ&#x20AC;&#x2122;s buffer(8). The depression in fermentation parameters(15) presumably due to cell damage(8,9) or microbial death(9) may explain this underestimation. In addition, limitations in the availability of nutrients such as nitrogen(16,17) and carbohydrates(18,19,20) may influence reactivation, growth and activity of ruminal microbes. Thus, it has been recently acknowledged that the reactivation of preserved bacteria is a critical step in obtaining active microorganisms, and that the reactivation conditions should be optimized(21,22,23). Because of the limited information on strategies to improve the reactivation of ruminal inoculum, research to find a cost-effective and practical approach is warranted. Thus, the objectives of this study were to evaluate the effects of the culture medium used and the incubation time needed for proper reactivation of lyophilized ruminal inoculum. Response variables assessed were based on in vitro fermentation kinetics and dry matter digestibility of alfalfa, orchardgrass, cocuite and guinea grass. The hypothesis was that there will be no difference in in vitro forage digestibility and fermentation kinetics between preserved and fresh ruminal inoculum. 316

Rev Mex Cienc Pecu 2019;10(2):315-334

Material and methods Experiments were carried out at Universidad Autรณnoma Chapingo. Animals used in the experiments were managed according to the guidelines and University regulations.

Fermentation substrates and chemical analysis Four forage species commonly used for grazing ruminants in Mexico were utilized as fermentation substrates (Table 1): alfalfa (Medicago sativa L) cv San Miguel, orchardgrass (Dactylis glomerata L) cv Potomac, cocuite (Gliricidia sepium (Jacq.) Kunth ex Walp.) and guinea grass (Panicum maximum Jacq.) cv Tanzania. Alfalfa, guinea grass and orchardgrass were cut at 7 cm above ground level; only leaves of cocuite were collected by hand from branches of several trees. Enough sample material was collected to obtain at least 1 kg of sample (DM basis) for each forage species. Collected forage samples were dried in a forced air oven at 60 ยบC for 96 h; they were ground to pass through a 1 mm screen (Wiley Mill, Arthur H. Thomas Co., Philadelphia, PA) and analyzed for crude protein, ash, ether extract(24) (methods # 976.06; # 942.05; # 920.39, respectively). Acid detergent fiber (ADF)(25), neutral detergent fiber (NDF) were assayed without heat stable amylase and expressed inclusive of residual ash(25), and soluble sugars(26).

Table 1: Analyzed chemical composition (g/kg DM) of the four forage species used as fermentation substrates for in vitro fermentation kinetics and in vitro dry matter digestibility experiments

Forage species

Crude protein

Chemical composition (g/kg DM) Ash Ether extract ADF NDFA

Alfalfa Orchardgrass Cocuite Guinea grass

206 197 183 65

119 163 85 123

11 26 24 5

350 400 367 564

442 540 465 779

Sugars 41 35 47 29

ADF= acid detergent fiber; NDF= neutral detergent fiber. neutral detergent fiber was assayed without heat stable amylase and was expressed inclusive of residual ash.

Ruminal fluid collection, preservation and reactivation In vitro procedures reported for each experiment included three replicates(27,28). Similar to previous studies(29), fresh ruminal fluid was collected for each in vitro run from three ruminally fistulated adult Creole rams with an average body weight of 53.0 kg. Donor 317

Rev Mex Cienc Pecu 2019;10(2):315-334

rams were fed a diet containing 80 % forage and 20 % concentrate. Feed was offered at 0900 and 1500 h every day; ad libitum intake was allowed. In addition, clean fresh water was available ad libitum. Rams were fitted with a ruminal cannula to collect ruminal fluid by suction(30). The collected ruminal fluid was filtered through four layers of cheesecloth and equal volumes of ruminal fluid from each donor were combined in order to obtain a representative sample and to prevent animal-to-animal variations(31,32,33). Five percent (v/v) glycerol (Sigma-Aldrich, St. Louis, MO) was incorporated to serve as a cryoprotectant of ruminal inoculum(12,13). Aliquots were placed in 10-mL sterile glass containers. Containers were hermetically sealed and frozen at -70 ÂşC for 3 d. Lyophilization was conducted as previously described(8) (Labconco Lyph Lock, model 195) under vacuum (-0.133 mBar), and inoculum was stored until later use. The reactivation of the preserved inoculum was conducted by reconstituting lyophilized samples in a cysteine solution to a volume equal to that of the original strained ruminal fluid. This solution contained 2.5 g of L-cysteine, 2.5 g of sodium sulfite and 0.1 mL of resazurin (1%) dissolved in 15 mL of sodium hydroxide (2N), distilled water was added to make a total volume of 100 mL (Table 2), which served as a buffer and created a reduced environment in the media, simulating the reduced conditions of the rumen. Reconstituted inoculum was incubated at room temperature for 10 min to allow rehydration, the reconstituted inoculum was transferred to 100 mL of culture medium, then it was pre-incubated at 39 Â°C for 24 or 12 h. The culture medium used and the preincubation time varied depending on the experiment, as described below.

Table 2: Ingredient composition of the three media utilized for the reactivation of lyophilized ruminal inoculum Inoculum type Ingredient of medium used for reactivation

Distilled water, mL Ruminal fluidA, mL Sodium carbonate solution (8%), mL Mineral solution IB, mL Mineral solution IIC, mL Cysteine solutionD, mL Resazurin solution 1%, mL Yeast extract, g Peptone from casein, g Ground forageE, g Glucose, g Cellobiose, g Starch, g

LOW24

MODE24

HIGH24

----------50 29

Amount per 100 mL

--------

50 29

7 7 2 0.10 ----0.25 -------

7 7 2 0.10 0.50 0.50 0.25 -------

7 7 2 0.10 0.50 0.50 0.25 0.30 0.30 0.25

318

Rev Mex Cienc Pecu 2019;10(2):315-334 A

Strained through 4 layers of cheesecloth, 2 times centrifuged at 13,416 Ă&#x2014;g and sterilized at 15 psi for 15 min. B Containing 6.0 g of potassium hydrogen phosphate per liter of distilled water (44). C Containing 6.0 g of monobasic potassium phosphate; 6.0 g ammonium sulfate; 12 g sodium chloride; 2.45 g magnesium sulfate monohydrate; and 1.6 g calcium chloride monohydrate per liter of distilled water(44). D 2.5 g of L-cysteine dissolved in 15 mL of sodium hydroxide (2N), 2.5 g of sodium sulfide and 0.1 mL of rezasurin (1%) volume was brought to 100 mL; the solution was heated and it was sterilized using an autoclave. E Ground guinea grass.

Ruminal inocula evaluated Experiment 1. Four types of ruminal inoculum were evaluated for measurements of fermentation kinetics and IVDMD. A fresh ruminal fluid (Control) was compared to lyophilized inocula reactivated by pre-incubation for 24 h in 1 of 3 culture media (Table 2). Specifically, treatments were 1) CONTROL, fresh ruminal fluid; 2) LOW24, inoculum reactivated in a medium containing 100 mL of a basal culture solution (composed of 50 % distilled water, 29 % clarified ruminal fluid, 14 % mineral solutions I and II, 5 % sodium carbonate, 2 % cysteine solution) and 0.1 % resazurin; 3) MODE24, inoculum reactivated in a medium containing 100 mL of the basal culture solution, 0.1 % resazurin, 0.5 g of yeast extract (Sigma-Aldrich, St. Louis, MO) and 0.5 g of peptone from casein (Bioxon Becton Dickinson, Mexico); and 4) HIGH24, inoculum reactivated in a medium containing 100 mL of a basal culture solution, 0.1 % resazurin, 0.5 g of yeast extract (Sigma-Aldrich, St. Louis, MO), 0.5 g of peptone from casein (Bioxon Becton Dickinson, Mexico), 0.3 g of glucose, 0.3 g of cellobiose and 0.25 g of starch. Media also included 0.25 g of ground forage on a DM basis (Table 2). Experiment 2. In the second experiment, two types of ruminal fluid were compared: 1) CONTROL, fresh ruminal fluid, and 2) HIGH12, inoculum reactivated using a medium previously described for HIGH24. However, in this experiment, preserved ruminal inoculum was reactivated by pre-incubation for only 12 h as an attempt to find a more practical and faster approach for the reactivation process.

Fermentation kinetics and IVDMD In each experiment, fresh and reactivated ruminal inocula were combined with a diluting agent containing the reduced mineral solutions I and II and the cysteine solution (34) at a ratio of 1:9 (v/v, ruminal fluid: diluting agent, Table 2). CO2 was flushed while adding the diluting agent to the ruminal fluid, which was maintained at 39 ÂşC. Afterwards, the fermentation kinetics and forage IVDMD were determined by combining 90 mL of diluted ruminal inoculum with 0.5 g of fermentation substrate using 125-mL 319

Rev Mex Cienc Pecu 2019;10(2):315-334

glass bottles. The determination of the parameters of fermentation kinetics was based on the procedure utilized for the measurement of gas(35,36). More specifically, gas pressure (kg/cm2) was recorded at 1, 2, 4, 6, 10, 14, 18, 24, 30, 38, 48 and 72 h of incubation. After recording this value at each time point, the gas pressure was reset to cero. The values of pressure were then converted to volume of gas (mL/g DM of substrate); to do so, a standard curve was first generated by injecting known volumes of CO2. The equation of this standard curve was generated by adding a linear regression line, and this equation was: Gas volume (mL/g of substrate) = pressure (kg/cm2)* 39.46 + 0, with an R2 of 0.94. This standard curve was generated at room temperature. The use of this technique has also been recently reported by other investigators(29). The accumulated volume of gas at each time point was used to estimate the parameters of the fermentation kinetics: maximum volume of gas (Vm; mL/g), lag phase (L; h), and the rate of gas production (S; h-1). This was conducted using a logistic model described by Schofield et al(37): Volume of gas =

đ?&#x2018;&#x2030;đ?&#x2018;&#x161;

(Equation 1)

1+đ?&#x2018;&#x2019;đ?&#x2018;Ľđ?&#x2018;?(2 â&#x2C6;&#x2019; 4 Ă&#x2014; đ?&#x2018;&#x2020; Ă&#x2014; (đ?&#x2018;Ąâ&#x2C6;&#x2019;đ??ż))

Where: Vm is maximum volume; S is the rate of gas production; t is the time point of measurement; L is the lag phase. In addition to parameters of fermentation kinetics, the IVDMD of substrates was determined at 24 and 72 h fermentation (IVDMD24, and IVDMD72, respectively). At each time point, the content of corresponding fermentation bottles was filtered through Whatman filter paper No. 4. The residue was dried at 100 ÂşC for 12 h in a forced air oven and the dry weight was recorded. Then, IVDMD was calculated relative to the amount of original sample used.

Statistical analysis The GLM procedure of SAS(38) was used. In each experiment (n =3), the mean values within each fermentation substrate were considered as the experimental unit. Given the controlled experimental conditions, significant effect was declared at P<0.01; this level of significance may also contribute to reduce the type I error risk. Only when first order interaction was not significant, mean separation for main effects was conducted by Tukey; otherwise, paired mean separation by t-test was performed. Dispersion parameter reported is the largest standard error of the mean (SEM). Data from Exp 1 were analyzed as a completely randomized experimental design with a 4 Ă&#x2014; 4 factorial arrangement of treatments (4 inoculum types and 4 fermentation 320

Rev Mex Cienc Pecu 2019;10(2):315-334

substrates). Data from Exp 2 were analyzed according to a completely randomized experimental design with a 2 × 4 factorial arrangement of treatments (2 inoculum types and 4 fermentation substrates). In both experiments, the main effects of inoculum type and fermentation substrate were analyzed. The interaction of inoculum type × fermentation substrate was also evaluated. The statistical model for the analyses was: Yijk = µ + τi + βj + τβij + εijk Where: Yijk represents the observation of the ijk treatment; µ represents the overall mean; τi represents the inoculum type i; βj represents the fermentation substrate j; τβij represents the interaction effect of the inoculum type i and the fermentation substrate j. The residual term εijk was assumed to be normally, independently, and identically distributed, with variance σ2e.

Results Chemical composition of forages used as fermentation substrates

Analyzed chemical composition of the four forages used is listed in Table 1. Guinea grass was low in crude protein and high in fiber contents (65.0 and 779.0 g/kg DM for crude protein and NDF, respectively); whereas alfalfa was high in protein and low in fiber content (206.0 and 442.0 g/kg DM for crude protein and NDF, respectively), with these nutrients having intermediate values for orchardgrass and cocuite.

Fermentation kinetics and IVDMD for inocula reactivated by 24 h preincubation Figure 1 illustrates in vitro gas production for the CONTROL and inocula reactivated by pre-incubation for 24 h. CONTROL displayed the fastest and greatest maximum gas production compared to the other treatments. Even with the HIGH24 treatment, fermentation was reduced by around 50 % during the first hours of incubation. Within the preserved inocula, HIGH24 displayed the greatest maximum gas production, followed by MODE24 and by LOW24. In addition, Figure 2 displays gas production for each fermentation substrate. Alfalfa had the greatest and fastest maximum gas production 321

Rev Mex Cienc Pecu 2019;10(2):315-334

compared to the rest of forages. Orchard grass displayed intermediate values for gas production, with cocuite and guinea grass having the lowest values.

Figure 1: In vitro gas production for the control and the preserved inocula reactivated by pre-incubation for 24 h in different culture media

Gas production, mL/g DM

450

CONTROL

LOW24

MODE24

HIGH24

400 350 300 250 200 150 100 50 0 0

Fermentation time, hours CONTROL= fresh ruminal fluid; LOW24= inoculum reactivated by 24 h pre-incubation in a basal culture solution; MODE24= similar to LOW24, but included yeast extract and peptone from casein; HIGH24= similar to MODE24, but included carbohydrates. Control: Vm=387.15 mL/g, L=4.06 h, S=0.041 h-1; LOW24: Vm=266.11 mL/g, L=13.70 h, S=0.018 h-1; MODE24: Vm=288.22 mL/g, L=7.62 h, S=0.023 h-1; HIGH24: Vm=332.83 mL/g, L=8.05 h, S=0.32 h-1.

322

Rev Mex Cienc Pecu 2019;10(2):315-334

Figure 2: In vitro gas production for four forages when values for fresh ruminal fluid and inocula reactivated by pre-incubation for 24 h were averaged

Gas production, mL/g DM

400

Alfalfa

Orchardgrass

Cocuite

Guinea grass

350 300 250 200 150 100 50 0 0

Fermentation time, hours Alfafa: Vm=357.90 mL/g, L=5.22 h, S=0.030 h-1; orchardgrass: Vm=333.50 mL/g, L=11.77 h, S=0.029 h-1; cocuite: Vm=291.50 mL/g, L=3.83 h, S=0.030 h-1; guinea grass: Vm=291.20 mL/g, L=12.20 h, S=0.025 h-1.

More specifically, fermentation kinetics, IVDMD24 and IVDMD72 were affected by treatment and fermentation substrate (Table 3). Regardless of the nutrient composition of the medium used for reactivating the inoculum, Vm decrease (P<0.01) when reactivated inoculum was used compared to fresh ruminal fluid, with this difference being greater during the first 24 h (Figure 1). However, treatment HIGH24 displayed greater Vm (P<0.01) compared to treatments MODE24 or LOW24 regardless of fermentation substrate. In addition, both alfalfa and orchardgrass had the highest (P<0.01) Vm across treatments with an average of 345.7 Âą 14.40 mL/g. The interaction of treatment Ă&#x2014; fermentation substrate was significant (P<0.01) for L and S. Specifically, L was highest (P<0.01) for LOW24 when orchardgrass or guinea grass was used as fermentation substrates with an estimate of 22.29 h. However, there was no difference in L among treatments when cocuite was used as fermentation substrate. Furthermore, S was lowest (P<0.01) for treatment LOW24 regardless of fermentation substrates with an average of 0.018 h-1. However, S reached highest (P<0.01) values in most fermentation substrates when CONTROL was used as inoculum followed by HIGH24.

323

Rev Mex Cienc Pecu 2019;10(2):315-334

Table 3: Parameters of the fermentation kinetics (Vm, L and S) and in vitro dry matter digestibility at 24 and 72 h (IVDMD24, IVDMD72) for fresh inoculum or lyophilized inocula reactivated by 24-h pre-incubation in one of three culture media Fermentation parametersA Inoculum type

CONTROL

LOW24

MODE24

HIGH24

Fermentation substrate

% gas at 72 h

% IVDM at 24h/72h

622.0a

100.0

89.7

538.0a

618.0a

100.0

87.1

0.044a

466.0ba

508.0dc

100.0

91.7

6.09dc

0.036cb

398.0c

550.0cb

99.9

72.4

309.30b

7.31bc

0.019e

432.0cb

590.0b

94.9

73.2

Orchardgrass

303.20b

20.2a

0.017e

314.0d

624.0a

87.1

50.3

Cocuite

207.85c

2.89d

0.020e

324.0d

454.0e

97.1

71.4

Guinea grass

244.10c

24.38a

0.016e

180.0f

424.0e

94.0

42.5

Alfalfa

319.45b

5.14dc

0.025d

482.0ba

674.0a

99.1

71.5

Orchardgrass

307.75b

10.32bc

0.018e

402.0c

636.0a

92.0

63.2

Cocuite

288.80c

4.91d

0.025d

382.0c

516.0c

99.1

74.0

Guinea grass

236.90c

10.12bc

0.021ed

252.0e

484.0d

96.1

52.1

Alfalfa

367.15a

5.64dc

0.033cb

524.0a

630.0a

99.9

83.2

Orchardgrass

333.00b

11.68bc

0.039ba

502.0ba

656.0a

99.9

76.5

Cocuite

323.25b

5.04dc

0.030dc

404.0c

512.0c

99.8

78.9

Guinea grass

307.75b

9.85bc

0.025d

324.0d

554.0b

98.5

58.5

CONTROLy

387.15a

4.06c

0.041a

490.0a

574.5a

100.0

85.3

L (h)

S (h-1)

Alfalfa

435.75a

2.80d

0.043a

558.0a

Orchardgrass

390.25a

4.89d

0.041ba

Cocuite

346.25a

2.46d

Guinea grass

376.35a

Alfalfa

Inoculum means LOW24x

Forage means

266.11c

13.70a

0.018d

312.5d

523.0b

90.0

59.8

MODE24w

288.22c

7.62b

0.023c

379.5c

577.5a

98.1

65.7

HIGH24v

332.83b

8.05b

0.032b

438.5b

588.0a

99.8

74.6

Alfalfa

357.90a

5.22b

0.030a

499.0a

629.0a

99.8

79.3

Orchardgrass

333.50a

11.77a

0.029a

439.0b

633.5a

99.3

69.3

Cocuite

291.50b

3.83b

0.030a

394.0c

497.5b

99.8

79.2

Guinea grass

291.20b

12.61a

0.025b

288.5d

503.0b

98.1

57.4

14.40

1.290

0.0012

10.80

10.50

Inoculum

0.001

Forage

0.001

Inoculum × forage

0.0766

0.001

0.0002

0.0012

0.0001

SEMB

P-values

IVDMD24 IVDMD72 (g/kg) (g/kg)

Vm (mL/g)

Vm: maximum volume of gas; L: lag phase; S: rate of gas production. B SEM: the largest standard error of the mean is reported. a-f: Means in the same column with different superscripts are different (P<0.01).

The treatment × fermentation substrate interaction was significant (P<0.01) for IVDMD24 and IVDMD72. Specifically, when alfalfa was used as fermentation substrate, IVDMD24 324

Rev Mex Cienc Pecu 2019;10(2):315-334

for treatments MODE24 and HIGH24 was similar (P≥0.1) to CONTROL with an average of 521.3 ± 10.8 g/kg. However, IVDMD24 for alfalfa was lower (P<0.01) for treatment LOW24 compared to CONTROL with estimates of 432.0 and 558.0 ± 10.8 g/kg for LOW and CONTROL, respectively. Likewise, IVDMD72 for treatments MODE24 and HIGH24 were similar (P≥0.1) to CONTROL with an average of 642.0 ± 10.5 g/kg. However, IVDMD72 for alfalfa was lower (P<0.01) for LOW24 compared to CONTROL24 with estimates of 590 and 622.0 ± 10.5 g/kg for LOW24 and CONTROL, respectively. The lowest (P<0.01) IVDMD72 was observed for treatment LOW24 when cocuite was used as fermentation substrate with an average of 439.0 ± 10.5 g/kg. Overall, regardless of fermentation substrate, there was a depression (P<0.01) in IVDMD for LOW24 compared to any of the other treatments.

Fermentation kinetics and IVDMD for inoculum reactivated by 12 h preincubation Figure 3 illustrates in vitro gas production for the CONTROL and inoculum reactivated by incubation for 12 h. CONTROL displayed a faster and greater maximum gas production compared to HIGH12. In addition, Figure 4 illustrates gas production for each fermentation substrate. Alfalfa displayed the greatest and fastest maximum gas production compared to the rest of forages, with cocuite and guinea grass having the lowest values.

Figure 3: In vitro gas production for the control and the preserved inoculum reactivated by pre-incubation for 12 h in a culture medium CONTROL

450

HIGH12

Gas production, mL/g DM

400 350 300 250

200 150 100 50 0 0

Fermentation time, hours

CONTROL= fresh ruminal fluid; HIGH12, inoculum reactivated by 12 h pre-incubation in a basal culture solution, yeast extract, peptone from casein and carbohydrates. Control= Vm=410.80 mL/g, L=5.42 h, S=0.032 h-1; HIGH12= Vm=264.97 mL/g, L=4.29 h, S=0.017 h-1.

325

Rev Mex Cienc Pecu 2019;10(2):315-334

Figure 4: In vitro gas production for four forages when values for fresh ruminal fluid and inoculum reactivated by pre-incubation for 12 h were averaged Alfalfa

Gas production, mL/g DM

400

Orchardgrass

Cocuite

Guinea grass

350 300 250 200

150 100 50 0 0

Fermentation time, hours

Alfafa: Vm=368.30 mL/g, L=2.13 h, S=0.032 h-1; orchardgrass: Vm=352.51 mL/g, L=9.19 h, S=0.033 h-1; cocuite: Vm=334.16 mL/g, L=3.79 h, S=0.027 h-1; guinea grass: Vm=296.56 mL/g, L=4.31 h, S=0.025 h-1.

Specifically, fermentation kinetics, IVDMD24 and IVDMD72 were affected by treatment and fermentation substrate (Table 4). Vm was greater (P<0.01) for CONTROL compared to HIGH12, with estimates of 410.80 and 264.97 ± 13.050 mL/g, respectively. The interaction of inoculum type × fermentation substrate was significant for L (P<0.011); orchardgrass and alfalfa incubated in HIGH12 had the greatest and lowest (P<0.01) L, respectively; with estimates of 12.4 and 0.07 ± 0.700 h for orchardgrass and alfalfa. Likewise, an interaction (P<0.01) was detected for S; alfalfa incubated in CONTROL and cocuite incubated in HIGH12 had the greatest and lowest S, respectively; with estimates of 0.047 and 0.013 ± 0.007 h-1 for alfalfa and cocuite. Regardless of forage type, the IVDMD24 was greater for CONTROL compared to HIGH12 with estimates of 520.6 and 374.3 ± 12.70 g/kg, respectively. There was an inoculum type × fermentation substrate interaction (P<0.01) for IVDMD72 with alfalfa and orchargrass incubated in CONTROL having the greatest IVDMD72, and cocuite and guinea grass having the lowest IVDMD72 values.

326

Rev Mex Cienc Pecu 2019;10(2):315-334

Table 4: Parameters of fermentation kinetics (Vm, L and S) and in vitro dry matter digestibility at 24 and 72 h (IVDMD24, IVDMD72) for fresh inoculum or lyophilized inoculum reactivated by 12 h pre-incubation in a nutrient-rich medium Fermentation parameters A Inoculum type

CONTROL

HIGH12

Inoculum means

Forage means

Fementation substrate

Vm (mL/g)

L (h)

S (h-1)

IVDMD24 (g/kg)

% gas at 72 h

% IVDM at 24 h

Alfalfa

457.33d

4.19b

0.047f

625.3a

673.3d

100.0

92.9

Orchardgrass

409.96c

6.14b

0.042e

594.6a

678.6d

100.0

87.6

Cocuite

400.80c

4.36b

0.041e

463.9b

573.3b

100.0

80.9

Guinea grass

375.10b

7.00b

0.034d

398.6c

551.9b

99.9

72.2

Alfalfa

279.26a

0.07a

0.017b

461.3b

619.9c

94.7

74.4

Orchardgrass

295.06a

12.24c

0.024c

407.9b

657.3d

97.7

62.1

Cocuite

267.53a

3.23ab

0.013a

350.6c

478.6a

82.9

73.3

Guinea grass

218.03a

1.63ab

0.015ab

278.6d

459.9a

90.2

60.6

CONTROL

410.80b

5.42

0.041b

520.6a

619.3b

100.0

84.1

HIGH12

264.97a

4.29

0.017a

374.3b

553.9a

93.1

67.6

Alfalfa

368.30b

2.13a

0.032

543.3a

646.6b

99.9

84.0

Orchardgrass Cocuite

352.51b 334.16b

9.19c 3.79ab

0.033c 0.027b

501.3a 407.3b

667.9b 525.9a

99.8 99.5

75.1 77.4

Guinea grass

296.56a

4.31b

0.025a

338.6c

505.9a

99.2

66.9

13.050

0.700

0.0007

12.70

7.80

Inoculum type

0.0001

0.0359

0.0001

Forage species Inoculum type Ă&#x2014; forage species

0.0003

0.0001

0.1200

0.0001

0.0295

0.0006

SEMB P-values

Gas production model was Schofield et al. (1994): Volume of gas =

đ?&#x2018;&#x2030;đ?&#x2018;&#x161; 1+đ?&#x2018;&#x2019;đ?&#x2018;Ľđ?&#x2018;? (2 â&#x2C6;&#x2019; 4 Ă&#x2014; đ?&#x2018;&#x2020; Ă&#x2014; (đ?&#x2018;Ąâ&#x2C6;&#x2019;đ??ż))

where Vm is maximum volume of gas; L is the lag phase, and S is the rate of gas production. B

SEM: the largest standard error of the mean is reported.

a-f: Means within column with at least 1 letter in common are not different (P<0.01).

Discussion Ruminal fluid sampling and the use of glycerol as a cryoprotectant

Studies(31,32,33) have found differences in in vitro fermentation patterns between ruminal fluid from different donors. The source of ruminal fluid can influence in vitro fermentation and digestibility trials(31,39). Differences in fermentation patterns among animals observed by those researchers can be partially attributed to differences in the composition of the established bacterial community among host animals(40,41). Therefore, in the present study, ruminal fluid samples from three donors were pooled to obtain a representative sample to prevent bias due to ruminal fluid source. 327

Rev Mex Cienc Pecu 2019;10(2):315-334

The use of glycerol improves the preservation of the ruminal bacterial community(12,13,14). Benefits of glycerol may be explained by peripheral vitrification providing protection to the bacterial cytoplasmic membranes from potential damage that can be caused by ice crystal formation(42). More specifically, glycerol penetrates the cells, which can then protect them from damage by maintaining a semi-fluid state(43,44). Consequently, the use of glycerol not only protects the integrity and viability of the ruminal bacterial cells, but may also prevent degradation of the microbial DNA(13).

Fermentation kinetics and IVDMD of preserved inocula

In vitro fermentation kinetics and IVDMD revealed differences between fresh and lyophilized ruminal fluid. When compared to fresh ruminal fluid, the greatest depression in fermentation kinetic parameters was observed when lyophilized inocula were reactivated in media without sugars or growth promoters. These observations are in line with other studies(15), indicating a depression on fermentation parameters with frozen inocula, which can be explained by a decrease in microbial activity due to microbial death or nutrient limitation(9). In addition, researchers have reported(8) that protein degradation rates with preserved ruminal microorganisms were 4 to 8 times slower than when using fresh ruminal fluid. Furthermore, the use of inoculum preserved through freezing affects fermentation parameters during the first hours of fermentation(30), and deep freezing may represent a better preservation method compared to freezing at â&#x20AC;&#x201C;20 Â°C. Consequently, in agreement with recent reports, the reactivation of preserved bacteria is one of the most critical steps in obtaining active and effective microorganisms for in vitro fermentation trials(21,22,23). In this study, compared to fresh ruminal fluid, the negative effects of lyophilization on fermentation kinetics and IVDMD was less severe when ruminal inocula were reactivated in a nutrient-rich medium including a basal culture solution, growth promoters and sugars. These observations indicate that growth promoters such as yeast extract and peptone from casein, and carbohydrates such as glucose, cellobiose and starch enhance the reactivation of ruminal microorganisms, thus, improving in vitro fermentation. The need for yeast extract in the medium for adequate bacterial reactivation and growth may be attributed to the absence of the genes for the synthesis of some proteinogenic amino acids such as arginine and asparagine in the genome of some ruminal bacterial species(45,46), which indicates that these amino acids contained in the yeast extract need to be included in the medium. Additionally, peptone from casein and carbohydrates provide readily available nitrogen and energy stimulating microbial reactivation, growth and activity(19,47). It is interesting to note the different patterns (gas production at different time points) among the fermentation curves, which suggests that different microbial populations may be acting on the substrates at each fermentation time point. Further research should aim at investigating shifts in the structure of the microbial community(48,49) using techniques 328

Rev Mex Cienc Pecu 2019;10(2):315-334

such as high-throughput DNA sequencing(50,51,52), which allows a broad evaluation of the profile microbial community from highest to lowest taxonomic levels. It has been found that, in comparison to fresh ruminal fluid, digestibility of alfalfa decreased 17.63 % when using frozen inoculum or lyophilized inoculum reactivated by 24 h pre-incubation in McDougallâ&#x20AC;&#x2122;s solution(9). In contrast to previous observations(9), in the present study, IVDMD72 was not affected when using lyophilized inoculum reactivated by 24 h pre-incubation in a nutrient-rich medium; indicating that, compared to the use of McDougallâ&#x20AC;&#x2122;s solution, using a nutrient-rich medium containing a wider range of nutrients represents a better approach for stimulating the reactivation and activity of ruminal microorganisms. When averaged across fermentation substrates (i.e. alfalfa, orchard grass, cocuite and guinea grass), the IVDMD for any of the reactivated inocula was negatively affected, compared to the values obtained with the control. However, within lyophilized inocula, the reactivation by 24 h pre-incubation in a nutrient-rich medium displayed the best performance. In addition, when the inoculum was reactivated by 12 h pre-incubation, IVDMD values were lower compared to the control fresh ruminal fluid. It is important to note that, at 72 h fermentation all forages but cocuite reached almost 100 % of the total gas produced. This indicates that 72h-fermentation rates are not suitable for measuring the effectiveness of the treatments, which also suggests that a better approach would be to measure fermentation rates and IVDMD at 24 or 48 h of fermentation.

Effect of fermentation substrate on fermentation kinetics and IVDMD

The use of fermentation substrates with a wide range of nutrient composition facilitated the evaluation of our hypothesis under different scenarios. Overall, our results revealed that forages from temperate zones, namely alfalfa and orchardgrass, had higher Vm and IVDMD compared to their counterparts from the tropical regions. These observations were likely due to differences in the structural components of the plant cell-wall existing between forages from temperate and those from tropical zones(53). Furthermore, alternative inoculum sources have been suggested for in vitro fermentations. One of these sources is ruminant feces; however, results have been inconsistent. For example, fecal inoculum has been demonstrated to be effective for in vitro gas production studies(54); nonetheless, fecal inoculum from sheep was not comparable to fresh ruminal fluid when evaluating in vitro dry matter digestibility(55). In addition, other studies, have revealed that fecal inoculum does not perform as good as ruminal fluid in in vitro fermentation techniques(55,56), which may be due to differences in the bacterial populations between the rumen and the lower gastrointestinal tract(57).

329

Rev Mex Cienc Pecu 2019;10(2):315-334

Conclusions and implications

In vitro fermentation kinetics and IVDMD were affected by lyophilization of ruminal fluid. In most cases, fermentation parameters Vm, L and S were negatively affected when lyophilized ruminal inoculum was used. However, when glycerol was added to the lyophilized ruminal inocula and was reactivated for 24 h in a pre-incubation nutrient-rich medium, including growth promoters and sugars, the negative effects of lyophilization on in vitro fermentation kinetics and IVDMD were less severe. As expected, alfalfa and orchardgrass had higher Vm and IVDMD compared to cocuite and guinea grass. Results reported in this study should provide new insights into reactivation of preserved ruminal inoculum as well as its utilization in in vitro fermentation and digestion trials for laboratories with limited access to fistulated animals or fresh ruminal fluid. Future research should explore changes in rumen microbial populations during in vitro fermentations using high-throughput DNA sequencing to understand how shifts in the microbial profiles lead to the different patterns observed among fermentation curves.

Literature cited: 1.

Narvaez N, Wang Y, Xu Z, McAllister T. Effects of hops on in vitro ruminal fermentation of diets varying in forage content. Livest Sci 2011;138:193–201.

Anele UY, Refat B, Swift ML, Zhao YL, Doublier C, McAllister TA, et al. In vitro ruminal fermentation of ground and dry-rolled barley grain differing in starch content. Anim Feed Sci Technol 2015;203:88–94.

Pal K, Patra AK, Sahoo A, Kumawat PK. Evaluation of several tropical tree leaves for methane production potential, degradability and rumen fermentation in vitro. Livest Sci 2015;180:98–105.

Bochi-Brum O, Carro MD, Valdés C, González JS, López S. In vitro digestibility of forages and concentrates: effect of diet on donor animals. Arch Zoot 1999;48:51–61.

Bueno ICS, Cabral LS, Gobbo SP, Louvandini H, Vitti DM, Abdalla L. Influence of inoculum source in a gas production method. Anim Feed Sci Technol 2005;124:95105.

Mould FL, Kliem KE, Morgan R, Mauricio RM. In vitro microbial inoculum: A review of its function and properties. Anim Feed Sci Technol 2005;123:31–50.

Luchini ND, Broderick GA, Combs DK. In vitro determination of ruminal protein degradation using freeze-stored ruminal microorganisms. J Anim Sci 1996;74:2488– 2499. 330

Rev Mex Cienc Pecu 2019;10(2):315-334

Luchini ND, Broderick GA, Combs DK. Preservation of ruminal microorganisms for in vitro determination of ruminal protein. J Anim Sci 1996;74:1134–1143.

Meneses M, Madrid SJ, Hernández RF, Megias MD. Evaluación de diferentes métodos de conservación del líquido ruminal para pruebas in vitro. Sociedad Española de Ovinotecnia y Caprinotecnia 2000;25:315-317.

10. Malik KA. Cryopreservation of bacteria with special reference to anaerobes. World J Microbiol Biotechnol 1991;7:629-632. 11. Perry SF. Freeze-drying and cryopreservation of bacteria. Mol Biotechnol 1998;9:59-64. 12. Rojas-Tapias D, Ortiz-Vera M, Rivera D, Kloepper J, Bonilla R. Evaluation of three methods for preservation of Azotobacter chroococcum and Azotobacter vinelandii. Universitas Scientiarum 2013;18(2):129-139. 13. McKain N, Genc B, Snelling TJ, Wallace RJ. Differential recovery of bacterial and archaeal 16S rRNA genes from ruminal digesta in response to glycerol as cryoprotectant. J Microbiol Methods 2013;95:381–383. 14. Fliegerova K, Tapio I, Bonin A, Mrazek J, Callegari ML, Bani P, et al. Effect of DNA extraction and sample preservation method on rumen bacterial population. Anaerobe 2014;29:80–84. 15. Hervas G, Frutos P, Giráldez FJ, Mora MJ, Fernández B, Mantecón AR. Effect of preservation on fermentative activity of ruminal fluid inoculum for in vitro gas production techniques. Anim Feed Sci Technol 2005;124:107-118. 16. NRC. Nutrient requirements of beef cattle. 7th rev. ed. Washington, DC; Natl Acad Press; 2000. 17. Beaudet V, Gervais R, Graulet B, Nozière P, Doreau AM, Fanchone A, et al. Effects of dietary nitrogen levels and carbohydrate sources on apparent ruminal synthesis of some B vitamins in dairy cows. J Dairy Sci 2016;99:2730–2739. 18. Stern MD, Hoover WH. Methods for determining and factors affecting rumen microbial protein synthesis: a review. J Anim Sci 1979;49:1590–1603. 19. Russell JB. Rumen Microbiology and its role in ruminant nutrition. Russell JB editor. Ithaca, NY, USA: Publ. Co; 2002. 20. Fernando SC, Purvis II HT, Najar FZ, Sukharnikov L, Nagaraja TG, Krehbiel CR, et al. Rumen microbial population dynamics during adaptation to high-grain diet. Appl Environ Microbiol 2010;76:7482–7490.

331

Rev Mex Cienc Pecu 2019;10(2):315-334

21. Muller JA, Stanton C, Sybesma W, Fitzgerald GF, Ross RP. Reconstitution conditions for dried probiotic powders represent a critical step in determining cell viability. J Appl Microbiol 2012;108:1369–1379 22. Hoefman S, Van Hoorde K, Boon N, Vandamme P, De Vos P, Heylen K. Survival or revival: long-term preservation induces a reversible viable but non-culturable state in methane-oxidizing bacteria. PLoS ONE 2012;7(4):e34196. 23. Miyamoto-Shinohara Y, Sukenobe J, Imaizumi T, Nakahara T. Survival of freezedried bacteria. J Gen Appl Microbiol 2008;54:9–24. 24. Association of Official Analytical Chemists. ‘Official Methods of Analysis.’ 17th ed. (AOAC). Arlington, VA, USA. 2000. 25. Goering HK, Van Soest PJ. Forage fiber analysis (apparatus, reagents, procedures and some applications). Agr Res Serv, USDA, Washington, DC, USA, Agriculture Handbook No 379; 1970. 26. Witham FH, Blaydes DF, Devlin RM. Experiments in plant physiology. Van Nostrand New York, USA: Reinhold Company; 1971. 27. Udén P, Robinson PH, Mateos GG, Blank R. Use of replicates in statistical analyses in papers submitted for publication in Animal Feed Science and Technology. Anim Feed Sci Technol 2012;171:11–15. 28. Castro-Montoya J, De Campeneere S, Van Ranst G, Fievez V. Interactions between methane mitigation additives and basal substrates on in vitro methane and VFA production. Anim Feed Sci Technol 2012;176:47–60. 29. Ferraro SM, Mendoza GD, Miranda LA, Gutiérrez CG. In vitro ruminal fermentation of glycerol, propylene glycol and molasses combined with forages and their effect on glucose and insulin blood plasma concentrations after an oral drench in sheep. Anim Feed Sci Technol 2016;213:74–80. 30. Prate A, de Oliveira JA, Abecia L, Fondevila M. Effects of preservation procedures of rumen inoculum on in vitro microbial diversity and fermentation. Anim Feed Sci Technol 2010;150:186–193. 31. Johnson RR. Techniques and procedures for in vitro and in vivo rumen studies. J Anim Sci 1966;25:855–875. 32. Nelson BD, Ellzey HD, Montgomery C, Morgan EB. Factors affecting the variability of an in vitro rumen fermentation technique for estimating forage quality. J Dairy Sci 1972;55:358–366. 33. Pehrson A, Faber WE. Individual variation of in vitro dry matter digestibility in moose. J Range Manage 1994;47:392–394. 332

Rev Mex Cienc Pecu 2019;10(2):315-334

34. Jones GA, Pickard MD. Effect of titanium citrate as reducing agent on growth of rumen bacteria. Appl Environ Microbiol 1980;39:144-1147. 35. Theodorou MK, Williams BA, Dhanoa MS, McAllan AB, France J. A simple gas production method using a pressure transducer to determine the fermentation kinetics of ruminant feeds. Anim Feed Sci Technol 1994;48:185–197. 36. Antúnez G, Cajarville C, Britos A, González A, Repetto JL. Ruminal inoculum activity in cattle supplemented with corn grain at different daily frequencies: evaluation using the in vitro gas-production technique. Anim Prod Sci 2014;54:1662–1664. 37. Schofield P, Pitt RE, Pell AN. Kinetics of fiber digestion from in vitro gas production. J Anim Sci 1994;72:2980–2991. 38. SAS. SAS/STAT User´s guide (Release 9.1). SAS Institute Inc., Cary, NC, USA, 2004. 39. Williams BA. Cumulative gas-production techniques for forage evaluation. In: Forage evaluation in ruminant nutrition. Givens DI, et al. editors. Wallingford. UK: CAB International; 2000. 40. Weimer PJ, Stevenson DM, Mantovani HC, Man SLC. Host specificity of the ruminal bacterial community in the dairy cow following near-total exchange of ruminal contents. J Dairy Sci 2010;93:5902–5912. 41. Weimer PJ, Stevenson DM, Mertens DR. Shifts in bacterial community composition in the rumen of lactating dairy cows under milk fat-depressing conditions. J Dairy Sci 2010;93:265–278. 42. Kim SJ, Yim JH. Cryoprotective properties of exopolysaccharide (P-21653) produced by the Antarctic bacterium, Pseudoalteromonas artica KOPRI 21653. J Microbiol 2007;46:510–514. 43. Hubálek Z. Protectant used in the cryopreservation of microorganisms. Cryobiology 2003;46:205–229. 44. Hancocks NH, Thomas CR, Stocks SM, Hewitt CJ. An investigation into the preservation of microbial cell banks for α–amilase production during 5 l fed-batch Bacillus licheniformis fermentations. Biotechnol Lett 2010;32:1405–1412. 45. Geissinger O, Herlemann DPR, Morschel E, Maier UG, Brune A. The ultramicrobacterium “Elusimicrobium minutum” gen. nov., sp. nov., the ﬁrst cultivated representative of the termite group I phylum. Appl Environ Microbiol 2009;75:2831–2840. 46. Herlemann DPR, Geissinger O, Ikeda-Ohtsubo W, Kunin V, Sun H, Lapidus A, et al. Genomic analysis of “Elusimicrobium minutum,” the first cultivated 333

Rev Mex Cienc Pecu 2019;10(2):315-334

representative of the phylum “Elusimicrobia” (formerly termite group 1). Appl Environ Microbiol 2009;75:2841–2849. 47. McAllister TA, Bae HD, Jones GA, Cheng KJ. Microbial attachment and feed digestion in the rumen. J Anim Sci 1994;72:3004–3018. 48. Castillo-Lopez E, Moats J, Aluthge ND, Ramirez Ramirez HA, Christensen D, Mutsvangwa T et al. Effect of partially replacing a barley-based concentrate with flaxseed-based products on the rumen bacterial population of lactating Holstein dairy cows. J Appl Microbiol 2017;124:42-57. 49. Castillo-Lopez E, Jenkins CJR, Aluthge ND, Westom T, Fernando SC, Kononoff PJ. The effects of regular or low-fat distillers grains and solubles on rumen methanogenesis and the rumen bacterial community. J Appl Microbiol 2017;123:1381-1395. 50. Danielsson R, Dicksved J, Sun L, Gonda H, Muller B, Schnurer A, Bertilsson J. Methane production in dairy cows correlates with rumen methanogenic and bacterial community structure. Front Microbiol 2017;8:226. 51. Anderson CL, Schneider CJ, Erickson GE, MacDonald JC, Fernando SC. Rumen bacterial communities can be acclimated faster to high concentrate diets than currently implemented feedlot programs. J Appl Microbiol 2016;120:588–599. 52. Castillo-Lopez E, Klopfenstein TJ, Anderson C, Alugthge ND, Fernando SC, Kononoff PJ. Effect of feeding dried distillers grains with solubles on rumen biohydrogenation, intestinal fatty acid profile and gut microbial diversity evaluated through DNA pyrosequencing. J Anim Sci 2014;92:733–743. 53. Saydack AH, Grant CC, Smit IP, Vermeulen WJ, Baard J, Zambatis N. Climate and vegetation in a semi-arid savanna: Development of a climate-vegetation response model linking plant metabolic performance to climate and the effects on forage availability for large herbivores. Koedoe 2012;54:1–12. 54. Posada SL, Noguera RR, Segura JA. Ruminant feces used as inoculum for the in vitro gas production technique. Rev Colomb Cienc Pecu 2012;25:592-600. 55. Hughes M, Mlambo V, Lallo CHO, Jennins PGA. Potency of microbial inocula from bovine faeces and rumen fluid for in vitro digestion of different tropical forage substrates. Grass Forage Sci 2012;67:263-273. 56. Zicarelli F, Calabro S, Cutrignelli MI, Infascelli F, Tudisco R, Bovera F et al. In vitro fermentation characteristics of diets with different forage/concentrate ratios: comparison of rumen and faecal inocula. J Sci Food Agric 2011;91:1213-1221. 57. Castillo-Lopez E, Klopfenstein TJ, Fernando SC, Kononoff PJ. In vivo determination of rumen undegradable protein of dried distillers grains with solubles and evaluation of duodenal microbial crude protein flow. J Anim Sci 2013;91:924-934. 334

https://doi.org/10.22319/rmcp.v10i2.4569 Article

Productive and economic response to partial replacement of cracked maize ears with ground maize or molasses in supplements for dualpurpose cows

Isela G. Salas-Reyes a Carlos M. Arriaga-Jordán b Julieta G. Estrada-Flores b Anastacio García-Martínez a Rolando Rojo-Rubio a José F. Vázquez Armijo a Benito Albarrán-Portillo a*

Universidad Autónoma del Estado de México. Centro Universitario UAEM. Temascaltepec. Km 67.5 Carretera Toluca-Tejupilco, Temascaltepec. 51300. Estado de México. México. b

Universidad Autónoma del Estado de México. Instituto de Ciencias Agropecuarias y Rurales. Estado de México. México.

*Corresponding autor: balbarranp@gmail.com

Abstract: The aim of the study was to assess the effect of partial replacement of cracked maize ears with ground maize (GM) or sugar cane molasses (SCM) in supplements for dual purpose cows. Eighteen (18) multiparous cows (414 ± 13 kg of body weight and 106 ± 32 d in milk) were randomly assigned to the treatments. Treatments were as follows: 1) Control supplement (CS) which consisted of 87% of cracked maize ears (CME), 11% soybean meal, and 2% urea; 2) Ground maize replacing 20% of CME in CS (GMS); 3) Sugar cane molasses replacing 18% of CME in the CS (MOS). Each cow received 5 kg/d of 335

Rev Mex Cienc Pecu 2019;10(2):335-352

supplement DM, whereas their calves received 1.8 kg/d DM of the CS. The experiment lasted eleven weeks, and data were recorded once at the end of every week. Data were analysed using a linear mixed model as a completely randomized design. Net profit from milk and beef due to supplements were estimated using the partial budget approach. There were no differences (P>0.05) between treatments on milk composition, body conditions score, nor daily weight gain of cows and calves. However, compared to GM, CS shown greater (9.0 %, P<0.05) dry matter intake and SCM shown greater milk yield (18.6 %, P<0.05). Partial replacement of cracked maize ears with ground maize or sugar cane molasses, in supplements for dual purpose cows, did not affected animal productive response. However, considered the combined net profit margins (milk and calves), SCM got an average of 9 % higher profits compared of the rest of supplements. Key words: Milk, Beef, Brown Swiss, Tropical Grasses, Energy supplementation.

Received: 05/08/2017 Accepted: 30/04/2018

Introduction

Dual-purpose (DP) bovine production, in tropical regions of Mexico and Latin America, rely on the use of local resources like grasses, shrubs and trees under extensive management. In the south west of the State of Mexico as well as in most tropical regions of MĂŠxico, cattle feed exclusively on forages under extensive grazing during the rainy season. During the dry season (December to May), the availability and nutritional quality of forages decreases considerably. To minimize the impact of the low forage availability and to the diminished quality of forages, farmers supplement their cattle with variable amounts of supplement (5 to 9 kg DM/cow/d)(1). Farmersâ&#x20AC;&#x2122; decision on the amount of supplement offered to each cow, and the time to start supplementation during the dry season, depends on the availability of forage on pastures. The second half of the dry period (March to May) is the most critical for farmers, since forage in pastures becomes scarce, so that farmers use supplements to sustain animal production(1,2). Metabolizable energy has been reported as one of the main constrains for cattle production under tropical conditions due to the low nutritional value of forages (due mainly to high fibre content)(3).

336

Rev Mex Cienc Pecu 2019;10(2):335-352

Supplements represent between 50 to 70 % of milk and beef production costs. Due to supplementation, milk production costs increase 22 % in the dry season, in comparison to the rainy season, reducing the already slim profit margins(1,2). In order to keep supplement costs as low as possible, harvested maize ears produced in the farm are cracked instead of being ground, in order to reduce processing cost. However, total digestibility of cracked maize ears is lower (87.6 %), compared with ground maize (91.7 %)(4). Frequently, un-degraded large particles of maize appear in faeces representing a waste and inefficient use of this resource. Maize starch is the most common source of energy for dairy cattle, that degrades between 4 to 6.4 %/h. Carbohydrate sources with faster degradation rates than maize may improve ruminal conditions, resulting in better animal productive response to supplementation(5). Sugar cane molasses is a readily source of energy, that has been used in supplements for cattle feeding on low quality grasses in tropical regions(6,7,8). However, despite availability and relatively low cost, farmers in the study region do not incorporate this resource in their cattle supplements. The inclusion of sugar cane molasses under in vitro studies improves fibre digestibility of a combination of star grass (Cynodon nlemfuensis) and Leucaena leucocephala; whereas the inclusion of maize grain increased in vitro volatile fatty acids production(9). Furthermore, addition of sugar cane molasses to supplements based on maize silage, improved growing rates of heifers under tropical conditions, reducing production costs at the same time(6). The aim of this experiment was to evaluate the productive and economic response of partial replacement of cracked maize ears (control supplement) with ground maize (20 % inclusion) (GM), or sugar cane molasses (18 % inclusion) (SCM), in supplements offered to grazing dual purpose Brow Swiss cows during the dry season in a subtropical region of Mexico.

Material and methods

Area description

The study was performed in a commercial dual purpose farm in the State of Mexico, at 19° 04 ´48” N and 100° 13’ 18” W, and an altitude of 1,470 m. Climate is subtropical (warm sub-humid), with a mean annual temperature of 23 °C, and 1,115 mm mean annual rainfall.

337

Rev Mex Cienc Pecu 2019;10(2):335-352

Experimental farm

The participating farm is of typical characteristics of DP of the region. Resources, management and socioeconomic characteristics have been described(1). Briefly, the farm produces milk all year round, and milk and calves sales represent 42 and 44 % of annual incomes, respectively. Daily milk incomes cover daily expenses of farm operation, and the economic needs of the farming family. Calves are sold at 18 mo old, usually by the end of the rainy season. Farm land extension is 100 ha and the perimeter fenced, with no subdivisions, where cattle graze all year round. Usually, around 35 milking cows and their calves plus a sire are kept as a single herd, whereas replacements, are kept on a different location. Cattle feed exclusively on forages during the rainy season, receiving only mineral supplementation. During the dry season, cows are supplemented with a mixture of cracked maize, and soybean meal (~5 kg/cow/d DM).

Animals and management

Eighteen (18) multiparous Brown Swiss cows (414 Âą 13 kg weight and 106 Âą 32 d in milk) were randomly allocated to one of three treatments (six cows per treatment). Experimental cows grazed with the rest of the herd. Stocking rate was 0.25 animal units (AU) per ha. Cows had access to ad libitum water and minerals. Milking of cows was manually from 0700 to 0900 h once a day. Before milking, the calf was allowed to suckle for few seconds the first milk for let-down, and then tied to the cowÂ´s neck until the end of milking. Afterwards, calves suckled the residual milk and remained with their dam in grazing areas until 1400 h. After been separated from their dams, calves remained in a different paddock until the next morning, where they grazed on a pasture of similar characteristics as the cows. Calves received 1.8 kg DM/d of control supplement (CS) (Table 1), and had access to water and a mineral mix ad libitum.

338

Rev Mex Cienc Pecu 2019;10(2):335-352

Table 1: Ingredients and chemical composition of control (CS), ground maize (GM), and sugar cane molasses (SCM) supplements (g/kg DM)

Cracked maize ears Soybean meal Ground maize Molasses Urea Dry matter Crude protein Neutral detergent fibre Acid detergent fibre Lignin Dry matter digestibility Organic matter digestibility NDF digestibility Metabolizable energy, MJ/kg DM Solubles (a) Solubles rate (0-1) Insoluble (b) Insolubles rate (0-1) Lag (h)

CS GM Ingredient composition: 866 696 111 81 200 23 23 Chemical composition: 873 870 124 113 379 218 55.7 63.0 11.0 11.5 903 908

SCM

SEM

693 107 177 23 849 119 214 48.9 11.4 940

4.1 14.4 2.7 0.6 8.5 5.2

895

901

933

11.3

792

715

809

3.2

14.1

14.6

16.1

59.8 0.098 256.8 0.062 5.8

46.5 0.128 274.2 0.067 5.5

68.1 0.153 255.7 0.065 4.2

From a previous study (unpublished), calves consumed on average 3.0 kg of milk estimated by weight differences before suckling (0900 h milking) and after removal from their dams (1400 h). The management of cows and calves during the experiment was minimal in order to avoid stress in the animals, and not to interfere with the farmerâ&#x20AC;&#x2122;s daily activities. Therefore, cows and calves were weighted once a week.

Treatments

The control supplement (CS) was based on cracked maize ears (CME) (husk, kernels and cob) (86.6 %), complemented with soybean meal (11.1 %) and urea (2.3 %). In the first experimental supplement, 20 % of ground maize grain partially replaced cracked maize ears, to form the ground maize supplement (GM). For the second experimental

339

Rev Mex Cienc Pecu 2019;10(2):335-352

supplement, 18 % of molasses replaced the same proportion of cracked ear maize (SCM). Table 1 shows the ingredients and chemical composition of supplements. Experimental cows individually received their assigned supplement (5 kg of DM/cow/d) while milking, in a cloth bag tied to their neck. All cows consumed the supplement entirely. The experiment started on February 19th and ended on May 8th of 2015. Previous to the start, cows spent one week as adaptation period to the supplements. Then, the experiment proceeded for the next 11 wk (experimental periods).

Milk yield and composition

Milk yield was recorded on the last day of every week. After milking, cows and calves were weighted. Body condition score (BCS) of cows was determined on a 1 to 5 score scale. Milk composition (fat, protein and lactose g/kg) was determined within 2 h after milking on recording day with a portable ultra-sound milk analyser. Milk urea nitrogen (MUN) was subsequently determined in the laboratory by enzymatic colorimetry.

Feed sampling and chemical analysis

Pasture variables were determined every other week (1, 3, 5, 7, 9 and 11). Available herbage mass (AHM) (kg DM ha/d), was determined by placing six quadrants (0.25 m2), adjacent to a patch where the cows were grazing at the sampling time. Herbage mass (HM) inside the quadrants was cut to ground level with shears to determine AHM in grazing areas. From the quadrants, a 25 g sample was separated into live and dead matter, and each was weighed. Determined pasture variables (kg DM/ha) were: available herbage mass (AHM), and its corresponding amounts of leaf (LA), stem (SA), dead matter (DMA), and live matter (LMA). Green matter was considered live matter, and non-green matter was considered dead matter. LA and SA were estimated from the 25 g samples harvested from each quadrant by separating leaves from stems and weighing them separately. Finally, a composite sample from the six quadrants (100 g) per week was taken to determine chemical composition of pastures. Supplements were sampled on two consecutive days at the end of every week, to determine chemical composition of a composite sample. Feed samples were dried at

340

Rev Mex Cienc Pecu 2019;10(2):335-352

60 Â°C to constant weight to determine DM. They were also analysed for ash, crude protein (CP) by the micro Kjeldahl method(10). Neutral detergent fibre (NDF), acid detergent fibre (ADF) and acid detergent lignin (ADL) using the Ankom method(11). The ME of supplements and pasture was estimated using the OMd values from in vitro gas production, using the following equation(12): ME (MJ/kg DM) = (OMd) (0.0157) Where: ME = metabolizable energy (MJ/kg DM); OMd digestibility of organic matter (g/kg DM). The in vitro dry matter digestibility (DMd), organic matter digestibility (OMd), and NDF digestibility (NDFd) were determined using the in vitro gas production technique. Degradation fractions a, b and L of herbage were estimated according to the following equation(13). đ?&#x2018;Ś = đ??´ {1 â&#x2C6;&#x2019; đ?&#x2018;&#x2019;đ?&#x2018;Ľđ?&#x2018;?â&#x152;&#x2C6;â&#x2C6;&#x2019; đ?&#x2018;? (đ?&#x2018;Ą â&#x2C6;&#x2019; đ?&#x2018;&#x2021;) â&#x2C6;&#x2019; đ?&#x2018;?(â&#x2C6;&#x161;đ?&#x2018;Ą â&#x2C6;&#x2019; â&#x2C6;&#x161;đ?&#x2018;&#x2021;)â&#x152;&#x2030;} Where: y = cumulative gas production (mL), t = is the incubation time in hours, A = is the asymptote of the total gas produce (mL/g DM), b = is the constant of gas produced per hour, c = is a constant, and T = is a discrete lag time in hours in that microorganisms colonize the substrate and star the fermentation. The degradation fraction rate (Âľ) was calculated using the following equation(13): Âľ = b + đ?&#x153;&#x2021; = b + c ,đ?&#x2018;Ą â&#x2030;Ľ đ?&#x2018;&#x2021; 2 â&#x2C6;&#x161;đ?&#x2018;Ą

Herbage dry matter intake

CowÂ´s herbage DMI was estimated indirectly from animal performance, taking calculations for energy requirements of milking cows from and estimated ME content of feeds from chemical analysis(14).

341

Rev Mex Cienc Pecu 2019;10(2):335-352

Herbage dry matter intake (kg/day) = MEm+MEml+MELw+SupME Herbage ME

Where: MEm, MEml and MELw are the estimated ME requirements for maintenance, milk yield and live weight change, respectively. SupME is the ME provided by the supplement (MJ/kg DM). Herbage ME is the estimated ME concentration of herbage samples. The ME concentrations of supplements and pasture were calculated using OMd results from in vitro gas production(13): đ?&#x2018;&#x20AC;đ??¸ (

đ?&#x2018;&#x20AC;đ??˝ đ??ˇđ?&#x2018;&#x20AC;) = (đ?&#x2018;&#x201A;đ?&#x2018;&#x20AC;đ?&#x2018;&#x2018; )(0.0157) đ?&#x2018;&#x2DC;đ?&#x2018;&#x201D;

Economic analysis

The economic analysis was performed using the partial budget approach(15), to determine the economic profits from the use of supplements, exclusively for milk and beef (i.e. kg of weaned calves). Economic analysis results are expressed in US dollars.

Statistical analyses

The data were analysed using the MIXED procedure of SAS 9.0(16) for a completely randomized experimental design, with cow as a random effect to account for repeated measurements on the same animal throughout the experiment. The model used was: yijk= Âľ + Ď&#x201E;i + Î´ij + tk + (Ď&#x201E;*t)ik + Îľijk where: yijk= dependent variable, Âľ= overall mean, Ď&#x201E;i= fixed effect of treatment (i =1, 2 and 3), tk= fixed effect of Wk (k = 1, 2â&#x20AC;Ś11), (Ď&#x201E;*t)ik= fixed effect of interaction between treatment i and Wk k , Î´ij= random effect of cow j within each treatment and, Îľijk= random error term. 342

Rev Mex Cienc Pecu 2019;10(2):335-352

Least squares means and standard errors for fixed effects were obtained and used for multiple mean comparisons. Significant differences between treatments were declared when P<0.05.

Results Table 2 shows the chemical composition of pasture herbage as well as in vitro gas production parameters. Crude protein average was 58 g/kg DM, having maximum values in wk3 and wk4 (70 and 75 g/kg DM, respectively). Dry matter digestibility (DMd) and estimated metabolizable energy (ME) had the highest values in wk 4 and wk 5 (620 and 606 g/kg DM, and 9.6 and 9.4 MJ/kg DM, respectively).

Table 2: Herbage chemical characteristics (g/kg) and gas production curve parameters Experimental week Dry matter Crude protein Neutral detergent fibre Acid detergent fibre Acid detergent lignin Dry matter digestibility Organic matter digestibility NDFd ME, MJ/kg DM

1 701 50 716 371 14 559 552 489 8.7

3 675 75 704 367 14 580 572 501 9.0

5 648 70 706 360 15 620 612 523 9.6

7 623 53 703 369 17 606 599 560 9.4

9 694 46 738 401 14 555 548 526 8.6

11 613 50 796 424 16 497 490 423 7.7

200

198

209

213

181

160

0.0 32

0.031

0.033

0.032

0.034

0.039

5.1

5.3

5.2

Mean 651 58 728 380 15 570 564 517 8.9

SD 36.8 12.1 36.2 25.0 1.3 43.7 43.5 46.4 0.7

The asymptotic gas production (b) (mL/g DM), had the highest values in wk 4 and wk 5. The rate of gas production (c) showed the highest values in wk 6 (0.034) and wk 7 (0.039), whereas from wk 1 to wk 5 the rate remained constant ~ 0.032/h. Initial lag time before gas production begins (L) had the lowest value in wk1 (4.4), while from wk 2 to wk 7 values remained close to 5.2. Average NHA was 11 (kg/ha/d), whereas AHM was 1,932 (kg/ha DM). Pasture morphological composition is shown in Figure 1. Green pasture represented 58 % of AHM, with and increasing trend towards the end of the study, due to some light rains; whereas leaf represented 38 % of the AHM. Cynodon plectostachyus was the predominant

343

Rev Mex Cienc Pecu 2019;10(2):335-352

grass representing 92 % of the botanical composition; while Paspalum notatum and Paspalum convexum represented 5 and 3 %, respectively.

Figure 1: Available herbage mass (AHM) (kg/ha DM), morphological composition (kg/ha DM) throughout experimental weeks 2000

kg/ha DM

1500

1000

500

0 1

Experimental week Dead material

Green material

Leaf

Stem

Green leaf

AHM

Table 1 shows ingredients and chemical composition of supplements. Average DM was 864 g/kg. Crude protein contents were 124 (CS), 113 (GM) and, 119 (SCM) g/kg DM. Neutral detergent fibre of CS was 43 % higher (379 g/kg DM) than experimental supplements (218 and 214 g/kg DM for GM and SCM, respectively). Molasses inclusion increased values for dry mater digestibility (DMd), organic matter digestibility (OMd) and neutral detergent fibre digestibility (NDFd), as well as estimated metabolizable energy (MJ/kg DM), compared with CS and GM. SCM water soluble content represented by the a fraction produced higher gas volume (68.1), than CS (59.8) and GM (46.5) (Table 1). Soluble fermentation rate of CS was lower (0.098), than GM and SCM (0.128 and 0.153, respectively). Insolubles (b), which is the insoluble but potentially fermentable material was higher for GM (274.2), than CS (256.8) and SCM (255.7). The lag phase was shorter for MOS (4.2 h), intermediate for GM (5.5 h) and longer for CS (5.8 h). Table 3 shows animal productive response variables. There were no significant differences due to treatments, with the exception of DMI and milk yield (P<0.01). The effect of week was highly significant (P<0.01) for all variables.

344

Rev Mex Cienc Pecu 2019;10(2):335-352

Table 3: Least squares means of animal response variables due to control supplement (CS), ground maize supplement (GM) and, sugar cane molasses supplement (SCM) on dual-purpose lactating cows during dry season

Dry matter intake, kg/d

SCM

SEM

12.2a

11.1b

11.7ab

0.27

Milk, kg/d

6.2

5.7

7.0

0.31

Fat, g/kg

33.8

34.6

33.2

2.1

Protein, g/kg

30.5

30.6

0.19

Lactose, g/kg

42.2

43.1

42.7

0.43

Milk urea nitrogen, mg/dL

8.0

7.5

0.28

Cow weight, kg

430

406

430

16.9

Cow weight gain, kg/d

0.283

0.136

0.281

0.13

Body condition score, 1-5 Calves daily weight gain, kg/d

1.5 0.68

1.5 0.71

1.5

0.03

0.73

0.07

a,b,c

Means within a row with different superscript are significantly different (P<0.05).

Dry matter intake (kg/cow/d) of CS was statistically not different (P>0.05) from SCM (12.2 and 11.7 kg/d, respectively), but significantly different (P<0.05) from GM (11.1 kg/d); whereas GM and SCM were not different from each other (P>0.05). Milk yield was statistically similar between CS and SCM with 6.2 and 7 kg/cow/d; whereas GM (5.7 kg) was different from SCM but similar to CS. There were no differences (P>0.05) for the rest of the response variables. Fat, protein and lactose mean contents were 33.9, 30.5 and 42.7 (g/kg), respectively. Mean milk urea nitrogen (MUN) was 7.7 (mg/dL). Live-weight was not different between treatments (430, 406 and 430 kg/cow, for CS, GM and SCM, respectively). Cows given CS, GM and SCM had similar (P>0.05) daily weight gains of 0.283, 0.136 and 0.281 (kg/d), respectively. The average body condition score (BCS) was 1.5 points. Calves mean weight gain was 0.7 (kg/d) (Table 3). Table 4 shows the partial budget analysis of milk and beef (weaned calves) due to supplements. Molasses supplement had a higher production cost (i.e. total supplement cost), but had better economic returns (i.e. total milk profit margin).

345

Rev Mex Cienc Pecu 2019;10(2):335-352

Table 4: Milk and beef production cost due to supplements: control (CS), ground maize (GM) and sugar cane molasses (SCM)

Beef production

Milk production

Item

Mean

SCM

Total supplement, kg/treatment Supplement cost, $/kg DM %Ŧ Total supplement cost, $ %Ŧ Total milk yield, kg/treatment %Ŧ

2,730 0.24 -0.05 655 -0.01 3,260 -0.02

2,730 0.25 -0.01 677 +0.02 3,041 -0.09

2,730 0.27 +0.07 660 -0.01 3,713 +0.11

Milk selling price, $/kg Milk sales incomes, $ %Ŧ Milk production cost, $/kg %Ŧ Milk´s profit margin, $/kg %Ŧ Total milk´s profit margin, $/treatment %Ŧ Total milk´s profit margin, $/cow %Ŧ Supplement, kg/treatment

0.39 1,269 -0.02 0.20 -0.03 0.19 +0.04 613 0.0 102 0.0 601

0.39 1,184 -0.09 0.22 +0.06 0.17 -0.07 507 -0.17 85 -0.17 601

0.39 1,446 +0.11 0.20 -0.03 0.19 0.04 721 +0.17 120 +0.17 601

Supplement cost, $/kg

0.24

Total supplement cost, $ Beef produce, kg/treatment %Ŧ Beef selling price, $/kg Beef incomes, $/treatment %Ŧ Beef production cost, $/kg Beef margin profit, $/treatment %Ŧ Beef margin profit, $/calf %Ŧ Total net margin profit, ($) (milk + beef) %Ŧ

144 371 -0.04 3.24 1,205 -0.04 0.34 1,064 -0.04 177 -0.04 1,678 -0.03

144 388 0.0 3.24 1,258 0.0 0.34 1,118 +0.01 186 +0.01 1,625 -0.06

144 399 +0.03 3.24 1,293 +0.03 0.34 1,153 +0.04 192 +0.04 1,874 +0.09

144

2,730 0.25 664 3,338 0.39 1,300 0.21 0.18 614 102 601

386 3.24 1,252 0.34 1,112 185 1,726

%Ŧ= Difference in relation to mean.

Beef production (kg/treatment as weaned calves) for SCM was higher (399 kg) than CS and GM (371 and 388 kg, respectively); resulting in higher beef incomes and profit margins. GM was second best for both indicators. Overall, SCM was the treatment with higher total net profit margin from milk plus beef with $1,874 (P<0.01); whereas CS came second ($1,678) and, GM generated the lowest total net profit margin with $1,625.

346

Rev Mex Cienc Pecu 2019;10(2):335-352

Discussion

The AHM in grazing areas remained low but constant in the grazing areas. The low but constant forage production during the experiment in spite of dry conditions could be due to water filtered to pastures from a stream that runs across the study area. This may explain in part the constant green material in grazing areas from wk1 to wk9; whereas the sharp increment was due to unusual rain at the end of the study. In spite of these, the chemical composition of pasture across the experiment was low in terms of CP, DMd, and estimated ME. Similar chemical and agronomic characteristics of pastures dominated by Cynodon plectostachyus, from a nearby location to this study have been reported(17,18). Molasses inclusion improved in vitro degradability of the supplement given by the fractions a and b, resulting in 0.5 MJ of estimated ME more than CS and GM. This improvement could have had a positive impact on forage digestibility, by improving the ruminal environment due to the supply of readily available energy, which could have increased dry matter intake (additive effect), as demonstrated in previous studies(19,20,21). The second best supplement was CS, according to soluble fraction a. Better degradation kinetics were expected in the GM than in the CS, since a small particle size of maize grain increases starch digestibility (high soluble fraction)(22). However, CS had a higher soluble (a) fraction, higher insoluble (potentially degradable â&#x20AC;&#x153;bâ&#x20AC;?) and higher insoluble fermentation rate, than GM. These could be due to higher proportion of husk and cob material in CS, which have a greater potential degradability, compared with GM. The low milk production response of cows on GM was unexpected, since ground maize has been reported to yield more energy in rumen in the form of propionate production. Rumen propionate production has been reported as the main driver of milk in lactating dairy cows(4). One possible explanation to the low milk production response could be related to the fact that GM had about 20 % less soybean than the other two supplements. Low rumen degradable protein has been related to lower NDF digestibility(23,24). Furthermore, under low grass quality conditions like in this experiment, sugar cane molasses supplemented with urea, could be a better alternative than ground maize as a source of energy, since sugars are more rapidly fermented in the rumen than the starch from maize, allowing a readily supply of energy to rumen microbes. This may explain the higher soluble fraction and shorter lag phase of SCM(25). Milk yields and milk composition in this study were lower than yields of Holstein and Brown Swiss x Zebu cows(26,27). However, cows in both studies lost weight (~ 40 kg) and BCS, attributed to insufficient nutrients provided by the supplements; contrary to weight gained by the cows in this experiment (~ 0.233 kg/d). 347

Rev Mex Cienc Pecu 2019;10(2):335-352

In this study, treatments did not affect milk composition (i.e. fat, protein or lactose); contrary to this, reports show significant differences in protein yield (kg/d) due to a reduction in maize grain particle size that increased starch fermentation, resulting on higher propionate concentration in rumen(23). Despite cows did gain weight due to supplements (average 0.233 kg/d), body condition score remained unchanged throughout the experiment (~1.5). Dual purpose cows under typical management do not receive enough energy supplies, resulting in small cow size, and limited dry matter intake capacity limiting milk yields. To overcome this situation, it has been proposed supplementation of good quality tropical grasses (0.6 to 4.4 kg/d), and supplements (between 4.0 and 5.0 kg/d), all year round. By doing this, cows will likely be on a better body condition score, (positive energy balance), particularly during critical periods like early lactation, resulting on higher milk yields(28). It is important to note that the weather conditions during the dry season were atypical so the economic analysis should be taken with caution. From the economic point of view, molasses inclusion in the supplement increased profits from milk and beef. The small milk yield difference between these two treatments made a significant economic difference in milk and beef profit margin(29). Combined net profit margins from milk and beef (weaned calves) were around 9 % higher for SCM compared to CS and GM. Molasses has been reported as an energy supplement that results in better milk and beef revenues(29,30). However, these effects do not always happen. In situations when molasses is of high cost, its inclusion in dairy cow supplements represented a loss of revenue due to the small milk response(31). Farms in the study region cannot adopt any kind of forage conservation due to the steep conditions of pastures, besides the increased cost due to labour and machinery. Therefore, molasses inclusion in supplements during the dry season could be a supplementation alternative to sustain animal production performance, when forages are limited and of low quality.

Conclusions and implications

Partial replacement of cracked maize ears with sugar cane molasses, in supplements for grazing Brown Swiss dual purpose cows during the dry season, significantly increased milk yields over a supplement with ground maize. There were no differences in other animal productive response variables. Combined net profit margins (milk and calf sales) were on average 9 % higher when including sugar cane molasses in supplements.

348

Rev Mex Cienc Pecu 2019;10(2):335-352

Acknowledgments

For the financial support of the Consejo Nacional de Ciencia y Tecnología (CONACYT) of Mexico and to the Universidad Autónoma del Estado de México (UAEMEX). Gratitude is also expressed for the funding of this research through grants 1003/2012RCA (UAEMEX) and 129449 CB-2009 (CONACYT).

Literature cited: 1.

Albarrán-Portillo B, Rebollar-Rebollar S, García-Martínez A, Rojo-Rubio R, AvilésNova F, Arriaga-Jordán, CM. Socioeconomic and productive characterization of dual-purpose farms oriented to milk production in a subtropical region of Mexico. Trop Anim Health Prod 2015;44(3):519-523. doi:10.1007/s11250-014-0753-8.

Salas-Reyes IG, Arriaga-Jordán CM, Rebollar-Rebollar S, García-Martínez A, Albarrán-Portillo B. Assessment of the sustainability of dual-purpose farms by the IDEA method in the subtropical area of central Mexico. Trop Anim Health Prod 2015;47(6):1187-1194. DOI 10.1007/s11250-015-0846-z.

Absalón-Medina VA, Blake RW, Gene Fox D, Juárez-Lagunes EG, Nicholson FC, Canudas-Lara EG. Limitations and potentials of dual-purpose cows herds in central coastal Veracruz, Mexico. Trop Anim Health Prod 2011;44(6):1131-1142. doi:10.1007/s11250-011-0049-1.

Owens FN, Zinn RA, Kim YK. Limits to starch digestion in the ruminant small intestine. J Anim Sci 1986;63(5):1634-1648.doi:10.2527/jas1986.6351634x.

Gehman AM, Bertrand JA, Jenkins TC, Pinkerton BW. The effect of carbohydrate source on nitrogen capture in dairy cows on pasture. J Dairy Sci 2006;89(7):26592667.

Vélez-Terranova M, Sánchez-Guerrero H, Duran Castro CV. Evaluación de la suplementación energética durante el crecimiento de novillas lecheras de reemplazo utilizando el modelo CNCPS. Trop Subtropical Agroecosys 2014;17(1):143-154.

Granzin BC, Dryden G McL. Monensin supplementation of lactating cows fed tropical grasses and cane molasses or grain. Anim Feed Sci Tech 2005;120: 1-16.

Hunter RA, Kennedy PM. Effects of increasing rates of molasses supplementation and forages quality on the productivity of steers. Anim Prod Sci 2016;56:871-881. http://dx.doi.org/10.1071/AN14846.

349

Rev Mex Cienc Pecu 2019;10(2):335-352

Estrada-Liévano JM, Sandoval-Castro CA, Ramírez-Avilés L, Capetillo-Leal CM. In vitro fermentation efficiency of mixtures of Cynodon nlemfuensis, Leucaena leucocephala and two energy sources (maize or sugar cane molasses). Trop Subtropical Agroecosys 2009;10(3):497-503.

10. AOAC, Official Methods for Analysis. Association of Official Analytical Chemists 1990, Arlington, VA, USA. 11. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and non-starch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74(10):3583–97. 12. AFRC (Agricultural and Food Research Council). An advisory manual prepared by the AFRC Technical Committee on Responses to Nutrients. Wallingford: CAB International. 1993. 13. Mauricio MR, Mould FL, Dhanoa MS, Owen E, Channa K, Theodorou MK. A semiautomated in vitro gas production technique for ruminant feedstuff evaluation. Anim Feed Sci Tech 1999;79(4):321-330. 14. Baker RD. Estimating herbage intake from animal performance. In: Leaver, JD editor. Herbage intake handbook. Hurley: British Grassland Society;1982:77-93. 15. Espinoza-Ortega A, Espinosa-Ayala E, Bastida-López J, Castañeda-Martínez T, Arriaga-Jordán CM. Small-Scale dairy farming in the highlands of central Mexico: technical, economic and social aspects and their impact on poverty. Exp Agr 2007;43:241-256. 16. SAS Institute. SAS User´s guide. Statistics, Version 9 ed. SAS Inst., Inc., Cary, NC. 2002. 17. López-González F, Estrada-Flores JG, Avilés-Nova F, Yong-Angel G, HernándezMorales P, Martínez-Loperena R, et al. Agronomic evaluation and chemical composition of african star grass (Cynodon plectostachyus) in the southern region of the state of Mexico. Trop Subtropical Agroecosys 2010;12(1):1-9. 18. López-González F, Sánchez-Valdés JJ, Castelán-Ortega OA, Albarrán-Portillo B, Estrada-Flores JG. Agronomic and nutritional characteristics of three grass species in the southern region of Mexico. Indian J Anim Sci 2015;85(3):271-274. 19. Morales JL, Van Horn HH, Moore JE. Dietary interaction of cane molasses with source of roughage: intake and lactation effects. J Dairy Sci 1989;72(9):2331-2338. 20. Petty SR, Poppi DP. The live weight gain response of heifers to supplements of molasses or maize while grazing irrigated Leucaena leucocephala/Digitaria eriantha pastures in north-west Australia. Anim Prod Sci 2012;52:619-623. http://dx.doi.org/10.1071/AN11242.

350

Rev Mex Cienc Pecu 2019;10(2):335-352

21. Tuyen DV, Tolosa XM, Poppi DP, McLennan SR. Effect of varying the proportion of molasses in the diet on intake, digestion and microbial protein production by steers. Anim Prod Sci 2014;55:17-26. http://dx.doi.org/10.1071/AN13225. 22. Rémond D, Cabrera-Estrada JI, Champon M, Chauveau B, Coudure R, Poncet C. Effect of corn particle size on site and extent of starch digestion in lactating dairy cows. J Dairy Sci 2004;87(5):1389-1399. 23. San Emeterio F, Reis RB, Campos WE, Satter LD. Effect of coarse or fine grinding on utilization of dry or ensiled corn by lactating dairy cows. J Dairy Sci 2000;83(12):2839-2848. 24. Barros T, Quaassdorff MA, Aguerre MJ, Olmos CJJ, Bertics SJ, Crump PM, Wattiaux MA. Effects of dietary crude protein concentration on late-lactation dairy cow performance and indicators of nitrogen utilization. J Dairy Sci 2017;100:54345448. 25. Baurhoo A, Mustafa A. Effect of molasses supplementation on performance of lactating cows fed high-alfalfa silage diets. J Dairy Sci 2014;97(2):2072-1076. 26. Tinoco-Magaña JC, Aguilar-Pérez CF, Delgado-Leon R, Magaña-Monforte JG, Ku Vera JC, Herrera-Camacho J. Effects of energy supplementation on productivity of dual-purpose cows grazing in a silvopastoral system in the tropics. Trop Anim Health Prod 2012;44(5):1073-1078. doi:10.1007/s11250-011-0042-8. 27. Peniche-González IN, González-López ZU, Aguilar-Pérez CF, Ku-Vera JC, AyalaBurgos AJ, Solorio-Sánchez FJ. Milk production and reproduction of dual-purpose cows with a restricted concentrate allowance and access to an association of Leucaena leucocephala and Cynodon nlemfuensis. J App Anim Res 2014;42(3):345351. 28. Absalón-Medina VA, Blake RW, Gene Fox D, Juárez-Lagunes EG, Nicholson FC, Canudas-Lara EG, et al. Limitations and potentials of dual-purpose cows herds in central coastal Veracruz, Mexico. Trop Anim Health Prod 2011;44(6):1131-1142. doi:10.1007/s11250-011-0049-1. 29. Salvador-Loreto I, Arriaga-Jordán CM, Estrada-Flores JG, Vicente-Mainar F, García-Martínez A, Albarrán-Portillo B. Molasses supplementation for dual-purpose cows during the dry season in subtropical Mexico. Trop Anim Health Prod 2016;48(3):643-648. doi:10.1007/s11250-016-1012-y. 30. Jiménez-Ferrer G, Mendoza-Martínez G, Soto-Pinto L, Alayón-Gamboa A. Evaluation of local energy sources in milk production in a tropical silvopastoral system with Erythrina poeppigiana. Trop Anim Health Prod 2015;47(5):903-908. doi:10.1007/s11250-015-0806-7.

351

Rev Mex Cienc Pecu 2019;10(2):335-352

31. Katongole CB, Kabirizi JM, Nanyeenya WN, Kigongo J, Nviiri G. Milk yields response of cows supplemented with sorghum stover and Tithonia diversifolia leaf hay diets during the dry season in northern Uganda. Trop Anim Health Prod 2016;48(7):1463-1469. doi:10.1007/s11250-016-1119-1.

352

https://doi.org/10.22319/rmcp.v10i2.4319 Article

Alfalfa (Medicago sativa L.) biomass yield at different pasture ages and cutting frequencies

José Alfredo Gaytán Valencia a Rigoberto Castro Rivera b* Yuri Villegas Aparicio a Gisela Aguilar Benítez c María Myrna Solís Oba b José Cruz Carrillo Rodríguez a Luís Octavio Negrete Sánchez d

Instituto Tecnológico del Valle de Oaxaca, División de estudios de Posgrado. ExHacienda de Nazareno, Santa Cruz Xoxocotlán, Oaxaca, México. b

Instituto Politécnico Nacional, CIBA Tlaxcala. Tlaxcala, México.

Universidad Autónoma de San Luís Potosí. Instituto de Investigación de Zonas Desérticas, San Luís Potosí. México. d

Universidad Autónoma de San Luis Potosí. Facultad de Agronomía y Veterinaria. San Luis Potosí, México.

*Corresponding author: rcastror@ipn.mx

Abstract: Cutting frequency and pasture age are strategic variables in defining alfalfa crop management aimed at increasing biomass yield. An analysis was done to identify the effects of three cutting frequencies (three, four and five weeks) in the spring-summer cycle on dry matter production, growth rate and performance variables in alfalfa (Medicago sativa L. Oaxaca criolla) in three pasture ages (one, two and three years). A 353

Rev Mex Cienc Pecu 2019;10(2):353-366

random block design with a 3x3 factorial arrangement (cutting frequency and pasture age) was used. Highest (P<0.01) average dry matter yield (7,528 kg DM ha-1) and growth rate (257 kg DM ha-1 d-1) were recorded at the one-year pasture age. Average dry matter yield was highest at the four-week cutting frequency (6,844 kg DM ha-1), which was 29% higher than at three weeks and 16% higher than at five weeks. In the one-year pasture, leaf and stem production was 45% higher than in the three-year pasture and forage height was 32% higher. At the four-week cutting frequency leaf production was 21% higher than at the three-week frequency, while stem production was 49% higher and forage height was 33% higher. The evaluated variables and their interactions determined estimated alfalfa component yield. Key words: Alfalfa, Cutting frequency, Pasture age.

Received: 07/11/2016 Accepted: 22/03/2018

Introduction

Factors such as forage yield, protein content, digestibility, rusticity and adaptability to different environmental conditions have made alfalfa (Medicago sativa L.) the most cultivated Fabaceae worldwide. It is ubiquitous as an animal feed, and is even recommended as a dietary supplement to combat malnutrition and digestive disorders in humans(1). In 2016, alfalfa was grown on 387,154 ha in Mexico, with an average annual yield of 86 t per hectare green forage. In the state of Oaxaca, 3,489 ha are sown in alfalfa the production from which accounts for 1.45% of national production, placing the state sixteenth nationwide. The majority (95%) of alfalfa production in Oaxaca occurs in the central valleys, where it is the second largest crop(2). Pasture yield, growth and persistence, as well as forage quality, depend on cut frequency and intensity, and season(3,4). Cut frequency determines forage nutritional value and morphogenesis. Defining a management plan based on biomass accumulation rate is therefore fundamental to alfalfa production(5,6). Pasture regrowth age, or fallow time, affects animal production profitability, particularly in milk production systems(7). Cut frequency also modifies regrowth mortality rate and survival by allowing radiation to reach the crown level, which affects resprout rate and stem death, as well as photosynthesis in early post-cut foliage(8).

354

Rev Mex Cienc Pecu 2019;10(2):353-366

Biomass accumulation rate determines cut frequency and therefore time to pasture harvest. The leaf:stem ratio, and consequently forage quality, varies with plant maturity, recovery time between successive cuts, regrowth time, season and environmental conditions(8-11). Forage nutritional value is also correlated to other phenological variables such as weight, density and stem size and leaf count per stem(10,12,13). The physical and chemical changes in forage caused by pasture age and cut frequency manifest in variations in digestibility, yield, and lignin, fiber and protein contents(14,15). A species’ potential forage production also depends on the morphological structures (leaf and stem) remaining post-cut and root carbohydrate reserves for production of new stems and leaves(16). In a previous study evaluating alfalfa pastures over five consecutive years average annual forage yield was highest (18,300 kg ha-1) at two and four years, independent of initial sowing density(17). Another study evaluating nineteen alfalfa varieties over two consecutive years found differences (P < 0.05) in plant height, main stem diameter, green forage and dry matter production, and protein content(18). The present study objective was to evaluate forage yield, leaf and stem production, crop growth rate and the leaf:stem ratio in alfalfa (Medicago sativa L., var. Oaxaca criolla) at different pasture ages and cut frequencies.

Materials and methods

Data were collected during spring-summer (March - October 2013) from alfalfa (Medicago sativa L., var. Oaxaca criolla) pastures under cultivation for one, two and three years at the experimental agricultural field of the Technological Institute of the Valley of Oaxaca, Nazareno Xoxocotlan, Oaxaca (17°01’ 20.40” N; 96°44’51.50” W; 1,530 m asl). The predominant climate in the region is dry steppe (BS1h, (h)), with a 20.6 °C average annual temperature, and 645 mm average annual precipitation(2). Average monthly precipitation and temperature during the study period were within normal values (Table 1).

355

Rev Mex Cienc Pecu 2019;10(2):353-366

Table 1: Average monthly temperature and precipitation during study period (March â&#x20AC;&#x201C; October 2013). Month March April May June July August September October

Temperature (oC) Max. Min. Aver. 31.0 9.4 35.8 30.2 10.4 35.5 30.3 12.3 36.4 28.9 15.1 36.4 29.7 13.0 36.2 27.0 13.0 33.5 26.8 15.2 34.4 26.8 13.0 33.3

Precipitation (mm) Means 2.8 2.7 2.7 4.9 3.6 3.1 8.3 1.6

An experimental design of random blocks was implemented based on terrain slope, establishing 36 experimental units of 9 m2 each. The 3 x 3 factorial arrangement included the factors pasture age (one, two and three years since sowing) and cut frequency (three, four and five weeks), generating nine treatments. The pastures were not fertilized and were sprinkler irrigated to field capacity. A homogenizing initial cut to 5 cm was done at the beginning of the experiment to reduce the covariate effect. Forage yield per cut in each experimental unit was measured by randomly placing a steel frame (0.25 m2) on an area in which all forage in the frame was cut to 5 cm(19). Harvested biomass was stored in paper bags marked with the treatment number and replicate, and dried in a forced air oven at 55 Â°C for 72 h to constant weight to determine dry matter content. Forage height was recorded before each cut with a 1-meter-long graduated ruler with 0.5 cm accuracy. Ten height measurements were taken inside each experimental unit on randomly selected plants with the ruler placed vertically from plant base to apex(20,21). The harvested forage samples from each experimental unit were homogenized and a subsample of approximately 25% taken. This was separated into morphological components (stems, leaves, inflorescence and dead matter) and the weight of each measured in dry base(4). Growth rate (GR) was calculated using dry matter yield per cut with the following formula:

đ??şđ?&#x2018;&#x2026; =

đ??ťđ??š đ?&#x2018;Ą

356

Rev Mex Cienc Pecu 2019;10(2):353-366

Where: HF = harvested forage (kg DM ha-1) and t = days from one cut to the next.

The leaf:stem ratio per cut was calculated by dividing average weight of leaves by average weight of stems. Values were grouped and analyzed with the PROC MIXED procedure in the SASÂŽ statistics software package(22). The Akaike criterion was used to select the variance and covariance matrix(23). This in turn was used to identify the effects of the sources of variation (cut frequency: 3, 4 and 5 weeks), pasture age (one, two and three years), which were considered fixed effects while the block effect was treated as random(24). Treatment means were estimated using LSMEANS, and comparison between them done with the probability of difference (PDIFF) using a 5% significance level. For the linear regression between pasture height and forage yield, the variables considered were forage height and dry matter yield. Linear regression equations were produced using 95% confidence intervals, and yield predicted by pasture age and cut frequency (CF). These calculations were done using a linear polynomial model in the Wizard Regression module of the SigmaPlot ver. 10 package(25).

Results and discussion

The factorial analysis showed that average biomass production was highest at the fourweek CF (6,844 Kg DM ha-1) and in the one-year pasture (7,528 Kg DM ha-1)(Table 2). These levels were 42% higher than in the two-year pasture and 44% higher than in the three-year pasture. Interaction between the factors was highly significant (P<0.001).

357

Rev Mex Cienc Pecu 2019;10(2):353-366

Table 2: Forage, stem and leaf yields, height, growth rate and leaf:stem (L:S) ratio at the studied pasture ages and cut frequencies Forage Leaf yield Stem yield Height Growth rate yield kg DM ha-1 kg DM ha-1 cm kg MS ha-1d-1 kg DM ha-1

Factor

Pasture age (years)

Cut frequency (weeks)

1 2 3 MSE 3 4 5 MSE

7528 a 5290 b 5208 b 286 ** 5289 c 6844 a 5892 b 354 **

5105 a 3321 b 3511 b 170 ** 3697 b 4474 a 3766 b 243 **

2424 a 1969 b 1669 c 133 ** 1592 c 2370 a 2127 b 129 **

37 a 30 b 28 b 1.4 ** 27 c 36 a 32 b 1.5 **

275 a 200 b 194 b 13 ** 252 a 244 a 173 b 13 **

Ratio L:S

2.6 b 3.4 a 2.6 b 0.11 ** 2.8 a 2.4 b 2.3 b 0.1 **

Pasture age/cut frequency interaction was highly significant (P<0.001). a,b,c Different lowercase case letters in the same column indicate significant difference (Tukey 0.05). MSE = mean standard error. ** (P<0.05).

When run by treatment, the four-week CF produced the highest (P<0.01) dry matter yields in the one-year (8,786 kg DM ha-1) and two-year (6,394 kg) pastures (Figure 1A). Yield in the one-year pasture at the four-week CF was 42 % higher than the three-week CF and 20 % higher than the five-week CF. Yield in the two-year pasture at the fourweek CF was 15 % higher than in the three-week CF and 54 % higher than in the fiveweek CF. However, biomass accumulation was highest (P< 0.01) in the three-year pasture at the five-week CF; this was 35 % higher than the three-week CF at the same pasture age. The latter also had the lowest biomass accumulation value among the one- and threeyear pasture ages, suggesting that older pastures require longer inter-cut rest periods.

358

Rev Mex Cienc Pecu 2019;10(2):353-366

Figure 1: Dry matter yield (A), leaf:stem ratio (B), crop growth rate (C), pasture height (D), leaf yield (E) and stem yield (F) in alfalfa pastures at different cut frequencies and pasture ages

8000

7000

6000

5000

4000

3.2

Height (cm)

Kg DM ha-1

9000

6000

3.0

2.6

4000

2.4

Kg DM leaf ha-1

5000 2.8

3000 2.2 2000

2.0

3500

350

3000

2500 250 2000 200

Kg DM stem ha-1

Kg DM ha-1 d-1

300

1500 150 1000 100 1

Age of cultivated pastureland 3 Weeks 4 Weeks 5 Weeks

Cutting frequencies

In the factorial analysis, leaf yield was highest in the one-year pasture (5,105 kg DM ha1 ); this is 53 % higher than in the two-year pasture and 45 % higher than in the three-year pasture. Among the cut frequencies, this parameter was highest at the four-week CF (4,474 kg DM leaf ha-1) (Table 2). When analyzed by treatment, the highest leaf yields were recorded at the four-week CF in the one- (5,856 kg DM leaf ha-1) and two-year pastures (3,900 kg). These levels were 30% higher than in the three-week CF and 51 %

359

Rev Mex Cienc Pecu 2019;10(2):353-366

higher than in the five-week CF. The three-week CF produced the lowest leaf yield in the one- and three-year pastures (Figure 1E). Factorial analysis showed the highest stem yields (Table 2) to be in the one-year pasture (2,424 kg DM ha-1) and at the four-week CF (2,370 kg). Among the treatments, the fourweek CF produced the highest leaf yield (P<0.01) in one- and two-year pastures, with an average of 2,710 kg and an average contribution of 34% of total yield (Figure 1F). The five-week CF produced the highest leaf yield in the three-year pasture (2,157 kg), which represented 37 % of total yield. The crop growth rate coefficient was lowest, with no differences between treatments (P>0.05), in the two- and three-year pastures (Table 2). The highest coefficients were at the three- and four-week CF (Figure 1C), with no differences between them. The present results agree with a study evaluating the growth dynamic of three-year old alfalfa (var. Oaxaca criolla) which concluded that in spring and summer cuts should be done at week four or five to obtain the highest leaf proportions and the least amount of senescent material(6). This supports the hypothesis that environmental conditions (temperature and precipitation) during the spring-summer period promote higher leaf and forage production. A report evaluating growth dynamics in two alfalfa varieties found that age at resprouting affected forage yield at different times of the year, and proposed that cuts should be made at week four in the summer and week six in the spring(5). Another study addressing growth in five alfalfa varieties found that yields were highest in the summer using a four week CF, and that the accumulated production in spring and summer represented 58% of total annual production(3). Overall, the above reports suggest that, independent of variety, postcut pasture recovery period in different seasons is the variable which determines yield and component proportions. The importance of season (spring-summer) is supported by a study of a three-year-old alfalfa pasture in which 57 % of forage production occurred in spring and summer(4). No differences (P>0.05) in yield were observed between three-, four- and five-week CF in the spring, which differs from the present results. This discrepancy could be due differences in experimental sites since climatic conditions differed because of geographical location. The same study also found that forage production in summer did not differ (P>0.05) between the four- and five-week CF, although both these CF produced values higher (P<0.05) than the three-week CF(4). This coincides with the present results in the three-year pasture, and further supports the hypothesis that alfalfa crop age influences reactions to inter-cut recovery periods. In an evaluation of four-, five- and six-week CF in a pasture shortly after planting and in two consecutive years, no differences (P>0.05) in forage yield were observed, although yield was 1.46 % higher in the first year than the second year(26). However, differences (P<0.05) were present between CF within the same year, with the four-week interval 360

Rev Mex Cienc Pecu 2019;10(2):353-366

resulting in the lowest yield (6,600 kg DM ha-1). Again, discrepancies between this study and the present results can be attributed to their being done in different geographical locations. In another study, four alfalfa varieties in newly planted pastures and subjected to severe (28 d) and light (35 d) CF found that in the summer all four varieties yielded 24 % more (P<0.05) forage when cut every 28 d and 70 % more (P<0.05) when cut every 35 d(27). However, the 28-d CF resulted in a better leaf:stem ratio than the 35-d CF. This study agrees with the present results for the one- and two-year pastures, but differs from those for the three-year pasture. Pasture age is apparently a determining factor in the leaf:stem ratio. An evaluation of accumulated alfalfa yield over five consecutive years found that yield was highest in the two- and four-year pastures (18,300 kg ha-1, average), independent of initial planting density(17). This contrasts with the present results, and again suggests that climatic conditions may have affected biomass accumulation in the years evaluated. Forage height was highest in the four-week CF (36 cm), and the one-year pasture (37 cm) (Table 2). It was lowest (28 cm) in the three-year pasture. Analysis by treatment (Figure 1D) showed that forage height was lowest with the three-week CF in the one- (31 cm) and three-year pastures (23 cm). The five-week CF was highest (P<0.01) in the threeyear pasture (31 cm). In a previous study average forage height only varied (P>0.05) during the first year after planting, independent of alfalfa variety(28). However, other factors such as ambient temperature can also influence plant growth performance and height. A different study evaluating nineteen alfalfa varieties reported differences in plant height, main stem diameter, green forage and dry matter production, and protein content during two consecutive years after planting(18). Considering the above it appears that under certain experimental conditions crop variety can influence growth and yield parameters. The leaf:stem ratio did not differ (P>0.05) between the one- and three-year pastures, nor between the four- and five-week CFs (Table 2). Both the four- and five-week CFs had lower values than all the pasture ages (Figure 1B). Leaf proportion was highest (P<0.01) at the three-week CF (2.8) and in the two-year pasture (3.4) (Table 2). Alfalfa varieties that produce high dry matter yield also have a low leaf:stem ratio(3), highlighting the importance of evaluating stem weight and height in relation to leaves. As plant height increases the leaf proportion decreases, a phenomenon clearly linked to phenological stage. Some studies have shown that the leaf:stem ratio decreases beginning in the preflowering stage, a trend that becomes particularly notable in the initial flowering stages(29). Growth, and thus leaf:stem ratio values, can also respond to season. In a study evaluating alfalfa physiological condition using mean stage by count (MSC) and mean stage by weight (MSW), values were clearly lower (P<0.001) in the autumn than in the spring-summer even at equal CFs, indicating that plant growth is not uniform year round(30). 361

Rev Mex Cienc Pecu 2019;10(2):353-366

The linear regressions showed the coefficient of determination to be higher than 0.8 for all variables (Figures 2A, 2C, 2D, 2E and 2F), except the two-year pasture (r2 = 0.74, Figure 2B). In practical terms the equations indicate that an increase of one centimeter in the biomass represented 204.4 kg DM ha-1 in the one-year pasture, 170.7 kg in the twoyear pasture and 163.7 kg in the three-year pasture. This same increase represented 180.7 kg at the three-week CF, 217.95 kg at the four-week CF and 253.9 kg at the five-week CF. These results generally coincide with previous reports that state pasture height to have a 0.80+ correlation in C3 forage species(20,21).

362

Rev Mex Cienc Pecu 2019;10(2):353-366

Figure 2: Linear regressions between forage height and yield in one- (A), two- (B) and three-year (C) pastures, and at three- (D), four- (E) and five-week cutting frequencies

y=204.46x-70.63 r2= 0.83

y=180.76x+413.84 r2= 0.83

10000

8000

6000

4000

12000

Kg DM ha-1

y=217.95x-1001.9 r2= 0.88

y=170.63x+247.17 r2= 0.74

10000

8000

6000

4000

12000

Kg DM ha-1

10000

Kg DM ha -1

B 10000

y=163.73x+664.15 r2= 0.83

y=253.99x-2108.2 r2= 0.81

10000

8000

6000

4000

Heigth (cm)

Straight slope (black line), confidence interval (0.95) (blue line), predicted data (red line).

More frequent cutting reduces N mobility in roots, consequently lowering the photosynthetic capacity of newly emerged leaves post-cut, leading to lower foliar expansion rates and less forage yield(13). This effect can be observed in the stem appearance rate, the number of sprouts per plant, the leaf area index and the stem death rate(8). The results observed in the treatments evaluated in the present study may be partially explained by the quantity of reserve substances stored in the alfalfa plant crowns and roots(11). However, longer inter-cut rest periods will not necessarily exponentially increase 363

Kg DM ha-1

Kg DM ha -1

10000

12000

Kg DM ha -1

12000

Rev Mex Cienc Pecu 2019;10(2):353-366

biomass production. This highlights the need to identify optimum cutting frequency for each forage species, time of year and production condition.

Conclusions and implications

In the studied alfalfa variety (Oaxaca criolla) biomass accumulation was highest in the one-year pasture, with significant relative decreases in the two- and three-year pastures. Using the four-week cut frequency, more biomass production was observed in the oneand two-year pastures. Plant yield proportions were mainly influenced by the interaction between the evaluated factors, resulting in a more complex reaction.

Literature cited: 1. Gawel E, Grzelak M, Janyszek M. Lucerne (Medicago sativa L.) in the human dietcase reports and short reports. J Herb Med 2017;(10):8-16. 2. SIAP. Cierre de la producción agrícola http://nube.siap.gob.mx/cierre_agricola/. Consultado 9 Ene, 2018.

por

cultivo.

3. Rivas JMA, López CC, Hernández GA, Pérez PJ. Efecto de tres regímenes de cosecha en el comportamiento productivo de cinco variedades comerciales de alfalfa (Medicago sativa L.). Téc Pecu Méx 2005;43(1):79-92. 4. Mendoza PSI, Hernández GA, Pérez PJ, Quero CAR, Escalante EAS, Zaragoza RJL, Ramírez RO. Respuesta productiva de la alfalfa a diferentes frecuencias de corte. Rev Mex Cienc Pecu 2010;1(3):287-296. 5. Villegas AY, Hernández GA, Pérez PJ, López CC, Herrera HJG, Enríquez QJF, Gómez VA. Patrones estacionales de crecimiento de dos variedades de alfalfa (Medicago sativa L.). Téc Pecu Méx 2004;42(2):145-158. 6. Montes CFJ, Castro RR, Aguilar BG, Sandoval TS, Solís OMM. Acumulación estacional de biomasa aérea de alfalfa var. Oaxaca criolla (Medicago sativa L.). Rev Mex Cienc Pecu 2016;7(4):539:552.

364

Rev Mex Cienc Pecu 2019;10(2):353-366

7. Andrzejewska j, Contreras-Govea FE, Albrecht KA. Field prediction of alfalfa (Medicago sativa L.) fibre constituents in northern Europe. Grass Forage Sci 2013;(69):348-255. 8. Teixeira EI, Moot DJ, Brown HE, Fletcher AL. The dynamics of lucerne (Medicago sativa L.) yield components in response to defoliation frequency. Euro J Agr 2007;(26):394-400. 9. Cangiano CA, Pece MA. Acumulación de biomasa aérea en rebrote de alfalfa en Balcarde. Rev Arg Prod Anim 2005;(25):39-52. 10. Nescier IM, Dalla FLA, Prieto C. Calidad forrajera de alfalfas inoculadas y fertilizadas. Revi FAVE- Cienc Vet 2004;3(1-2):79-85. 11. Teixeira EI, Moot DJ, Mickelbart MV. Seasonal patterns of root C and N reserves of lucerne crops (Medicago sativa L.) grown in a temperate climate were affected by defoliation regime. Euro J Agr 2007;(26):10-20. 12. Morales AJ, Jiménez VJL, Velasco VVA, Villegas AY, Enríquez VJR, Hernández GA. Evaluación de 14 variedades de alfalfa con fertirriego en la mixteca de Oaxaca. Téc Pecu Méx 2006;44(3):277-288. 13. Teixeira EI, Moot DJ, Brown HE. Defoliation frequency and season affected radiation use efficiency and dry matter partitioning to roots of lucerne (Medicago sativa L.) crops. Euro J Agr 2008;(28):103-111. 14. Basigalup D. Mejoramiento de la calidad forrajera de la alfalfa. Rev Agromerc 2000;(42):16-18. 15. Cupic T, Grljusic S, Popovic S, Stjepanovic M, Tucak M. Protein and fiber contents in alfalfa leaves and stems. In: Delgado I, Lloveras J editors. Quality in lucerne and medics for animal production. Zaragoza, Spain: CIHEAM; 2001:215-218. 16. Martiniello P, Texeria da Silva JA. Physiological and bioagronomical aspect involved in growth and yield components of cultivated forage species in Mediterranean environments: A review. Eur J Plant Sci Biot 2011;5(2):64-98. 17. Sevilla GA, Pasinato A, García JM. Producción de forraje y densidad de plantas de alfalfa irrigada comparando distintas densidades de siembra. Arch Latin Prod Anim 2002;10(3):164-170. 18. Mustafa OT, Ilknur A. Nutritional Contents and yield performances of Lucerne (Medicago sativa L.) cultivars in Southern Black Sea Shores. J Anim Vet Adv 2010;9(15):2067-2073 19. Castro RR, Hernández GA, Vaquera HH, Hernández GJ, Quero CA, Enríquez QJF, Martínez HPA. Comportamiento productivo de asociaciones de gramíneas con leguminosas en pastoreo. Rev Fitotec Mex 2012;35(1):87-95. 365

Rev Mex Cienc Pecu 2019;10(2):353-366

20. Castillo EG, Valles MB, Jarillo RJ. Relación entre materia seca presente y altura en gramas nativas del trópico mexicano. Téc Pecu Méx 2009;47(1):79-92. 21. Castro RR, Hernández GA, Aguilar BG, Ramírez RO. 2011. Comparación de métodos para estimar rendimiento de forraje en praderas asociadas. Naturaleza y Desarrollo 2011;9(1):38-46. 22. SAS. User´s Guide: Statistics (Version 9.0 ed.). Cary NC, USA: SAS Inst. Inc. 2002. 23. Wolfinger RD. Covariance structure selection in general mixed models. Communications in statistics simulation and computation. Philadelphia 1993;22(4):10791106. 24. Littell RC, Milliken GA; Stroup WW, Wolfinger RD. SAS System for mixed models. Cary: SAS Institute, 1996. 25. SigmaPlot. User´s Guide (Versión 12.0.). Systat software 2015. 26. Ahmad J, Iqbal A, Ayub M, Akhtar J. Forage yield potential and quality attributes of alfalfa (Medicago sativa L.) under various agro-management techniques. J Anim Plant Sci 2016;26(2):465-474. 27. Villegas AY, Hernández GA, Martínez HPA, Pérez PJ, Herrera HJG, López CC. Rendimiento de forraje de variedades de alfalfa en dos calendarios de corte. Rev Fito Mex 2006;29 (4):369-372. 28. Altinok S, Karakaya A. Forage yield of different alfalfa cultivars under Ankara Conditions. Turk J Agric For 2002;(26):11-16. 29. Sun Y, Yang Q, Kang J, Guo W, Zhang T, Li Y. Yield evaluation of seventeen lucerne cultivars in the Beijing area of China. J Agric Sci 2011;3(4):215-223. 30. Bernáldez ML, Basigalup D, Martínez FJ, Balzarini M, Alomar D. Comparación de dos índices cuantitativos de estimación del estado de desarrollo de la alfalfa. Agriscientia 2006; XXIII(2):77-82.

366

https://doi.org/10.22319/rmcp.v10i2.4291 Article

Technological and physicochemical properties of milk and physicochemical aspects of traditional Oaxaca cheese

Eric Montes de Oca-Floresa Angélica Espinoza-Ortegaa Carlos Manuel Arriaga-Jordána

Instituto de Ciencias Agropecuarias y Rurales (ICAR, Universidad Autónoma del Estado de México). Carretera a Tlachaloya SN, Cerrillo Piedras Blancas 50090 Toluca de Lerdo, México.

*Corresponding author: angelica.cihuatl@gmail.com

Abstract: Milk technological and physicochemical characteristics are vital to cheese yield and quality, but can vary in response to factors such as season. An evaluation was done of milk technological and physicochemical characteristics in the dry and rainy seasons, and their effects on the physicochemical characteristics of traditional Oaxaca cheese. Milk and cheese samples were collected from 21 different small-scale processing plants. Milk samples were analyzed for fat and protein content, acidity level, coagulation time, curd firmness and yield. Cheese samples were analyzed for fat and protein content, acidity level, moisture content and chlorides level. A one-way ANOVA was used to evaluate inter-seasonal changes. Differences by season were observed in milk fat and protein contents, acidity level, coagulation time, curd firmness and yield. In the cheese interseasonal differences were present in fat content, acidity level and moisture content. Season clearly affected milk physicochemical and technological characteristics, and consequently cheese composition. Keywords: Cheese, Milk, Traditional, Technological properties, Physicochemical properties.

367

Rev Mex Cienc Pecu 2019;10(2):367-378

Received: 04/10/2016 Accepted: 08/05/2018

Introduction

Various factors effect raw milk composition, including cow breed, feeding regimen, season, and lactation stage(1,2,3). Differences in these and other factors are vitally important in the fabrication of dairy products such as cheeses because they can influence milk technological properties which are reflected in cheese yield and quality(4,5), coagulation time and gel firmness. Higher fat and protein concentrations together with favorable technological parameters can shorten coagulation time and produce greater curd firmness(4). This means there is a positive correlation between milk fat and protein percentages and cheese yield; in other words, higher solids concentrations result in higher yields(6). However, cheese quality and performance is not only due to solids volume, but also to protein quantity and quality(7). Because of its influence on technological parameters(8), protein is a crucial component in cheeses. This is mainly in response to k-casein(9,10), a phenomenon confirmed in reports of good coagulation in milk containing high k-casein levels, as well as adequate calcium and pH levels(11,12). Seasonal variations can strongly influence milk physicochemical properties and therefore cheese quality(13,14). This is due to variation in milk fat, protein and lactose percentages during an annual cycle; these are normally lower in spring-summer and higher in autumnwinter. Variation in these percentages responds mainly to changes in cow diet(15). Research on seasonal variations in milk has been done worldwide, but is scarce for milk from certain regions of Mexico and has not been linked to cheese quality. In central Mexico, Oaxaca-style cheese is handmade using artisanal techniques. One of the most widely known cheese types in the country, this traditional fresh cheese product belongs to the pasta filata (or stretched-curd) group of cheeses. It is made by kneading curdled raw milk in hot water until it becomes flexible and forms bands which are then wound into skeins(16). Because raw cowâ&#x20AC;&#x2122;s milk is used this cheese type is influenced by any variability in milk properties originating in the animal or external factors(17,18,19). Raw milk composition and technological properties can also affect dairy product nutritional value(15), especially in cheeses(20). Research has been done on the elaboration and physicochemical characteristics of Oaxaca cheese(21), and on the relationship between cheese flavor and texture(22). However, information is needed on how seasonal variation in milk quality affects Oaxaca cheese quality since fat content and density is known to vary widely in the milk produced by the

368

Rev Mex Cienc Pecu 2019;10(2):367-378

small-scale milk production systems that supply artisanal Oaxaca cheese makers(23). Since this cheese is made year round it is important to understand if variations in milk quality affect cheese yield and quality. The present study objectives were to document any seasonal variations in the technological and physicochemical properties of the raw milk used to make traditional Oaxaca-style cheese and if these correlate to cheese physicochemical characteristics.

Materials and methods

Milk and cheese samples

Three sets of milk and cheese samples were collected directly from small-scale dairies in the northwest of the state of Mexico, Mexico(23). Samples were collected during the dry season (February-April) and rainy season (August to October). All samples were stored at 4 °C while transported to the laboratory and analyzed within 24 h.

Milk analysis

Physicochemical Parameters: Fat (F) and protein (P) contents were analyzed using ultrasound waves in an Ecomilk Analyzer KAM98-2ª(21), and acidity measured using 0.1 M NAOH/phenolphthalein as an indicator. Technological parameters: Coagulation time (CT), curd firmness (CF) and yield (YD) were measured. For each test the samples were heated to 35 ºC, 10% industrial rennet immediately added, and temperature kept constant in a water bath. Measurement of CT was done by monitoring coagulation onset based on a sudden increase in viscosity(24) as measured with a viscometer (Model LVT, Brookfield Engineering Labs, Inc., Middleboro, MA 02346), using a No. 1 spindle at 12 rpm. Curd firmness (CF) was measured 30 min after addition of the rennet, and calculated as compression force (N)(25) using a texture analyzer (TX-XT2) with a 10 mm diameter cylindrical probe, 20 mm depth compression cycle and 1 mm/sec velocity. Yield (YD) was quantified by centrifuging to 369

Rev Mex Cienc Pecu 2019;10(2):367-378

force serum release. First, 1 ml sample (milk at 35 °C with 10% rennet) was added to Eppendorf tubes, allowed to sit for 30 min and centrifuged (Universal 320R, D7852Tuttlingen Heftich) at 14,000 rpm for 30 min at 35 ºC(26). Cheese yield was calculated by subtracting initial sample weight from that of the curd.

Cheese analysis

Acidity was measured using 0.1 M NAOH /phenolphthalein as an indicator (21). Standard AOAC (1990) methods were used to quantify fat (933.05), protein (991.20) and moisture (926.08); NaCl was measured following the Volhard method(27).

Statistical analysis

Milk and cheese data were analyzed with a one-way (season) ANOVA, and differences between means calculated with Tukey’s test (P<0.05). Relationships between milk physicochemical and technological properties were analyzed with a Pearson’s correlation. All analyses were done with the STATGRAPHICS Plus statistical package.

Results and discussion

Milk physicochemical and technological properties

Milk acidity, and protein and fat contents differed by season (Table 1), with higher fat and lower protein values in the rainy season (P<0.05). Previous studies(23) evaluating milk physicochemical quality found differences only in fat percentage and density, with higher fat values during the rainy months (average 3.62 %); this is similar to the present results.

370

Rev Mex Cienc Pecu 2019;10(2):367-378

Studies done from June to October(21) report 3.34 % fat, and 3.05 % protein, and another reported 3.18 % fat and 2.97 % protein(28); all these values are well below those observed in the present study. Changes in milk physicochemical and technological properties in different seasons are caused by forage availability in livestock feed. For instance there are reports of higher fat and protein percentages in the rainy season when cow diets consist mainly of green forages such as clover(29,30).

Table 1: Analysis of means for milk physicochemical and technological properties in dry and rainy seasons Fat (%)

Protein (%)

Acid (oD)

CT (minutes)

CF (Newton)

YD (%)

3.02ª

23.6 ª

16.7ª

0.11a

12.6a

Dry

3.28ª

Rainy

3.64b

2.94b

23.1 b

27.0b

0.09b

10.8b

SEM

0.014

0.004

0.024

0.565

0.001

0.082

CT = coagulation time; CF= curd firmness; YD = yield; D = Dornic degrees. SEM = Standard error of the mean. ab Different letter superscripts in the same columns indicate significant difference (P<0.001).

Milk technological properties differed between seasons, with lower CT, and higher CF and YD in the dry season (P<0.001). Fat and protein percentages are linked to desirable technological properties (lower CT and greater CF), as well as higher YD (23). However other factors such as protein content and quality (k-casein content, micelle characteristics, genetic polymorphism)(31-34), and calcium content and pH(11,12), can influence technological properties. Further research is needed to closely analyze these factors. The correlation between protein and YD, CF and CT was strongest in the dry season, but for fat it was only positive for YD. Other studies report higher yields and shorter coagulation times at high protein and low fat concentrations(9). In another study shorter coagulation times (14.61 min) and better firmness (62.63 mm) were observed in the winter rather than in the summer (16.84 min and 59.33 mm, respectively), probably due to higher milk fat content in the winter(35). A study done in a traditional dairy system found 3.41 % protein content, 4.17 % fat content and 6.06 min coagulation times in winter, but 3.48 % protein, 3.93 % fat and 3.26 min coagulation time in the summer(36). Some reports establish that at coagulation times longer than 30 min milk is no longer considered fit for cheese production(37,38). In the present results 14% of the dry season samples and 33% of rainy season samples exhibited coagulation times in excess of 30 min. The presence of green forage in the cow diet reduces milk enzymatic coagulation

371

Rev Mex Cienc Pecu 2019;10(2):367-378

time, mainly because of its effect on milk protein (caseins and whey proteins)(36); this is probably why more rainy season samples exceeded the 30 min limit.

Correlation between milk physicochemical and technological properties

Both CF and YD exhibited a negative correlation with CT in the dry (Table 2) and rainy seasons (Table 3). This coincides with a previous study in which gel was found to be weaker at longer coagulation times(26). In the present results acidity was also negatively correlated with CT. Other studies mention shorter coagulation times as acidity increases, as well as greater curd firmness(23,39). Reports of shorter coagulation times at low pH values illustrate the effect of low pH on coagulation capacity(37).

Table 2: Correlation coefficients between milk physicochemical and technological properties in the dry season Fat Protein Acidity CT CF YD

CT -0.149 -0.233** -0.534*** 1.000 -0.608*** -0.250**

CF 0.169 0.329*** 0.441*** -0.608*** 1.000 0.104

YD 0.388*** 0.286** 0.032 -0.250** 0.104 1.000

CT= coagulation time; CF= curd firmness; YD= yield. **P<0.01; ***P<0.001

The correlations between total solids (fat and protein) and CT, CF and YD varied in both seasons (Tables 2 and 3). Fat content positively correlated with YD in both seasons, but protein positively correlated to YD only in the dry season. This lack of clear correlation is noteworthy since previous studies report clearly improved CF as casein and protein percentages increase(26,38,40).

372

Rev Mex Cienc Pecu 2019;10(2):367-378

Table 3: Correlation coefficients between milk physicochemical and technological properties in the rainy season

Fat Protein Acidity CT CF YD

CT -0.030 -0.203* -0.660*** 1.000 -0.576*** -0.405***

CF 0.067 -0.069 0.121 -0.576*** 1.000 0.350***

YD 0.328*** 0.08 0.039 -0.405*** 0.350*** 1.000

CT= coagulation time; CF= curd firmness; YD= yield. *P<0.05; ***P<0.001.

Correlations have also been reported between milk components (e.g. fat, protein and calcium, among others) and curd firmness and curd bifurcation time, but not with coagulation time(41). Although the inter-season correlations did not coincide in the present results, they do meet the conditions in previous reports. As mentioned previously differences between studies can be attributed to variations in feeding conditions.

Traditional Oaxaca cheese physicochemical properties by season

Cheese fat content, acidity and moisture were all higher (P<0.05) in the rainy season (Table 4). These results differ somewhat from a study of Ricotta and Pecorino cheeses in which milk fat and protein percentages did not differ between seasons (spring, summer, fall and winter), but Ricotta cheese fat, protein and moisture contents did differ between seasons (P<0.05)(42). In the present results only the milk and cheese fat percentages were proportionately related to season, being higher in the rainy season and lower in the dry season. Protein content was not linked to season, even though yield was higher in the dry season (12.6 %). Although the solids ratio in milk and cheese strongly affects final product characteristics, it is also important in yield. Indeed, cheese yield is directly related to milk fat and casein contents(43). In the traditional Oaxaca cheese evaluated here protein was the parameter that most directly influenced yield.

373

Rev Mex Cienc Pecu 2019;10(2):367-378

Table 4: Physicochemical characteristics in traditional Oaxaca cheese by season

Dry season Rainy season SEM ab

Fat (%) 20.6ª 22.2b 0.103

Protein (%) 18.5 18.7 0.078

Acidity (%) 0.8ª 1.0b 0.011

Moisture (%) 50.4ª 51.3b 0.104

Chlorides (%) 4.2 4.3 0.067

SEM = Standard error of the mean. Different letter superscripts in the same column indicate difference (P<0.05).

Conclusions and implications

Season exerted a significant effect on the physicochemical and technological characteristics of milk as well as cheese composition. This effect was mainly due to seasonal variation in feed availability. Although fat, protein and acidity percentages positively correlated to milk technological properties, protein content had the greatest effect on yield, which was reflected in cheeses with low fat and moisture contents. Variation in milk and cheese quality between dairies is typical of traditional products produced with non-standardized processes. The present results provide technological guidelines to quantify this variation, and highlight that it is part of the craft cheese process which makes traditional Oaxaca cheese unique.

Acknowledgements

The research reported here was financed by the Consejo Nacional de Ciencia y Tecnología (CONACYT) and the Universidad Autónoma del Estado de México (UAEM). Eric Montes de Oca Flores received a Ph.D. scholarship from the CONACYT. The authors wish to express their special thanks to the cheese producers of Aculco for collaborating with this research.

374

Rev Mex Cienc Pecu 2019;10(2):367-378

Literature cited: 1.

Dillon P, Buckley F, O’Connor P, Hegarty D, Rath M. A comparison of different dairy cow breeds on a seasonal grass-based system of milk production 1. Milk production, live weight, body condition score and DM intake. Livest Prod Sci 2003;(83):21–33.

Ozrenk E, Selcuk-Inci S. The effect of seasonal variation on the composition of cow milk in Van Province. Pak J Nut 2008;7(1):61-164.

Křížová L, Hanuš O, Hadrová S, Kučera J, Samková E, Roubal P, Veselý A. Composition, physical and technological properties of raw milk as affected by cattle breed, season and type of diet. Ann Anim Sci 2014;(14):721–736.

Auldist, MJ, Johnston KA, White NJ, Fitzsimons WP, Boland MJA. Comparison of the composition, coagulation characteristics and cheesemaking capacity of milk from Friesian and Jersey dairy cows. J Dairy Res 2004;(71):51–57.

Schönfeldt HC, Hall NG, Smit LE. The need for country specific composition data on milk. Food Res Inter 2012;(47):207–209.

Barrón LJR, Fernández LE, Perea S, Chávarri F, María SVC, Torres MI, et al. Seasonal changes in the composition of bulk raw ewe’s milk used for Idiazabal cheese manufacture. Int Dairy J 2001;(11):771–778.

Wedholm A, Larsen LB, Lindmark-Mansson H, Karlsson AH, Andren A. Effect of protein composition on the cheese-making properties of milk from individual dairy cows. J Dairy Sci 2006;(89):3296–3305.

Guinee TP. Role of protein in cheese and cheese products. In: Fox PF, McSweeney PLH editors. Advanced dairy chemistry 1: Proteins, Part B, 3rd ed. Kluver Academic/Plenum Publisher; 2003:1083-1174.

Alipanah M, Kalashnikova LA. Influence of k-casein genetic variant on cheese making ability. J Anim Vet Adv 2006;(7):855-857.

10. Jõudu I, Henno M, Värv S, Viinalass H, Püssa T, Kaart T, Arney D, Kärt O. The effect of milk proteins on milk coagulation properties in stonian dairy breeds. Vet ir Zootec 2009;(68):14-19. 11. Serrano MB, Garzón SAI, González AME, Oliver AF, Figueroa SA, Martínez HJ. Factores que influyen en el tiempo de coagulación y en la cuajada de leche de oveja de raza merina. Prod Ovi Capr 1998;(23):175-178. 12. Joudu I, Merike H, Tanel K, Tonu P, Olav K. The effect of milk protein contents on the rennet coagulation properties of milk from individual dairy cows. Int Dairy J 2008;(18):964–967.

375

Rev Mex Cienc Pecu 2019;10(2):367-378

13. Mendina C, Ibánez FC, Torre P, Barcina Y. Influence of the season on proteolysis and sensory characteristics of idiazabal cheese. J Dairy Sci 2000;(83):1899–1904. 14. Lucey JA, Johnson ME, Horne DS. Perspective on the basis of the rheology and texture properties of cheese. J Dairy Sci 2003;(86):2725–2743. 15. Heck JML, Van-Valenberg HJF, Dijkstra J, Van-Hooijdonk ACM. Seasonal variation in the Dutch bovine raw milk composition. J Dairy Sci 2009;(92):4745– 4755. 16. Cervantes EF, Villegas de Gante A. La leche y los quesos artesanales. 1ª ed. México, DF: Editorial Porrúa; 2012. 17. Galina MA, Osnaya F, Cuchillo HM, Haenlein GFW. Cheese quality from milk of grazing or indoor fed Zebu cows and Alpine crossbred goats. Small Ruminant Res 2007;(71):264–272. 18. Martin B, Pomiés D, Pradel P, Verdier-Metz I, Rémond B. Yield and sensory properties of cheese made with milk from Holstein or Montbéliarde cows milked twice or once daily. J Dairy Sci 2009;(92):4730–4737. 19. Jaramillo DP, Buffa MN, Rodríguez M, Pérez-Baena I, Guamis B, Trujillo AJ. Effect of the inclusion of artichoke silage in the ration of lactating ewes on the properties of milk and cheese characteristics during ripening. J Dairy Sci 2010;(93):1412–1419. 20. Najera AI, Barrón LJR, Ribeiro P, Pelissier F, Abilleira E, Perez-Elortondo FJ, et al. Seasonal changes in the technological and compositional quality of ewe’s raw milks from commercial flocks underpart-time grazing. J Dairy Res 2009;(76):301–307. 21. Montes de Oca-Flores E, Castelán-Ortega OA, Estrada-Flores JG, Espinoza-Ortega A. Oaxaca cheese: Manufacture process and physicochemical characteristics. Int J Dairy Technol 2009;(62):535-540. 22. Villanueva-Carvajal A, Esteban-Chávez M, Espinoza-Ortega A, Arriaga-Jordán CM, Dominguez-Lopez A. Oaxaca cheese: flavour, texture and their interaction in a Mexican traditional pasta filata type cheese. CyTA – J Food 2012;(1):63-70. 23. De Marchi M, Dal-Zotto R, Cassandro M, Bittante G. Milk coagulation ability of five dairy cattle Breeds. J Dairy Sci 2007;(90):3986–3992. 24. López MB, Laencina J. Viscosimetric measurement of milk clotting time. Sci Tec Lattiero – Casearia 1994;(45):169-182. 25. Berruga MI, Molina P, Román M, Molina A. Características del yogur de oveja según el tipo de fermento lácteo. Universidad de Castilla La Mancha. 2003. www.seoc.eu. Consultado 9 Mar, 2012. 26. Jaramillo P, Zamora A, Guamisa B, Rodríguez M, Trujillo AJ. Cheesemaking aptitude of two Spanish dairy ewe breeds: Changes during lactation and relationship 376

Rev Mex Cienc Pecu 2019;10(2):367-378

between physico-chemical and technological properties. Small Ruminant Res 2008;(78):48–55. 27. NMX-F-360. Alimentos para humanos. Determinación de cloruros como cloruro de sodio (método de volhard). Foods for humans. Determination of chlorides as sodium chloride (volhard method), México. 1981. 28. Vázquez FC. Caracterización del queso Botanero producido en Aculco Estado de México [tesis maestría]. México: Universidad Autónoma del Estado de México; 2008. 29. Nobrega DB, Langoni H. Breed and season influence on milk quality parameters and in mastitis occurrence. Pesquisa Vet Brasil 2011;31(12):1045-1052. 30. Hattem HE, Taleb AT, Manal AN, Hanaa SS. Effect of pasteurization and season on milk composition and ripening of Ras cheese. J Brew Distilling 2012;3(2):15-22. 31. Pellegrini O, Remeuf F, Rivemale M, Barillet F. Renneting properties of milk from individual ewes: influence of genetic and non-genetic variables, and relationship with physico-chemical characteristics. J Dairy Res 1997;(64):355–366. 32. Alipanah ML, Kalashnikova A. Influence of k-casein genetic variant on cheese making ability. J Anim Vet Adv 2007;6(7):855-857. 33. Requena FD, Aguera EI, Requena F. Genética de la caseína de la leche en el bovino Frison. Rev Elec Vet 2007;(1):1-9. 34. Joudu I, Henno M, Värv S, Viinalass H, Püssa T, Kaart T, et al. The effect of milk proteins on milk coagulation properties in Stonian dairy breeds. Vet Zootech 2009;46(68):14-19. 35. Micari P, Caridi A, Colacino T, Caparra P, Cufari A. Physicochemical, microbiological and coagulating properties of ewe’s milk produced on the Calabrian Mount Poro plateau. Int J Dairy Technol 2002;(55):204-210. 36. Barłowska J, Litwińczuk Z, Brodziak A, Chabuz W. Effect of the production season on nutritional value and technological suitability of milk obtained from intensive (tmr) and traditional feeding system of cows. J Microbiol Biotechnol Food Sci 2012;1(5):1205-1220. 37. Tyriseva AM, Vahlsten T, Ruottinen O, Ojala M. Noncoagulation of milk in Finnish Ayrshire and Holstein-Friesian cows and effect of herds on milk coagulation ability. J Dairy Sci 2004;(87):3958–3966. 38. Toffanin V, De Marchi M, Penasa M, Pretto D, Cassandro M. Characterization of milk coagulation ability in bulk milk samples. Acta Argicul Slove Suppl 2012;(3):93–98.

377

Rev Mex Cienc Pecu 2019;10(2):367-378

39. Cecchinato A, Penasa M, Cipolat GC, De Marchi M, Bittante G. Short communication: Factors affecting coagulation properties of Mediterranean buffalo milk. J Dairy Sci 2011;(95):1709–1713. 40. Catarino I, Martins APL, Duarte E, Elane SP, Norberta de Pinho M. Rennet coagulation of sheep milk processed by ultrafiltration at low concentration factors. J Food Eng 2013;(114):249–254. 41. Auldist MJ, Johnston KA, White NJ, Fitzsimons WP, Boland MJ. A comparison of the composition, coagulation characteristics and cheesemaking capacity of milk from Friesian and Jersey dairy cows. J Dairy Res 2004;(71):51–57. 42. Pianaccioli L, Acciaioli A, Malvezzi R, Giustini L. Effect of season on characteristics of Pecorino cheese and Ricotta of Pistoiese Appennine: First results. Ital J Anim Sci 2007;(6):585-587. 43. Jaeggi JJ, Wendorff WL, Romero J, Berger M, Johnson ME. Impact of seasonal changes in ovine milk on composition and yield of a hard-pressed cheese. J Dairy Sci 2005;(88):1358–1363.

378

https://doi.org/10.22319/rmcp.v10i2.4568 Article

Evaluation of animal welfare conditions of South American camelids admitted to the Huancavelica municipal slaughterhouse, Peru

Carlos Eduardo Smith Davila a* Galy Juana Mendoza Torres a Claudio Gustavo Barbeito b Marcelo Daniel Ghezzi c

Universidad Peruana Cayetano Heredia. Facultad de Medicina Veterinaria y Zootecnia. PerĂş.

Universidad Nacional de La Plata. Facultad de Ciencias Veterinarias. Argentina.

Universidad Nacional del Centro de la Provincia de Buenos Aires. Facultad de Ciencias Veterinarias. Argentina.

* Corresponding author: carlos.smith@upch.pe

Abstract: Raising South American domestic camelids is the main source of subsistence in the Peruvian Andes. Under the understanding that pre-slaughter handling and transport practices can affect meat quality an evaluation was done of South American camelids based on animal welfare criteria and carcass lesions. Data were collected at the Huancavelica municipal slaughterhouse, Peru. A total of 203 carcasses were inspected post-slaughter for lesions from trauma. Information collected on transport included number of animals transported per vehicle, transport characteristics and animal handling practices. Every one of the 203 evaluated carcasses exhibited evidence of pre-slaughter mistreatment. A total of 1,418 lesions were recorded, with an average of 6.9 Âą 0.2 per carcass; four animals (1.9 %) exhibited generalized traumas. Of the 27 animal group arrivals, half were in cars (50.0 %). Grade 2 and 3 lesions were associated with transport in any vehicle type (OR= 2.20, 95% CI: 1.27 - 3.82), and no vision restriction (OR= 2.26, 95% CI: 1.66 - 3.06). Large area lesions were associated with pre-slaughter wait times 379

Rev Mex Cienc Pecu 2019;10(2):379-390

greater than 24 h (OR= 1.42, 95% CI: 0.99 - 2.03). South American camelid transport and handling practices at the studied slaughterhouse were generally poor and clearly compromised carcass quality as evidenced by ubiquitous lesions. Animal welfare criteria and regulations for South American camelids were not fulfilled. Key words: Animal welfare, South American camelid, Lesions, Transport.

Received: 01/08/2017 Accepted: 26/04/2018

Introduction

Approximately 85 % of the worldâ&#x20AC;&#x2122;s domestic South American camelids (SAC) are in Peru. This represents more than 5 million animals of which 4 million are alpacas (Vicugna pacos) and 1.2 million are llamas (Lama glama)(1). Raising SAC is the principal means of subsistence in the Peruvian Andean highlands since it is sustainable in this environment and provides wool and meat(2-5). Slaughter weight for alpacas is approximately 50 kg (52 % carcass yield) and for llamas it is 63 kg (55 % carcass yield)(2,6). Animal welfare (AW) is defined as the overall mental and physical health condition in which the animal is in harmony with its environment(7). This condition is ethically and commercially important and aimed at reducing detrimental stress, or distress, and preventing injury to animals during breeding, handling and transport(8,9). Transport of animals to the slaughterhouse can be a stress factor, and its effect increases with elapsed time(10,11,12). Such is its potential effect on AW that the World Organization of Animal Health (OIE) provides parameters and regulations for terrestrial transport of animals (Terrestrial Animal Health Code)(13). Distress causes elevation of catecholamine and blood cortisol levels(14,15), and consequent consumption of muscular and hepatic glycogen, affecting lactic acid formation and lowering muscle pH(16). Levels of pH greater than 5.8 cause the dark-firm-dry (DFD) phenomenon in meat(17). Lesions on carcasses lower meat quality, and require additional dressing of the injured parts, which affects final meat sale price(10). Despite its importance, no research has been done to date on the well-being of SAC during transport to slaughterhouses. In contrast, this aspect of cattle raising has been extensively studied; for example, in one study 58 % of bovine carcasses exhibited evidence of abuse during animal loading, handling and transport to the slaughterhouse(10). The present study objective was to document handling practices used with South American camelids during

380

Rev Mex Cienc Pecu 2019;10(2):379-390

transport to slaughter, and evaluate them considering animal welfare criteria, using postslaughter carcass lesions as an indicator of mistreatment.

Material and methods

Data were collected at the Huancavelica municipal slaughterhouse, Huancavelica Department, Peru. A total of 203 SAC carcasses were evaluated and information gathered on transport methods. Description of animal transport to the slaughterhouse was done using a survey validated by an AW group in Argentina. Information on transport time was collected in terms of hours to the slaughterhouse, kilometers traversed and road characteristics (trail, pavement, dirt and mixed). Handling information included type of fastening (i.e. if ropes were tied to anterior extremities, posterior extremities or both), vision restriction, sex, total number of animals transported per vehicle type, and means of transport (by vehicle or on foot). Vehicle types were four-passenger car, pick-up truck, cargo truck, passenger bus or minibus. Data was also recorded on what part of a vehicle the animals were transported in; for example, in the cabin (with and without passengers), the bed, the roof and even in the trunk. Animal density per vehicle could not be calculated due to wide variation in vehicle characteristics. When animals arrived at the slaughterhouse it was observed if they had fallen or died. Unloading was described in terms of wait time preunloading, during unloading and pre-slaughter, and if it rained. Handler behavior was also recorded from unloading to the rest corral. Observations were taken of if the animals were pulled by the ears, grabbed by the fleece in lateral areas of the thorax and abdomen, if shouts or whistles were used, and if they were lifted by the rump or beaten in this area. Carcass lesions were documented by an evaluator on the slaughter floor immediately after slaughter. They were described by direct observation and classified by depth as Grade 1 (superficial, involving subcutaneous tissue and outermost portion of muscle), Grade 2 (intermediate, muscle damage), and Grade 3 (deep, all tissue levels affected, including bone). Lesion area was classified as type A (< 25 cm²), B (25 to 100 cm²), C (> 100 cm²), and generalized (when injury covered at least one entire body region). Affected carcass area was indicated as Region 1 (pelvic area), Region 2 (thorax and abdomen) and Region 3 (lateral surface of thorax, cervical vertebrae and first five thoracic vertebrae). Data were processed with the Infostat/E ver. 2015e statistical package using a 95% confidence level and 80+% power(10,18). Analysis was done with parametric and nonparametric descriptive statistics. A chi-squared test was applied to identify associations between handling and transport characteristics and the presence of lesions on the carcasses. The odds ratio (OR) was calculated using PROC LOGISTIC in the Statistical Analysis Systems, version 9.1.3 program (SAS Institute Inc., Cary, NC, USA). The study 381

Rev Mex Cienc Pecu 2019;10(2):379-390

design was approved by the Institutional Animal Ethics Committee of the Cayetano Heredia Peruvian University (CONS-CIEA-054-2015).

Results

Most (64.6 %) of the SAC transported to the evaluated slaughterhouse were male. A total of 1,418 lesions were identified on all the carcasses with an average of 6.9 Âą 0.2 per carcass.

Means of transport

Twenty-seven (27) arrivals with SAC at the slaughterhouse were recorded, 25 in vehicles and two on foot (7.4 %). Cars were the most common means of transport, with thirteen arrivals (50.0 %) (Table 1).

Table 1: Vehicle type and animal handling data for transport of South American camelids (N = 203) Variable Vehicle Type: Pick-up Car Bus Truck Minibus On foot Vision Restricted: Yes No Restraints: Posterior Extrem. Both Extrem. Posterior Extrem + nose Not Restrained Unload time:

Transport n %

Carcasses n %

3 13 4 4 1 2

7.7 50.0 15.4 15.4 3.8 7.7

16 70 25 46 11 35

7.9 34.5 12.3 22.7 5.4 17.2

6 21

22.2 77.8

51 152

25.1 74.9

22 2 1 2

81.5 7.4 3.7 7.4

154 11 3 35

75.9 5.4 1.5 17.2

382

P value Extension Degree <0.001 0.38

0.293

<0.001

0.004

0.383

0.259

<0.001

Rev Mex Cienc Pecu 2019;10(2):379-390

< 10 mins > 10 mins Wrangling: Mixed Ears Rump Fleece Yelling/Whistling Rest Time: 48 h. 24 h. 1 h. Rain No Yes Road Type: Trail Mixed Pavement Dirt

21 6

77.8 22.2

136 67

67.0 33.0

13 6 3 3 2

48.1 22.2 11.1 11.1 7.4

129 34 17 17 6

63.5 16.7 8.4 8.4 3.0

2 19 6

7.4 70.4 22.2

17 136 50

8.4 67.0 24.6

6 21

22.2 77.8

163 40

80.3 19.7

12 8 6 1

44.4 29.6 22.2 3.7

107 54 36 6

52.7 26.6 17.7 3.0

0.09

0.139

0.005

0.691

0.309

0.741

0.74

<0.001

Carcass lesions

A total of 1,418 lesions were documented during the slaughter floor inspection. Most were Grade 1 depth (74.0 %), Type A in area (65.5 %), and almost half (48.8 %) were located in Region 2 (Table 2).

Table 2: Carcass lesion distribution: depth, area and location (N = 203) Lesion characteristic Depth: Degree 1 Degree 2 Degree 3 Area: Type A Type B Type C General Location: Region 1 Region 2 Region 3 383

1049 368 1

74.0 25.9 0.1

932 264 222 4

65.5 18.6 15.6 0.3

421 692 305

29.7 48.8 21.5

Rev Mex Cienc Pecu 2019;10(2):379-390

Download time was less than 10 min in most (77.8 %) transport methods, and wrangling method was largely mixed (48.1 %), employing yells, objects, blows and slaps, among others, to drive the animals. Pre-slaughter rest time was 24 h in 70 % of the groups. Rain during unloading was observed in 21 of the 27 groups arriving at the slaughterhouse. Road type as reported by carriers was trail or path in 44.4 % of cases. Neither rain nor road type constituted risk factors for carcass lesions. Transport in vehicles more than doubled (OR= 2.20; CI 95%: 1.27-3.82) the probability of Grade 2 and 3 lesions compared to transport on foot, but had no effect on lesion area (Figure 1). Non-restriction of vision also substantially increased the risk of large area (type C) lesions (OR = 2.26; CI 95%: 1.66-3.06), as did a pre-slaughter wait time longer than 24 h (OR = 1.42; CI 95%: 0.99 â&#x20AC;&#x201C; 2.03) (Table 3).

384

Rev Mex Cienc Pecu 2019;10(2):379-390

Figure 1: Putative cause/effect relationships for transport-related lesions in South American camelids Transport

Lesion

Description

Pulling fleece near base of tail to unload and sharp drop to ground

Irregular lesion on gluteus zone extending to base of tail

Description

Animal stepped on as passengers get off

Spotty lesion on back region

Description

Transported in luggage compartment, sharp fall to ground when unloaded

Two lesion combination: (A) linear lesion (B) circular lesion

Table 3: Factors associated with lesions in South American camelids by area and degree Area OR CI 95% Vehicle type Vision restricted Rest time

2.20 1.19 1.42

1.27 – 3.82 0.86 – 1.65 0.99 – 2.03 OR = odds ratio.

385

Degree OR CI 95% 0.86 2.28 1.13

0.61 – 1.22 1.67 – 3.11 0.85 – 1.5

Rev Mex Cienc Pecu 2019;10(2):379-390

Discussion

Presence of at least one injury in the post-slaughter inspections in the present results indicates overall poor animal management practices. This coincides with a previous report in which 92 % of the 264 studied carcasses exhibited at least one lesion with an average of 3.5 lesions per animal(19). Animal handling and transport are the most stressful and dangerous stages in the livestock production chain(5, 20,21). The present data confirm this in that the highest average lesion rates were in animals that had been transported in trucks (85.5 %) and minibuses (83.5 %). Abusive handling practices were also documented such as blows with fists and feet, stepping on the animal, as well as blows with wooden sticks, ropes, whips and rocks, among other stressful treatment (Table 1). Restricting vision with a dark band is known to have a calming effect on livestock(22). This agrees with the present results which indicate that animals transported with restricted vision remained calmer during transport and consequently experienced fewer injuries. In contrast to cattle(23), rain did not represent a risk factor for lesions among the evaluated SAC. This may be due to the digital pads of SAC, which allows them to better adhere to surfaces. Pre-slaughter rest time exceeded 24 h in 70 % of the transported animals. This poses a risk for extensive injuries since they can become aggressive when different groups are mixed in the same corral and they begin to establish hierarchies. Some of the recorded lesions could have resulted from fighting during rest time. The present results agree with previous reports(17,24,25) in that the most frequent lesions are Grade 1, followed by Grade 2 and a very few Grade 3. Distribution of pre-slaughter lesions in cattle is dominated by small area (2 to 8 cm diameter), and Grade 1 lesions (subcutaneous tissue) largely on the legs, iliac crest and abdomen. Larger, deeper lesions occur mostly in the loin, shoulder and thorax regions(19). The lesion distribution observed here in SAC differs from the pattern in cattle in that 48% of the lesions were located between the thorax and the abdomen. A number of factors may contribute to this pattern, such as scant adipose tissue coverage, the minimal space provided animals during transport, and inappropriate design of transport vehicles. These factors can facilitate blows and traumas against the surface, walls and floor of the transport space, negatively affecting AW. Another possible factor is the use of ropes tied around the posterior portion of the animal, surrounding the caudal part of the abdomen and cranial region of the rump. Injuries occur when the animals attempt to stand, causing the ropes to scrape them and resulting in extensive surface damage. During transport the animals also bump into each, and hit the walls and/or floor. Inadequate restraints frequently cause unnecessary stress to the animals, as well as injury from the restraining method.

386

Rev Mex Cienc Pecu 2019;10(2):379-390

Guidelines do exist for camelid transport in terms of the proper use of transport method, vehicle size and number of animals to be loaded(26, 27,28). In Peru the SENASA publishes a guide to best livestock practices(29), but it includes no specific mention of SAC. Preferable conditions for SAC transport include sufficient space to keep animals calm during transport, as well as providing food and water during long periods of transport, as recommended by the OIE(26). Only trucks can provide enough space for maintaining SAC well-being and comfort during transport, considering that a load density of 0.55 m² is required for an adult alpaca (40 to 55 kg body weight)(5).

Conclusions and implications

Transport of South American camelids to the Huancavelica municipal slaughterhouse and their handling once there do not promote animal welfare. This was evidenced by evidence of blunt trauma on all the examined carcasses. The most frequent injuries were shallow and located in the thorax and abdomen regions. The absence of conditions promoting animal welfare lowers meat quality, and negatively affects its technological characteristics in storage (reduced preservation time) and processing (economic losses from removal of injured areas and the extra processing time). Consumers of SAC products are increasingly concerned that animal production, transport and slaughter be done under acceptable conditions and managed in a humanitarian manner. This has led to increasing demands for laws and regulations controlling animal welfare, although in Latin America, and especially Peru, any existing regulations are largely ignored. Effective legislation is needed based on research in the area, since animal welfare has both ethical and economic connotations. In addition, scientific research needs to be applied to train SAC producers and processers in proper animal treatment to improve animal welfare and meat quality.

Acknowledgements

The research was financed by the Consejo Nacional de Ciencia, Tecnología e Innovación Tecnológica del Perú (CONCYTEC) and the Ministerio de Ciencia, Tecnología e Innovación Productiva de Argentina (MINCYT), through the Scientific-Technological Cooperation Project “Identificación, a partir de estudios de bienestar animal, embriológicos y reproductivos, de los puntos críticos en la cadena de producción de carne de camélidos sudamericanos domésticos, con impacto en la salud y en el bienestar del poblador altoandino y otros consumidores” (Agreement N° PE/13/01). 387

Rev Mex Cienc Pecu 2019;10(2):379-390

Literature cited: 1. Ministerio de Agricultura y Riego [MINAGRI]. Camélidos sudamericanos. 2015. http://www.minagri.gob.pe/portal/40-sector-agrario/situacion-de-las-actividades-decrianza-y-producci/298-camelidos-sudamericanos?start=1. Consultado 1 May, 2015. 2. Quispe PE, Poma GA, Siguas RO, Berain AJ, Purroy UA. Estudio de la carcasa de alpacas (Vicugna Pacos) en relación al peso y clasificación cárnica. Rev Inv Vet Perú 2012;23(1). 3. Neely K, Taylor C, Prosser O, Hamlyn P. Assessment of cooked alpaca and llama meats from the statistical analysis of data collected using an "electronic nose". Meat Sci 2001;58:53-58. 4. Pérez P, Maino M, Guzman R, Vaquero A, Kobrich C, Pokniak J. Carcass characteristics of llamas (Lama glama) reared in Central Chile. Small Ruminant Res 2000;37:93–97. 5. Organización de las Naciones Unidas para la Agricultura y la Alimentación [FAO]. Manual de prácticas de manejo de alpacas y llamas. 1996;1:3-39. 6. Cristofanelli S, Antonini M, Torres D, Polidori P, Renieri C. Meat and carcass quality from Peruvian llama (Lama glama) and alpaca (Lama pacos). Meat Sci 2003;66:589-593. 7. Hughes B. Behaviour as an index of welfare. Proc Fifth Europ Poultry Conf. Malta. 1976;1005-1018. 8. Broom D. The effects of land transport on animal welfare. Rev Sci Tech Int Epiz 2005; 24 (2): 683-691 http://web.oie.int/boutique/extrait/broom683691.pdf. Consultado 15 Oct, 2015. 9. Arthington J, Eichert S, Kunkle W, Martin F. Effect of transportation and commingling on the acute-phase protein response, growth, and feed intake of newly weaned beef calves. J Anim Sci 2013;81:1120–1125. 10. Ghezzi M, Acerbi R, Ballerio M, Rebagliati J, Díaz M, Bergonzelli P, et al. Evaluación de las prácticas relacionadas con el transporte terrestre de hacienda que causan perjuicios económicos en la cadena de ganados y carnes. IPCVA, Cuadernillo técnico Nº5 2008. http://www.ipcva.com.ar/files/ct5.pdf. Consultado 26 Ene, 2015. 11. Anderson D, Grubb T, Silveira F. The effect of short duration transportation on serum cortisol response in alpacas (Lama pacos). Vet J 1999;157:189-191. 12. Locatelli A, Sartorelli P, Agnes F, Bondiolotti G, Picotti G. Adrenal response in the calf to repeated simulated transport. Br Vet J 1989;145:517.

388

Rev Mex Cienc Pecu 2019;10(2):379-390

13. World Organisation for Animal Health [OIE]. Terrestrial animal health code. Volume I. General provisions. Twentieth ed. World Organization for Animal Health (OIE) publications. 2011: 407 http://www.oie.int/doc/ged/D10905.PDF. Accessed Jan 26, 2017. 14. Arias C, Velapatiño B. Cortisol como indicador fiable del estrés en alpacas y llamas. Rev Invest Vet Perú 2015;26(1). 15. Grandin T. Assessment of stress during handling and transport. J Anim Sci 1997;75:249-257. 16. Immonen K, Ruusunen M, Hissa K, Puolanne E. Bovine muscle glycogen concentration in relation to finishing diet, slaughter and ultimate pH. Meat Sci 2000;55:25-31. 17. Mach N, Bach A, Velarde A, Devant M. Association between animal, transportation, slaughterhouse practices, and meat pH in beef. Meat Sci 2008;78:232–238. 18. Strappini-Asteggiano A. Problemas y errores más comunes encontrados en Chile durante el manejo del ganado. En: Bienestar animal y calidad de la carne. Mota-Rojas D, Guerrero-Legarreta I. México: Editorial BM Editores; 2009; 1-13. http://intranet.uach.cl/dw/canales/repositorio/archivos/28/4123.pdf. Consultado 26 Ene, 2016. 19. Valenzuela LRA. Descripción de las lesiones en canales bovinas utilizando una nueva pauta de evaluación [tesis licenciatura]. Chile: Universidad Austral de Chile; 2010. 20. Smith G, Grandin T, Friend T, Lay Jr., Swanson J. Effect of transport on meat quality and animal welfare of cattle, pigs, sheep, horses, deer, and poultry 2004. http://www.grandin.com/behaviour/effect.of.transport.html. Accessed Jan 26, 2016. 21. Taruman BJ. Frecuencia de presentación y características de las lesiones en canales ovinas y su relación con el transporte [tesis licenciatura]. Chile: Universidad Austral de Chile; 2006. 22. Grandin T. Livestock handling and transport, 2nd ed. CAB International, Wallingford, Oxon, United Kingdom. 2000. 23. Heim HG. Contusiones en canales bovinas: factores que afectan la presentación y cálculo de pérdidas económicas en una planta faenadora [tesis licenciatura]. Chile: Universidad Austral de Chile; 2010. 24. Gallo C, Caro M, Villarroel C, Araya P. Características de los bovinos faenados en la Décima Región (Chile) según las pautas indicadas en las normas oficiales de clasificación y tipificación. Arch Med Vet 1999;1:81-88.

389

Rev Mex Cienc Pecu 2019;10(2):379-390

25. Sandoval M. Estudio de las lesiones presentes en canales de bovinos procedentes de ferias y predios faenados en el frigorífico Temuco 2007 [tesis licenciatura]. Chile: Universidad Católica de Temuco; 2007. 26. Organización Mundial de Sanidad Animal [OIE]. Código Sanitario para los Animales Terrestres. Transporte de animales por vía terrestre. 2015;I Capítulo 7.3. Artículo 7.3.12. http://www.o-ie.int/index.php? id=169&L=2&htmfile=chapitre_aw_land_transpt.htm Consultado 16 Oct, 2016. 27. Australian Government. Australian Animal Welfare Standars and Guidelines. Land transport of livestock code. 2012; 53-57 http://www.upch.edu.pe/evd/pluginfile.php/ 176197/mod resource/content/1/Cita%20Vancouver.pdf. Consultado 15 Oct, 2015. 28. National Animal Welfare Advisory Committee. Transport within New Zeland. Animal Welfare (Transport within New Zealand) Code of Welfare 2011. A code of welfare issued under the Animal Welfare Act 1999. National Animal Welfare Advisory Committee C/- Animal Welfare Standards, New Zealand. 2011. 29. Guía de buenas prácticas ganaderas de Perú. Requisitos generales y recomendaciones para la aplicación de las buenas prácticas ganaderas – BPG. SENASA 2014. http://www.senasa.gob.pe/senasa/wp-content/uploads/2014/12/ Guia-de-buenaspracticas-ganaderas.pdf. Consultado 26 Ene, 2015.

390

https://doi.org/10.22319/rmcp.v10i2.4526 Review

Hydroxycinnamic acids in animal production: pharmacokinetics, pharmacodynamics and growth promoting effects. Review

Edgar Fernando Peña-Torresa Humberto González-Ríosa* Leonel Avendaño-Reyesb Nidia Vanessa Valenzuela-Grijalvaa Araceli Pinelli-Saavedrac Adriana Muhlia-Almazánd Etna Aida Peña-Ramosa

Centro de Investigación en Alimentación y Desarrollo A.C. Laboratorio de Ciencia y Tecnología de la Carne, (CIAD A.C.), Carretera a la Victoria km. 0.6. Hermosillo, Sonora 83304, México. b

Universidad Autónoma de Baja California. Instituto de Ciencias Agrícolas, Baja California, México. c

CIAD A.C. Laboratorio de Nutrición Animal, Hermosillo, Sonora, México.

⃰

CIAD A.C. Laboratorio Bioenergética y Genética Molecular. Hermosillo, Sonora, México.

Corresponding author: hugory@ciad.mx

391

Rev Mex Cienc Pecu 2019;10(2):391-415

Abstract: Use of natural source additives in animal production is increasingly important because they potentially promote growth in ways similar to synthetic compounds, such as anabolic hormones and antibiotics, but without risks to animal or consumer health or degrading meat quality. Encompassing a wide variety of compounds extracted from different plant parts, natural origin additives can be administered as essential oils, mixtures of compounds or isolated compounds to function as medicinal remedies or dietary supplements. Phenolic compounds are widely used and include hydroxycinnamic acids, present in a variety of vegetables, fruits and grains. These acids exhibit interesting bioactivities such as antioxidant, antimicrobial, prevention of cardiovascular diseases and immunomodulation. Use of hydroxycinnamic acids in animal production is currently limited but may hold promise in promoting growth. Before this can occur further research is needed on their pharmacokinetics and pharmacodynamics, posology, exposition period and effects, as well as their possible metabolic routes and biotransformation in animal organisms. This review covers inclusion of hydroxycinnamic acids in livestock diets, their pharmacokinetic properties and pharmacodynamics, and findings on their effects in promoting growth and improving meat quality. Key words: Hydroxycinnamic acids, Ruminants, Monogastrics, Pharmacokinetic, Pharmacodynamic, Growth promoter.

Received: 12/06/2017 Accepted: 26/04/2018

Introduction

Use of synthetic growth promoters in animal production results in better feedlot weight gain, and higher lean meat yields(1). However, they are known to have negative repercussions which can affect some meat quality parameters(2,3), and to pose an intoxication risk due to retention of synthetic compound residues in the organs and meat(4-7). Due to their potential risks use of these compounds has been restricted in the European Union and many Asian countries(4). This constitutes a limiting factor for meat-exporting countries that use this technology which can lead to substantial financial

392

Rev Mex Cienc Pecu 2019;10(2):391-415

losses. The meat industry has responded by searching for safe alternatives for promoting growth in livestock. A promising alternative is the use of natural vegetal-source compounds, better known as phytochemicals (PC). These are non-nutritional secondary metabolites used by plants to protect themselves against microorganisms, pests and herbivores. Classification of PC is complex because it can be based on their properties (e.g. biological function), origin, purity, or chemical structure (e.g. polyphenols, isoprenoids, essential oils and phytoestrogens)(8,9). Phytochemicals can be administered as whole portions of a plant (e.g. roots, leaves, bark), their by-products, or as bioactive compounds in essential oils, isolated compounds or mixtures of compounds(10). After being used for years in humans as alternative medicine and remedies for chronic conditions most PC are classified as generally-recognized-as-safe (GRAS)(7,11). They are beginning to find a role in animal production systems as a way to fight infections and improve animal health status, and thus attain optimal development throughout the growth stages. This may allow the eventual replacement of routinely applied synthetic compounds such as antibiotics, hormones, and Î˛-adrenergic agonists(12). Among the PC are the hydroxycinnamic acids (HA), a group of phenols present in the fruits, roots, grains and seeds of plants. The best known of the PC are caffeic acid, ferulic acid, p-coumaric acid, sinapic acid and chlorogenic acid(13). Used to fight disease and illness in humans, these acids can also be added to animal feed or administered separately to affect physiological changes that can contribute to growth(14). Recent studies report improved growth performance, animal health and meat quality when HA are exogenously supplemented in animal diets(15,16,17). Understanding the mechanism for this action will require research into HA pharmacokinetics (i.e. absorption, distribution, metabolism and excretion), average time of efficacy, bioavailability and pharmacodynamics. In addition, information is needed on the direct relationship between HA and their action sites, biotransformation and physiological modifications, and how they are changed during metabolism(18). The most controversial aspect of HA use, and that of most natural additives, is their posology and the possible routes involved in growth, muscle deposition and nutrient utilization. These are needed before HA can be suggested as possible alternatives to synthetic growth promoters. This review addresses the possible absorption pathways of HA, their biotransformation and the metabolic changes they experience when added to growth diets in animals with the purpose of promoting growth without adversely affecting meat quality.

393

Rev Mex Cienc Pecu 2019;10(2):391-415

Hydroxycinnamic acids: definition, sources and properties

Hydroxycinnamic acids (HA) are derived from cinnamic acid and are common in plants and fruits in the form of organic acids or glycoside esters, or attached to proteins and other cell wall molecules such as cellulose, xylans and lignin(13,19). Plentiful in plants, they are secondary metabolic products known to be used in defense against pathogens and insects(8,20). They are synthesized via the shikimate pathway in which the amino acid phenylalanine is the precursor to HA. Recent research has addressed their potential bioactive effects and benefits in humans and animals when administered as nutritional supplements. Reported bioactive properties include antioxidant, antimicrobial, prevention of chronic diseases such as cancer and atherosclerosis, and growth promotion in animals(21,22,23). The HA can be extracted from plant cell walls by alkaline and enzymatic methods(24,25,26). Their basic structure is a phenylpropanoid, with caffeic acid being the most common in nature(27). The hydroxyl groups present in the aromatic ring of HA makes antioxidant activity their main attribute(22). This activity has been demonstrated in both in vivo and in vitro models aimed at preventing or treating diseases related to oxidative stress, such as cancer, diabetes, cardiovascular disorders and inflammatory diseases(13,28,29,30). There is increasing interest in their antimicrobial capacity since they are known to inactivate or eliminate pathogenic bacteria and can modify the intestinal microflora, possible improving nutrient use and reducing disease incidence by promoting optimal immune system functioning(31,32,33). These capacities highlight their wide range of possible applications in growing animals; initially they could replace synthetic growth promoters but their bioactive properties could provide additional advantages.

394

Rev Mex Cienc Pecu 2019;10(2):391-415

Hydroxycinnamic acids as additives in growing animals

Increasing research is being done on HA supplementation in livestock systems and their potential biological activities. This responds to changing perspectives among meat consumers who now demand healthier products from natural sources with the purpose intent of avoiding any health risks and impacts on meat quality caused by ingestion of synthetic compounds. When used as additives HA can act in diverse ways, including as antibiotics, ionophores, antioxidants, anti-inflammatories, anabolics or flavor enhancers. In most cases they exercise these activities without compromising animal health or meat quality (Figure 1)(34,35). Unlike some synthetic substances, which can only be used for limited periods and/or in a specific growth phase, the HA and other PC compounds are not apparently limited to a specific phase, nor do they cause damage from residual effects(36,37,38).

Figure 1: Principal hydroxycinnamic acids, sources, structure and benefits in animal production

395

Rev Mex Cienc Pecu 2019;10(2):391-415

Hydroxycinnamic acids in growth performance and carcass quality tests

Limited research has been done on inclusion of isolated HA in growth performance tests and there is still insufficient evidence to claim productive benefits in animals(10,39). Ferulic acid (FA) has been tested recently in growing animals in search of a possible growth-promoting effect, but its effects have been contradictory and inconsistent and no action mechanism has been identified. In pigs receiving 100 mg FA/kg feed for 28 d no improvements were observed in productive performance or primary carcass cuts(40). Lambs supplemented with 300 mg FA/d for 34 d exhibited no differences in productive performance versus a control, although carcass rib eye area did improve with FA (control= 16.61 vs FA= 18.0 cm2), possibly an indication of increased muscle tissue deposition(41). In a study in which two FA doses (5 and 10 mg/kg live weight/d) were administered in finishing heifers, daily weight gain was higher in the FA treatments (1.02 and 1.24 kg/d, respectively) than in the control (0.93 kg), and feed conversion improved by up to 20 %. Carcass yield in the FA treatments increased by 1.64% over the control, and rib eye area was greater in the 5 mg FA treatment than in the control (85.61 vs 82.12 cm2)(42). A study in which 15 mg FA/kg feed was supplemented in finishing pigs found dorsal fat thickness to be similar between treatments using the Î˛-agonist ractopamine (9.60 mm) and FA (9.67 mm)(43). This suggests possible activation of hormone-sensitive lipase (responsible for lipolysis) in subcutaneous fat, with much of the resulting energy redirected to other metabolic functions such as muscular deposition. Ferulic acid has also been reported to increase synthesis of endogenous hormones, including prolactin and growth hormones, which may translate into greater muscle deposition(44). However, more research is needed at the cellular level and of blood metabolites to determine if FA acts as an anabolic-type growth promoter. Pure cinnamic acid has not yet been studied in vivo in growing animals. However, in an in vitro study cinnamic acid was found to be recognized in the 3T3-L1 cells of adipocytes, to stimulate the AMPk activation and to improve insulin sensitivity, possible altering the fatty acids profile(45). Cinnamaldehyde is not a HA but is present in sources similar to cinnamic acid; indeed, in animals cinnamic acid can be synthesized from this compound. In one study supplementation with cinnamaldehyde (400 and 800 mg/d) in beef cattle for 28 d improved daily weight gain (2.18 and 2.08 kg [respectively] vs 1.97 kg control), and rib eye area was greater than in the control (89.5 vs 86.3 cm2)(46). The authors suggest that cinnamaldehyde modifies microbial populations and the volatile fatty acids profile, which can improve nutrient digestion, 396

Rev Mex Cienc Pecu 2019;10(2):391-415

reduce methane gas production and thus allow rerouting of this energy to muscle growth. However, high doses of cinnamaldehyde (1,600 mg/d) can decrease ruminal fermentation and thus diminish availability of protein from microbes and feed, compromising animal nutrition(47). In ruminants, HA such as cinnamic acid, p-coumaric acid and ferulic acid may be lost in the ruminal fluid by absorption and utilization by rumen microorganisms, or hydrogenation by specific bacteria, thus limiting growth(48). In contrast, other authors claim that the phenolic monomers in forage can be released and absorbed in the gastrointestinal tract, possibly providing benefits to the animal(49,50). Tests of FA in vitro and in mice have shown it to have possible fat reducing activities caused by an adipocyte dysfunction involving lower growth of preadipocytes to the detriment of fatty acids and cholesterol in the liver and plasma(51,52). Both caffeic acid and chlorogenic acid inhibit enzymes responsible for synthesis of fatty acids such as fatty acid synthase and 3-hydroxy-3-methylglutaryl CoA(53,54). The revised literature suggests that HA supplementation in cattle has a growth promoting effect. However, more research is needed to confirm this promoter activity since some studies report the contrary. For example, in two studies of ruminal culture employing 0.2 % p-coumaric acid and chlorogenic acid, the phenolic monomers in the forage or those added to the diet negatively affected the rumen, acting as antimicrobials in cellulolytic populations, and limiting use of energy from forage structural carbohydrates(50,55). However, the HA in forage lignin exhibit digestibility in different sections of the gastrointestinal tract primarily the rumen, abomasum and ileum suggesting the presence of various interactions, both positive and negative, between HA and the biological processes of digestion and metabolism in ruminants(50). Based on studies of FA in pigs and cattle in which doses and times have been tested, low doses (5 mg/kgLW/d) for periods not greater than 30 d can be suggested for supplementation with HA when seeking a growth promoter effect. That said, each monomer can act, absorb and metabolize in different ways, meaning that it is vital to closely monitor animal health status when supplementing HA for productive purposes.

Changes in meat quality in animals receiving hydroxycinnamic acids as supplements

Oxidation and microbial growth are the principal causes of reductions in meat quality since they diminish its nutritional, sensory, functional and health properties for the consumer. This generates a breakdown in the animal production chain and consequently, significant financial losses for the meat industry(56,57). 397

Rev Mex Cienc Pecu 2019;10(2):391-415

With the aim of improving the quality and stability of meat and meat products the industry has tested both synthetic and natural antioxidants(58,59,60). Using the animalâ&#x20AC;&#x2122;s metabolism, additives are included in the diet to reduce oxidation processes, formation of volatile compounds and microbial deterioration in the meat, while maintaining its nutritional quality and extending its shelf life(31,61). A wide variety of compounds and mixtures are used in animal diets to exert a protective effect on meat; one common example is vitamin E(62,63,64). Although little research has been done on HA in animal diets these compounds are known to have high antioxidant capacity, especially ferulic acid, caffeic acid and p-coumaric acid. They can therefore be seen as possible nutritional supplements aimed at preventing lipid oxidation in meat by inhibiting formation of primary and secondary products (e.g., malondialdehyde MDA)(17,40,65,66). Phytogenic substances are known to improve the quality of pork and beef(67,68); for example, administration of FA administered at 5 or 6 mg/kgLW/d for 30 d in beef cattle diets retarded lipids oxidation(17,69). Values less than 1 mg MDA/kg meat were recorded at up to d 10 of storage under refrigeration and metmyoglobulin formation was lower in the supplemented treatments than in the control, confirming a protective effect against oxidation of polyunsaturated fatty acids and myoglobin protein(17,69). In another study a mixture of FA (100 mg/kg feed) and vitamin E (400 mg/kg feed) were found to have a protective effect when added to diets for finishing pigs, resulting in lower muscle tetrabutylammonium (TBA) values and lower meat hardness than in the control(40). It is important to consider, however, that supplementation of PC for long periods or at high doses can cause a pro-oxidant effect in meat and accelerate fatty acids and protein oxidation. For example, supplementation with FA in beef cattle at 6 mg/kgLW/d for 60 d(17) or 10 mg/kgLW/d for 30 d(69) prior to slaughter, produced more than 2 mg MDA/kg meat beginning on d 3 of storage and formation of up to 30% myoglobin after 7 d of storage. This pro-oxidant effect of FA after long-term or high-dose supplementation may be due to accumulation of high levels of FA in the muscle, providing a stimulus for oxidation onset. High concentrations of antioxidants are known to affect the stability of trace metals, possibly altering myoglobin stability and leading to its oxidation(70,71). During animal growth in commercial livestock systems vitamin E is commonly used during the finishing phase and prior phases to maintain color stability in meat and retard its oxidation during storage(58,60). Hydroxycinnamic acids (HA) can exert a similar benefit as well as a growth promoter effect in animal metabolism and HA deposition in muscle. They can thus provide a double benefit or even be used as an adjunct to vitamin E. This synergistic combination has been tested in pigs in a study in which a mixture of FA (100 mg/kg feed) and vitamin E (400 mg/kg feed) halved MDA content in the Longissimus dorsi muscle and increased rib eye area compared to a control (44.70 vs 37.17 cm2)(40). Clearly, certain combinations of compounds can provide benefits for livestock producers.

398

Rev Mex Cienc Pecu 2019;10(2):391-415

Pharmacokinetics of hydroxycinnamic acids in animal production

Pharmacokinetics research on PC, particularly those on use of HA in growing livestock, are still limited and inconclusive. However, some reports do show that supplementation or intake of these compounds allow them to reach the portal system and thus attain bioavailability in the organism(72-76). Pharmacokinetics refers to the route taken by a drug or compound in an organism, from intake to excretion, including absorption rates in different organs. A substanceâ&#x20AC;&#x2122;s pharmacokinetic will indicate to what degree, if any, it is used by the organism. Whether in a pure form or in combination others, it has been proposed that HA are absorbed to some extent in the stomach and in a greater proportion in the intestine, thus reaching the bloodstream and eventually exerting physiological changes such as reducing oxidation in tissues such as the liver and muscle(23,77). However, absorption rates of these compounds in the gastrointestinal tract and their ability to reach to the bloodstream may vary due to enzymes, microorganisms in the rumen or intestine, stress factors, animal species and biotransformations such as glycosylation or sulfation(72,78). Many HA are quite small, meaning they can cross the gastrointestinal barrier by passive diffusion, mainly in the stomach and small intestine, and go on to be absorbed and deposited in different organs with the help of transporters such as albumin(54). Once absorbed these compounds subsequently change polarity, becoming more hydrophilic, and are excreted in their glycosylated form in the urine(79). Discovering a possible route and the pharmacokinetics of HA in growing animals is complex and most studies have employed murine models to this end(33,80). Absorption varies in response to species, diet, physiology, health status and genetics, among other factors. Understanding which HA are most effective and/or more bioavailable in the organism can be aided by reviewing reports for ruminant and monogastric models.

Hydroxycinnamic acid pharmacokinetics in ruminants

The metabolism and kinetics of PC, including HA, in ruminants is very complex. Several modifications occur mainly in the rumen; indeed, the first action site for HA modification is the rumen. It is here that microbial populations and the anaerobic 399

Rev Mex Cienc Pecu 2019;10(2):391-415

environment cause rapid hydrogenation of phenolic compounds, followed by dehydroxylation and subsequent biotransformation into phenylpropionic acid. This phenylpropionate is then absorbed in the bloodstream for transport to the liver, transformation by Î˛-oxidation and finally excretion in a glycosylated form or as a free acid(81). Some pharmacokinetic studies have addressed the route and modification of ferulic acid, caffeic acid and cinnamic acid in ruminants. Two studies of FA supplemented in sheep and lactating cows found that it was absorbed within the first 5 h postadministration. Sampling was done at shorter intervals in cows and showed that FA may experience rapid absorption since levels increased at baseline and during the first 6 h post-administration but then returned to baseline levels at fourteen hours. It is also possible that a portion of the compound was not modified in the rumen and was subsequently absorbed in low concentrations(72,73). A wide variety of dietary origin phenolic compounds are present in the rumen fluid, with 3-phenylpropionic acid being the most abundant (50 to 80 %), and cinnamic acid being a minor component (7 %)(49,82). The structure of HA in the rumen depends on rumen microorganism profile and HA dose; an approximately 0.4 % HA supplementation level in the diet can impair animal growth and diet utilization(55). Degradation of forage, particularly lignin, can also be compromised by HA release, especially FA, since it limits growth of cellulolytic bacteria. Due to its stronger ester bonds, release of p-coumaric acid occurs at lower levels than FA(50,83). Rumen cellulolytic bacteria are responsible for degrading phenolic compounds through hydrogenation of the HA side chain, which limits their bioavailability. Future research needs to focus on the different microorganism species in the rumen and how they generate significant changes in administered HA. It would also be of interest to quantify changes in microbial populations and volatile fatty acids, which are important in the use of nutrients in ruminants(72,84). Biotransformation of HA in the rumen can be prevented by encapsulating or saponifying the compounds, allowing them to reach target tissues and exert any bioactive effects. Encapsulation involves formation of small lipid particles (i.e. nanoand micro-particles) capable of storing and stabilizing bioactive substances such as salts, amino acids, proteins or PC. The encapsulating substance needs to protect the bioactive substances from interaction with the environment and control their release at a specific site or soft tissue in the organism(85,86). Due to the complexity of the rumen bacterial community and its importance in nutrient use, different studies have focused on encapsulation as a way of directing compounds to target tissues, or of ensuring that a compound is used only by specific bacterial populations through controlled release. For example, substances such as resveratrol, fumaric acid, probiotics, conjugated linoleic acid, and ionophores, among others, have been used to reduce methane emission by changing the rumen bacterial population or stabilizing the intestinal microbiota(86-89).

400

Rev Mex Cienc Pecu 2019;10(2):391-415

Hydroxycinnamic acid pharmacokinetics in monogastrics

In monogastrics phenolic compounds more easily preserve their structure and therefore experience a lower degradation-transformation rate. It is thus more probable that they can exercise some effect, mainly as antioxidants, because their rapid absorption and entrance into the bloodstream can prevent free radical generation by oxidative stress(23,40). Hydroxycinnamic acids have also been reported to be antimicrobial agents in the intestinal microbiota or against pathogenic species, and anti-inflammatory agents that improve nutrient absorption by improving bowel physiology(31). Understanding these activities, however, requires identifying the initial structure of the HA administered and all its subsequent structural changes, which may limit its effects(24,78). In monogastric animals such as pigs, cinnamic acid derives from cinnamaldehyde present in the feed, which later oxidizes into cinnamic acid in the stomach and small intestine. Average estimated life for this compound in this animal ranges from three to 5 h post-administration. Certain HA may already be circulating in the bloodstream, but transporters are needed to convey them to the intended target tissue. Serum albumin is one of the principal metabolite carriers in the organism and has recently been shown to have affinity for chlorogenic acid, ferulic acid and cinnamic acid; this could be of interest for investigating its affinity in organs such as the liver, kidneys, intestine and muscle tissue(54). Studies with caffeic acid and ferulic acid have shown that, much like cinnamic acid (approximately 90 % absorption), these compounds are rapidly absorbed in the stomach and small intestine(25). Caffeic acid is rapidly absorbed within the first two hours postfeeding, but, due to its non-ionized form, can also undergo passive absorption in the stomach(53). After absorption in the organism HA can be found intact in the plasma or urine, but also in conjugated forms such as glucuronide, sulfates or sulfa-glucuronides. However, depending on their interest in these metabolites, intestinal microbial populations can transform HA. Monocarboxylic acid transporters responsible for absorption of some phenolic acids (including HA) may be present in different tissues(24), and could be involved in transport of absorption processes in target tissues such as the liver, fat or muscle.

401

Rev Mex Cienc Pecu 2019;10(2):391-415

Hydroxycinnamic acid bioavailability

When substances such as drugs or dietary compounds are administered to an organism they are subject to a series of mechanisms that alter their structure and reduce compound bioavailability and consequently any possible biological activity. Bioavailability can therefore be defined as the percentage or fraction of a compound available in an intact form that reaches the target tissue, considering any changes this compound may have experienced as it passes through each stage of the digestive process(90). Most phenolic compounds, including HA, have beneficial effects but exhibit very low bioavailability when included in diets. This may be because these compounds are embedded in the polymeric matrices of arabinoxylans, pectins and xyloglucans, limiting their potential action in the organism. In addition, microbial changes produced in the gastrointestinal tract can produce conjugated forms of HA(24, 91,92). Most studies focused on the use of plants and plant extracts in livestock involve a large number of phenolic compounds, including HA. This makes it difficult to determine which of these compounds is responsible for any observed improvement in animal growth, health status or metabolic changes. True in vivo availability is actually limited and possible benefits are attributed to mixtures of compounds and conjugated forms rather than to individual compounds(31,34,36,93); in vitro studies are therefore needed to test isolated HA. Studies in ruminants report that in the ileum FA (4 mg/ml) and p-coumaric acid (9 mg/ml) are released from forage. These levels are notably higher than in the rumen (< 1.0 mg/ml), possibly due to the complexity of the matrix and the enzymes and microorganisms that structurally modify these monomers(50,83). Encapsulation is a promising strategy for improving the probability that HA arrive at target tissues. Some studies using other matrix-immersed compounds have shown that they can exert significant effects on animal metabolism. In one study, dairy cows were administered an encapsulated cinnamaldehyde and gallic acid mixture (300 mg/d) for 15 d, which increased total rumen volatile fatty acids concentration vs the control (108.9 mmol/L vs 98.3 mmol/L) and improved milk production (3 kg/d more than control)(94). The authors attribute this increase largely to modification of rumen microbial populations which raised AGV by reducing methane gas generation, thus allowing more efficient use of the energy in the feed. A different encapsulated mixture of cinnamaldehyde (100 g/t feed) and thymol (150 g/t feed) administered in pigs improved daily weight gain vs a control (0.45 vs 0.37 g/d) and lowered the rate of diarrhea by 50 %(95). This was due to optimal modulation of intestinal microbiota, particularly a reduction in E. coli populations, which improved animal immune system functioning.

402

Rev Mex Cienc Pecu 2019;10(2):391-415

Encapsulation has also been used with other molecules with efficient results. For instance, encapsulating zinc (100 ppm) in a 10 % lipid covering helps to mitigate the symptoms of colibacillosis in weaned pigs(96). Protecting probiotic cultures by encapsulation is known to improve nutrient digestibility and absorption, improve immune system function and prevent infections in both ruminant and monogastric species(97,98,99). Design of HA encapsulation systems is likely to prove a valuable technique in administering these compounds in animals and thus clarifying their route of action and their effects.

Table 1: Pharmacodynamics of hydroxycinnamic acids in fattening animals and in vitro tests Species

Additive

Site of action

Response

Author

Heifers

Ferulic acid (100 mg and 500 mg)

Plasma

Increase in the concentration of prolactin and growth hormone

(44)

Ruminant

0.1%, 0.2% of pcoumaric, ferulic and synaptic acid

Rumen

The cellulolytic population in rumen is not modified; only pcoumaric acid presents a reduction of bacteria responsible for fiber degradation

(55)

Pigs

Ferulic acid (100 mg/kg feed)

Plasma

Increase of antioxidant enzymes GPx11 and NFE2L2ARE2, and reduction of malonaldehyde concentration in blood

(40)

Pigs

Ferulic acid (150 mg/kg)

Ear

Increase in the synthesis of the hemo-oxygenase-1 enzyme and free radicals reduction

(101)

403

Rev Mex Cienc Pecu 2019;10(2):391-415

Pigs

Plant extracts including hydroxycinnamic acids

Plasma

Increase Insulinic Growth Factor-1 (IGF-1)

(102)

In vitro

Cinnamic acid

Adipocytes

Activation of AMPk3, responsible for the activation of lipolytic and lipogenic enzymes in the cell

(45)

GPx1= Glutathione peroxidase-1; 2 NFE2L2-ARE= nuclear factor, erythroid 2 like 2. 3AMPk= AMPactivated protein kinase.

Pharmacodynamic of hydroxycinnamic acids in growing animals

Pharmacodynamics is the study of a compoundâ&#x20AC;&#x2122;s action at specific sites and different levels (e.g. sub-molecular, molecular, cellular, tissue, organ or organism) using in vivo and/or in vitro models, and different techniques and instruments to identify its effective action in the organism(100). Hydroxycinnamic acids employ different mechanisms and cause modifications at various biological levels which can be translated into benefits for the organism such as better growth performance or maintenance of oxidative status. However, what evidence exists for their pharmacodynamics is inconclusive and for many it is non-existent. Very few reports are currently available on HA pharmacodynamics in growing animals aimed at understanding their growth promoter effect. As an additive in diets for cattle FA has exhibited interesting effects in vitro and in vivo, be it in a pure form or as a diet ingredient(14,81,92). In vivo, FA has been reported to affect enzyme and hormone profiles in both ruminants and pigs (Table 1)(44,72,73). One study of FA supplementation in cows found an increase in growth hormone and serum prolactin concentrations, suggesting possible alteration of the pituitary gland and consequently greater muscle protein deposition(44). An evaluation of changes in rumen microbial populations in response to 0.1 % and 0.2 % concentrations of ferulic acid, sinapic acid and p-coumaric acid found ferulic and sinapic acid to have little effect on the cellulolytic bacteria responsible for fiber degradation, indicating these acids did not limit bacterial viability and maintained normal fiber degradation levels(55). However, p-

404

Rev Mex Cienc Pecu 2019;10(2):391-415

coumaric acid exhibited a pronounced ability to traverse the cell wall of cellulolytic bacteria and protozoans, exercising an antimicrobial effect that limited nutrient digestibility and lowered microbial protein concentration. When FA was supplemented in finishing pigs it increased activity of the antioxidant enzymes GPX1 (glutathion peroxidase 1) and NFE2L2 (nuclear factor [erythroidderived 2]-like 2)-ARE, but without significant changes in productive performance and carcass yields(40). A characteristic effect of synthetic Î˛-adrenergic agonist compounds is reduction of dorsal fat deposition. In a recent study(43), FA supplementation in finishing pigs caused a similar effect, reduction of dorsal fat, possibly due to stimulation of hormone-sensitive lipase (not evaluated), which is responsible for fatty acids degradation and redirection of the energy from fat to muscle deposition. A neuroprotective effect has been reported with supplementation of FA in pigs, attributable to its ability to eliminate free radicals and regulate the cytoprotective enzyme heme oxygenase-1 (HO-1) in confined animals subjected to constant noise(101). Overall this literature review highlights the limited extent of research on the pharmacodynamics of HA in growing livestock. Most studies have been done with rats, and much more data is needed on the direct effects of HA in ruminants and monogastric species to better understand their growth promoting mechanisms.

Conclusions and implications

Use of hydroxycinnamic acids in animal diets is not currently common practice. However, they hold promise since their application is known to result in positive changes in animal growth and meat quality. Very little research is yet available on the metabolism of hydroxycinnamic acids when supplemented in animal diets. Future use of these compounds depends on studying these beneficial effects and the metabolic pathways activating or inhibiting them. Additional variables also need study such as toxicity, allergic effects, antioxidants in meat and production costs. Some research has been done on the pharmacokinetics and biotransformation of isolated hydroxycinnamic acids, mainly in rats or in vitro models. Very little information is available on pcoumaric acid, chlorogenic acid and sinapic acid in animal models, and some reports suggest they have negative effects on growth. Growth performance tests in various animal models using low doses of hydroxycinnamic acids such as ferulic acid could help to determine if these effects are general. Overall, more accurate and comprehensive research is needed on the action of hydroxycinnamic acids in the animal production chain. 405

Rev Mex Cienc Pecu 2019;10(2):391-415

Literature cited: 1.

Mersmann HJ. Overview of the effects of beta-adrenergic receptor agonists on animal growth including mechanisms of action. J Anim Sci 1998;76(1):160-172.

Dávila-Ramírez JL, Avendaño-Reyes L, Macías-Cruz U, Torrentera-Olivera NG, Zamorano-García L, Peña-Ramos A, González-Ríos H. Effects of zilpaterol hydrochloride and soybean oil supplementation on physicochemical and sensory characteristics of meat from hair lambs. Small Rumin Res 2013;114(2):253-257.

Avendaño L, Torres V, Meraz F, Pérez C, Figueroa F, Robinson P. Effects of two b-adrenergic agonists on finishing performance, carcass characteristics, and meat quality of feedlot steers. J Anim Sci 2006;84:3259-3265.

Vallejos A, Zaragoza JC, Parres JA. Intoxicación por clembuterol”, Sistema Nacional de Vigilancia Epidemiológica. 2007;18:24.

Smith D. The pharmacokinetics, metabolism, and tissue residues of beta-adrenergic agonists in livestock. J Anim Sci 1998;76(1):173-194.

Pulce C, Lamaison D, Keck G, Bostvironnois C, Nicolas J, Descotes J. Collective human food poisonings by clenbuterol residues in veal liver. Vet Hum Toxicol 1991;33(5):480-481.

Kuiper H, Noordam M, van Dooren-Flipsen M, Schilt R, Roos A. Illegal use of beta-adrenergic agonists: European Community. J Anim Sci 1998;76(1):195-207.

Lopez-Romero JC, Ansorena R, Gonzalez-Aguilar GA, Gonzalez-Rios H, AyalaZavala JF, Siddiqui MW. In: Plant secondary metabolites, Vol 2: Stimulation, extraction, and utilization. Chap 5: Applications of plant secondary metabolites in food systems. 1rst ed. Waretown, NJ, USA: Apple Academic Press; 2016:195-232.

Gottlieb OR. Phytochemicals: differentiation and function. Phytochemistry 1990;29(6):1715-1724.

10. Meskin MS, Bidlack WR, Davies AJ, Omaye ST. Phytochemicals in nutrition and health.1rst ed. Florida, USA: Chemical Rubber Company press; 2002. 11. Alemanno A, Capodieci G. Testing the limits of global food governance: the case of ractopamine. Eur J Risk Regul 2012;(12):400-407.

406

Rev Mex Cienc Pecu 2019;10(2):391-415

12. Patra AK, Saxena J. Dietary phytochemicals as rumen modifiers: a review of the effects on microbial populations. Antonie Leeuwenhoek 2009;96(4):363-375. 13. Chen JH, Ho C-T. Antioxidant activities of caffeic acid and its related hydroxycinnamic acid compounds. J Agric Food Chem 1997;45(7):2374-2378. 14. Scalbert A, Andres-Lacueva C, Arita M, Kroon P, Manach C, Urpi-Sarda M, Wishart D. Databases on food phytochemicals and their health-promoting effects. J Agric Food Chem 2011;59(9):4331-4348. 15. Jiang J, Xiong YL. Natural antioxidants as food and feed additives to promote health benefits and quality of meat products: A review. Meat Sci 2016;120:107117. 16. Waghorn GC, McNabb WC. Consequences of plant phenolic compounds for productivity and health of ruminants. Proc Nutr Soc 2003;62(02):383-392. 17. González-Ríos H, Dávila-Ramírez J, Peña-Ramos E, Valenzuela-Melendres M, Zamorano-García L, Islava-Lagarda T, Valenzuela-Grijalva N. Dietary supplementation of ferulic acid to steers under commercial feedlot feeding conditions improves meat quality and shelf life. Anim Feed Sci Technol 2016;222:111-121. 18. Labarca J. Nuevos conceptos en farmacodinamia: ¿debemos repensar cómo administramos antimicrobianos? Rev Chilena de Infectol 2002;19:S33-S37. 19. Niño-Medina G, Carvajal-Millán E, Lizardi J, Rascon-Chu A, Marquez-Escalante JA, Gardea A, Martinez-Lopez AL, Guerrero V. Maize processing waste water arabinoxylans: Gelling capability and cross-linking content. Food Chem 2009;115(4):1286-1290. 20. Maeda H, Dudareva N. The shikimate pathway and aromatic amino acid biosynthesis in plants. Annu Rev Plant Biol 2012;63:73-105. 21. Kroon PA, Williamson G. Hydroxycinnamates in plants and food: current and future perspectives. J Sci Food Agric 1999;79(3):355-361. 22. Razzaghi-Asl N, Garrido J, Khazraei H, Borges F, Firuzi O. Antioxidant properties of hydroxycinnamic acids: a review of structure-activity relationships. Curr Med Chem 2013;20(36):4436-4450. 23. Windisch W, Schedle K, Plitzner C, Kroismayr A. Use of phytogenic products as feed additives for swine and poultry. J Anim Sci 2008;86(Suppl 14):E140-E148.

407

Rev Mex Cienc Pecu 2019;10(2):391-415

24. Lafay S, Gil-Izquierdo A. Bioavailability of phenolic acids. Phytochem Rev 2008;7(2):301-311. 25. El-Seedi H, El-Said A, Khalifa S, Göransson U, Bohlin L, Borg-Karlson A-K, Verpoorte R. Biosynthesis, natural sources, dietary intake, pharmacokinetic properties, and biological activities of hydroxycinnamic acids. J Agric Food Chem 2012;60(44):10877-10895. 26. Asaff TA, De La Torre MM, Macias OR. Proceso para la recuperación de ácido ferúlico.. 2004. https:// 492 www.google.com/patents/WO2004110975A1?cl=en. Consultado Nov 8, 2016. 27. Crozier A, Jaganath IB, Clifford MN. Phenols, polyphenols and tannins: an overview. 494 Plant secondary metabolites: Occurrence, structure and role in the human diet. Oxford, 495 UK: John Wiley & Sons; 2006. 28. Rocha LD, Monteiro MC, Teodoro AJ. Anticancer properties of hydroxycinnamic acids-A Review. Canc Clin Onc 2012;1(2):109. 29. Cai Y, Luo Q, Sun M, Corke H. Antioxidant activity and phenolic compounds of 112 traditional Chinese medicinal plants associated with anticancer. Life Sci 2004;74(17):2157-2184. 30. Alam MA, Subhan N, Hossain H, Hossain M, Reza HM, Rahman MM, Ullah MO. Hydroxycinnamic acid derivatives: a potential class of natural compounds for the management of lipid metabolism and obesity. Nutr Metab 2016;13(1):27. 31. Valenzuela-Grijalva NV, Pinelli-Saavedra A, Muhlia-Almazan A, DomínguezDíaz D, González-Ríos H. Dietary inclusion effects of phytochemicals as growth promoters in animal production. J Anim Sci Technol 2017;59(1):8. 32. Hong J-C, Steiner T, Aufy A, Lien T-F. Effects of supplemental essential oil on growth performance, lipid metabolites and immunity, intestinal characteristics, microbiota and carcass traits in broilers. Livest Sci 2012;144(3):253-262. 33. Zhao Z, Moghadasian MH. Bioavailability of hydroxycinnamates: a brief review of in vivo and in vitro studies. Phytochem Rev 2010;9(1):133-145. 34. García-González R, López S, Fernández M, González JS. Effects of the addition of some medicinal plants on methane production in a rumen simulating fermenter (RUSITEC). Int Cong Series 2006;1293(0):172-175. 35. Busquet M, Calsamiglia S, Ferret A, Kamel C. Plant extracts affect in vitro rumen microbial fermentation. J Dairy Sci 2006;89(2):761-771. 408

Rev Mex Cienc Pecu 2019;10(2):391-415

36. Hashemi SR, Davoodi H. Herbal plants and their derivatives as growth and health promoters in animal nutrition. Vet Res Commun 2011;35(3):169-180. 37. Sørum H, Sunde M. Resistance to antibiotics in the normal flora of animals. Vet Res 2001;32(3-4):227-241. 38. Aarestrup FM, Jenser LB. Use of antimicrobials in food animal production. In: Simjee S. 528 foodborne diseases. Series Infectious Disease. Human Press Inc. Totowa NJ, USA. 529 2007:405-417. 39. Liu RH. Health benefits of fruit and vegetables are from additive and synergistic combinations of phytochemicals. Am J Clin Nutr 2003;78(3):517S-520S. 40. Li Y, Li L, Li J, Zhang L, Gao F, Zhou G. Effects of dietary supplementation with ferulic acid or vitamin E individually or in combination on meat quality and antioxidant capacity of finishing pigs. Asian-Australas J Anim Sci 2015;28(3):374. 41. Macías-Cruz U, Perard S, Vicente R, Álvarez F, Torrentera-Olivera N, GonzálezRíos H, Soto-Navarro S, Rojo R, Meza-Herrera C, et al. Effects of free ferulic acid on productive performance, blood metabolites, and carcass characteristics of feedlot finishing ewe lambs. J Anim Sci 2014;92(12):5762-5768. 42. Peña-Torres EF. Efecto de la suplementación de ácido ferúlico y ferulato de etilo en el comportamiento productivo y calidad de la carne de bovinos [tesis maestría]. Hermosillo, Sonora, México: Centro de Investigación en Alimentación y Desarrollo; 2014. 43. Herrera RH, Castillo MLA, Torres AJA. Methods to accelerate muscle development, 604 decrease fat deposits, and enhance feeding efficiency in pigs. Methods to accelerate 605 muscle development, decrease fat deposits, and enhance feeding efficiency in pigs. U.S. 606 patent published in February 24, 2011, Num 20110046224. 607 http:/www.faqs.org/patents/app/20110046224; 2009. Accessed Feb 26, 2017. 44. Gorewit R. Pituitary and thyroid hormone responses of heifers after ferulic acid administration. J Dairy Sci 1983;66(3):624-629. 45. Kopp C, Singh SP, Regenhard P, Müller U, Sauerwein H, Mielenz M. Transcinnamic acid increases adiponectin and the phosphorylation of AMP-activated protein kinase through G-protein-coupled receptor signaling in 3T3-L1 adipocytes. Int J Mol Sci 2014;15(2):2906-2915.

409

Rev Mex Cienc Pecu 2019;10(2):391-415

46. Yang W, Ametaj B, Benchaar C, He L, Beauchemin K. Cinnamaldehyde in feedlot cattle diets: Intake, growth performance, carcass characteristics, and blood metabolites. J Anim Sci 2010;88:1082–1092. 47. Cardozo P, Calsamiglia S, Ferret A, Kamel C. Effects of alfalfa extract, anise, capsicum, and a mixture of cinnamaldehyde and eugenol on ruminal fermentation and protein degradation in beef heifers fed a high-concentrate diet. J Anim Sci 2006;84(10):2801-2808. 48. Chesson A, Stewart CS, Wallace RJ. Influence of plant phenolic acids on growth and cellulolytic activity of rumen bacteria. Appl Environ Microbiol 1982;44(3):597-603. 49. Borneman WS, Akin D, VanEseltine W. Effect of phenolic monomers on ruminal bacteria. Appl Environ Microbiol 1986;52(6):1331-1339. 50. Jung H-JG, Fahey GC, Merchen NR. Effects of ruminant digestion and metabolism on phenolic monomers of forages. Br J Nutr 1983;50(3):637-651. 51. Adam A, Crespy V, Levrat-Verny MA, Leenhardt F, Leuillet M, Demigné C, Rémésy C. The bioavailability of ferulic acid is governed primarily by the food matrix rather than its metabolism in intestine and liver in rats. J Nutr 2002;132(7):1962-1968. 52. Zhao Z, Moghadasian MH. Chemistry, natural sources, dietary intake and pharmacokinetic properties of ferulic acid: a review. Food Chem 2008;109(4):691702. 53. Olthof MR, Hollman PC, Katan MB. Chlorogenic acid and caffeic acid are absorbed in humans. J Nutr 2001;131(1):66-71. 54. Li S, Huang K, Zhong M, Guo J, Wang WZ, Zhu R. Comparative studies on the interaction of caffeic acid, chlorogenic acid and ferulic acid with bovine serum albumin. Spectrochim Acta A Mol Biomol Spectrosc 2010;77(3):680-686. 55. Akin DE. Forage cell wall degradation and ρ-coumaric, ferulic, and sinapic acids. Agron J 1982;74(3):424-428. 56. Karre L, Lopez K, Getty KJ. Natural antioxidants in meat and poultry products. Meat Sci 2013;94(2):220-227. 57. Falowo AB, Fayemi PO, Muchenje V. Natural antioxidants against lipid–protein oxidative deterioration in meat and meat products: A review. Food Res Int 2014;64:171-181. 410

Rev Mex Cienc Pecu 2019;10(2):391-415

58. Chan W, Hakkarainen K, Faustman C, Schaefer D, Scheller K, Liu Q. Dietary vitamin E effect on color stability and sensory assessment of spoilage in three beef muscles. Meat Sci 1996;42(4):387-399. 59. Faustman C, Chan W, Schaefer D, Havens A. Beef color update: the role for vitamin E. J Anim Sci 1998;76(4):1019-1026. 60. Morrissey PA, Buckley DJ, Galvin K, Decker E, Faustman C, Lopez-Bote CJ. Antioxidants 636 in muscle foods: nutritional strategies to improve quality. Vitamin E and the oxidative 637 stabilities of pork and poultry. 1rst ed. USA: John Wiley & Sons; 2000:263-287. 61. Cox S, Gupta S, Abu-Ghannam N. Effect of different rehydration temperatures on the moisture, content of phenolic compounds, antioxidant capacity and textural properties of edible Irish brown seaweed. Food Sci Tech 2012;47(2):300-307. 62. Bloomberg BD, Hilton GG, Hanger KG, Richards CJ, Morgan JB, VanOverbeke DL. Effects of vitamin E on color stability and palatability of strip loin steaks from cattle fed distillers grains. J Anim Sci 2011;89(11):3769-3782. 63. Yang A, Lanari M, Brewster M, Tume R. Lipid stability and meat colour of beef from pasture-and grain-fed cattle with or without vitamin E supplement. Meat Sci 2002;60(1):41-50. 64. McDowell L, Williams S, Hidiroglou N, Njeru C, Hill G, Ochoa L, Wilkinson N. Vitamin E supplementation for the ruminant. Anim Feed Sci Technol 1996;60(3):273-296. 65. Brenes A, Viveros A, GoĂąĂ I, Centeno C, Sayago-Ayerdy S, Arija I, Saura-Calixto F. Effect of grape pomace concentrate and vitamin E on digestibility of polyphenols and antioxidant activity in chickens. Poult Sci 2008;87(2):307-316. 66. Cho J, Kim H, Kim I. Effects of phytogenic feed additive on growth performance, digestibility, blood metabolites, intestinal microbiota, meat color and relative organ weight after oral challenge with Clostridium perfringens in broilers. Livest Sci 2014;160:82-88. 67. Biquan Z, Lu C, Lianqiang C. Effects of phytogenic feed additives on growth performance, carcass, meat quality and pork antioxidative capacity in finishing pigs. J China Feed 2011;14:007. 68. Descalzo A, Sancho A. A review of natural antioxidants and their effects on oxidative status, odor and quality of fresh beef produced in Argentina. Meat Sci 2008;79(3):423-436. 411

Rev Mex Cienc Pecu 2019;10(2):391-415

69. Peña E, González-Ríos H, Islava T, Valenzuela-Melendres M, Peña-Ramos A, Zamorano L, Pinelli A, Dávila-Ramírez JL. 0896 Ferulic acid in diets of heifers and its effect on the oxidative stability of meat stored in refrigeration. J Anim Sci 2016;94 (Suppl 5):431-432. 70. Faustman C, Sun Q, Mancini R, Suman SP. Myoglobin and lipid oxidation interactions: Mechanistic bases and control. Meat Sci 2010;86(1):86-94. 71. Jiménez CIE, Martínez EYC, Fonseca JG. Flavonoides y sus acciones antioxidantes. Rev Fac Med UNAM 2009;52(2). 72. Soberon M, Cherney D, Cherney J. Free ferulic acid uptake in ram lambs. J Anim Sci 2012;90(6):1885-1891. 73. Soberon M, Cherney J, Liu R, Ross D, Cherney D. Free ferulic acid uptake in lactating cows. J Dairy Sci 2012;95(11):6563-6570. 74. Marcucci MC, Ferreres F, Garcıa-Viguera C, Bankova V, De Castro S, Dantas A, Valente P, Paulino N. Phenolic compounds from Brazilian propolis with pharmacological activities. J Ethnopharmacol 2001;74(2):105-112. 75. Crozier A, Del Rio D, Clifford MN. Bioavailability of dietary flavonoids and phenolic compounds. Mol Aspects Med 2010;31(6):446-467. 76. Aura AM. Microbial metabolism of dietary phenolic compounds in the colon. Phytochem Rev 2008;7(3):407-429. 77. Schoonmaker J. Novel feed additives for beef cattle. 76th Minnesota Nutrition Conference. Prior Lake, MN; 2015:130-142. 78. Flachowsky G, Lebzien P. Effects of phytogenic substances on rumen fermentation and methane emissions: A proposal for a research process. Anim Feed Sci Technol 2012;176(1–4):70-77. 79. Acamovic T, Brooker J. Biochemistry of plant secondary metabolites and their effects in animals. Proc Nutr Soc 2005;64(03):403-412. 80. Chen Y, Ma Y, Ma W. Pharmacokinetics and bioavailability of cinnamic acid after oral administration of Ramulus Cinnamomi in rats. Eur J Drug Metab Pharmacokinet 2009;34(1):51-56. 81. Chesson A, Provan GJ, Russell WR, Scobbie L, Richardson AJ, Stewart C. Hydroxycinnamic acids in the digestive tract of livestock and humans. J Sci Food and Agric 1999;79(3):373-378. 412

Rev Mex Cienc Pecu 2019;10(2):391-415

82. Martin A. The origin of urinary aromatic compounds excreted by ruminants 2. The metabolism of phenolic cinnamic acids to benzoic acid. Br J Nutr 1982;47(01):155164. 83. Kondo T, Ohshita T, Kyuma T. Comparison of phenolic acids in lignin fractions from forage grasses before and after digestion by sheep. Anim Feed Sci Technol 1994;47(3-4):277-285. 84. Besle J-M, Jouany J-P, Cornu A. Transformations of structural phenylpropanoids during cell wall digestion. FEMS Microbiol Rev 1995;16(1):33-52. 85. Lajoie MS, Cummings KR. Encapsulated dietary fatty acid salt products for ruminants. 566 Encapsulated dietary fatty acid salt products for ruminants. Google Patents; 1999. 567 https://www.google.com/patents/US5874102. Accessed Jun11, 2017. 86. Augustin MA, Sanguansri L, Lockett T. Nano‐and micro‐encapsulated systems for enhancing the delivery of resveratrol. Ann New York Acad Sci 2013;1290(1):107112. 87. Wood T, Wallace R, Rowe A, Price J, Yáñez-Ruiz D, Murray P, Newbold C. Encapsulated fumaric acid as a feed ingredient to decrease ruminal methane emissions. Anim Feed Sci Technol 2009;152(1):62-71. 88. Soto L, Frizzo L, Avataneo E, Zbrun M, Bertozzi E, Sequeira G, Signorini M, Rosmini M. Design of macrocapsules to improve bacterial viability and supplementation with a probiotic for young calves. Anim Feed Sci Technol 2011;165(3):176-183. 89. Chandler TL, Fugate RT, Jendza JA, Troescher A, White HM. Conjugated linoleic acid supplementation during the transition period increased milk production in primiparous and multiparous dairy cows. Anim Feed Sci Technol 2017;224:90103. 90. Gessner D, Ringseis R, Eder K. Potential of plant polyphenols to combat oxidative stress and inflammatory processes in farm animals. J Anim Physiol Anim Nutr 2016;1-24. 91. Turner AL, Shewry PR, Lovegrove A, Spencer JPE. Release of covalently bound 587 hydroxycinnamate, ferulic acid, from whole-grain. Proc Nutr Soc 2015;74: E113.

413

Rev Mex Cienc Pecu 2019;10(2):391-415

92. Kikuzaki H, Hisamoto M, Hirose K, Akiyama K, Taniguchi H. Antioxidant properties of ferulic acid and its related compounds. J Agric Food Chem 2002;50(7):2161-2168. 93. Vasta V, Luciano G. The effects of dietary consumption of plants secondary compounds on small ruminant products quality. Small Rumin Res 2011;101(1):150-159. 94. Blanch M, Carro MD, Ranilla MJ, Viso A, Vázquez-Añón M, Bach A. Influence of a mixture of cinnamaldehyde and garlic oil on rumen fermentation, feeding behavior and performance of lactating dairy cows. Anim Feed Sci Technol 2016;219(Suppl C):313-323. 95. Li SY, Ru YJ, Liu M, Xu B, Péron A, Shi XG. The effect of essential oils on performance, immunity and gut microbial population in weaner pigs. Livest Sci 2012;145(1):119-123. 96. Kwon CH, Lee CY, Han SJ, Kim SJ, Park BC, Jang I, Han JH. Effects of dietary supplementation of lipid‐encapsulated zinc oxide on colibacillosis, growth and intestinal morphology in weaned piglets challenged with enterotoxigenic Escherichia coli. Anim Sci J 2014;85(8):805-813. 97. Zhang L, Li J, Yun TT, Li AK, Qi WT, Liang XX, Wang YW, Liu S. Evaluation of pilot-scale microencapsulation of probiotics and product effect on broilers. J Anim Sci 2015;93(10):4796-4807. 98. Jiao PX, Wei LY, Walker ND, Liu FZ, Chen LY, Beauchemin KA, Yang WZ. Comparison of non-encapsulated and encapsulated active dried yeast on ruminal pH and fermentation, and site and extent of feed digestion in beef heifers fed highgrain diets. Anim Feed Sci Technol 2017;228(Suppl C):13-22. 99. Meng QW, Yan L, Ao X, Zhou TX, Wang JP, Lee JH, Kim IH. Influence of probiotics in different energy and nutrient density diets on growth performance, nutrient digestibility, meat quality, and blood characteristics in growing-finishing pigs. J Anim Sci 2010;88(10):3320-3326. 100. Lees P, Cunningham F, Elliott J. Principles of pharmacodynamics and their applications in veterinary pharmacology. J Vet Pharmacol Ther 2004;27(6):397414. 101. Fetoni AR, Mancuso C, Eramo SLM, Ralli M, Piacentini R, Barone E, Paludetti G, Troiani D. In vivo protective effect of ferulic acid against noise-induced hearing loss in the guinea-pig. Neuroscience 2010;169(4):1575-1588.

414

Rev Mex Cienc Pecu 2019;10(2):391-415

102. Liu G, Wei Y, Wang Z, Wu D, Zhou A, Liu G. Effects of herbal extract supplementation on growth performance and insulin-like growth factor (IGF)-I system in finishing pigs. J Anim Feed Sci 2008;17(4):538-547.

415

https://doi.org/10.22319/rmcp.v10i2.4648 Review

Effects of ultraviolet radiation (UV) in domestic animals. Review

Maricela Olarte Saucedo a* Sergio Hugo Sánchez Rodríguez b Carlos Fernando Aréchiga Flores a Rómulo Bañuelos Valenzuela a María Argelia López Luna c

Universidad Autónoma de Zacatecas. Unidad Académica de Medicina Veterinaria y Zootecnia. Zacatecas, México. b

Universidad Autónoma de Zacatecas. Unidad Académica de Ciencias Biológicas, Zacatecas, México. c

Universidad Autónoma de Zacatecas. Unidad Académica de Ciencias Químicas. Zacatecas, México.

* Corresponding author: olarte61@hotmail.com

Abstract: Solar radiation is necessary for life on Earth. Environmental pollution is contributing to global climate change, in ways such as degrading the atmospheric ozone layer, vital to controlling the type and amount of ultraviolet (UV) radiation reaching the surface. Domestic animals are constantly directly exposed to solar radiation and can consequently develop skin lesions, optical tumors and thermal stress, or even die. UV light produces oxidative stress of the skin due to excessive production of reactive oxygen species (ROS), which can damage cells, causing cell aging or cancer. Antioxidants neutralize these harmful agents, but their activity decreases with organism age and metabolic state. A review was done of the histology and physiology of the skin, and the effects of UV radiation on domestic animals using bibliographic databases (PubMed/MEDLINE, Science) as well as journals available on the Internet. Understanding the effects of UV 416

Rev Mex Cienc Pecu 2019;10(2):416-432

radiation on the health of domestic animals is vital since it can have substantial financial impacts on producers, compromise animal welfare and the quality and safety of animalorigin products. Key words: Ultraviolet radiation, Domestic animals, Skin, Cancer.

Received: 30/09/2017 Accepted: 16/04/2018

Introduction

Solar energy is necessary for all living beings on the planet. Climate change, global warming, gas emissions and the greenhouse effect have modified the atmosphere, which mediates the sunâ&#x20AC;&#x2122;s rays. These modifications have altered the ozone layer(1, 2), leading to more direct entry of ultraviolet (UV) radiation to the Earthâ&#x20AC;&#x2122;s surface. Those environments and animal species which receive direct solar radiation have been changed as a result. Livestock species are particularly vulnerable since excess exposure to solar radiation can cause skin lesions, optic tumors, caloric stress or even death, with substantial consequent financial losses in the industry(3).

Types of radiation

Radiation can be defined as energy that travels from one point to another, as well as any energy that propagates in wave or particle form through space(4). The electromagnetic radiation emitted by the Sun is generally characterized by frequency and wavelength (Figure 1), and can be classified based on two criteria: 1) By its nature: There are electromagnetic radiations(5,6), such as wave-propagated radiations (gamma rays, X-rays); ultraviolet radiations (UVA, UVB, UVC); visible radiation (violet, blue, 417

Rev Mex Cienc Pecu 2019;10(2):416-432

green, yellow, orange, red); infrared radiation; and radio frequencies (radar, microwave). And there are corpuscular radiations such as subatomic particles (Îą particles, Î˛ particles, neutrons, cosmic radiations); these move at high speeds and transport large amounts of energy(4,5,6). 2) By its biological effect: Radiation that carries enough energy to cause ionization in the mediums it crosses is known as ionizing radiation, while radiation that cannot separate electrons from atoms or alter molecular structures is called non-ionizing radiation(7). Photon energy is too weak to break chemical bonds but it has biological effects such as heating and induction of electrical currents in tissues and cells(8). The ionizing or non-ionizing character of a radiation is independent of its corpuscular or electromagnetic nature(9). Ionizing radiations include alpha and beta radiation, cosmic rays, gamma rays, X rays, and a portion of the UV spectrum, among others. Examples of non-ionizing radiations are UV, visible and infrared rays and radio, TV or mobile telephony waves(7,8,9).

Figure 1: Electromagnetic radiation spectrum showing the different wavelengths emitted by the Sun(10)

Structures

Humans

Insects

Grains of Sand

Human cells

Protozoaria

Molecules

Atoms

Atomic

Subatomic

nuclei Radio 10 m

Microwaves 10 cm

Submillimeter Infrared Visible Ultraviolet X-rays s 1 mm 0.3mm 780 nm 380 nm 10 nm 0.01 nm

particles

Gamma rays 0.000001 nm

Wavelength

103

109

1011

1012 1014

1015

1016

10-3

10-2

100

1019

1020

1027

Frequency (Hz)

10-8

10-5

Photon energy

418

105

106

109

1012

Rev Mex Cienc Pecu 2019;10(2):416-432

Ultraviolet (UV) light

Of the entire spectrum of solar radiation only visible light (50 %), infrared (40 %) and part of the ultraviolet spectrum (10 %) reach the planetâ&#x20AC;&#x2122;s surface, with the remaining wavelengths stopped by stratospheric ozone. Ultraviolet solar radiation is defined as the power of UV solar energy per surface unit (UV) and is measured in (w/m2)(11). It has three wavelength spectra: UVA (315-400 nm), UVB (280-315 nm) and UVC (100-280 nm)(4,12,13,14). The latter possesses the highest energy but is absorbed by the atmospheric ozone layer, as long as it remains intact, and thus has no adverse effects on life forms. If the ozone layer were to degenerate even slightly UVC could begin to cause harmful effects. Both the UVA (95 %) and UVB (5 %) spectra do reach the Earthâ&#x20AC;&#x2122;s surface and exposure to them is a known risk factor for development of skin cancer. The UVB is involved in formation of photoproducts and other complexes which impair nucleic acids, with longterm consequences, and are directly related to various skin neoplasms caused by repeated or frequent burns on the epidermis(15). Any cytotoxicity caused by the UVA is mainly mediated by photosensitizing endogenous molecules, which absorb photons and generate reactive oxygen species, generating direct damage to the dermis and premature aging(13,15).

The atmosphere

The atmosphere is composed mostly of nitrogen (78 %) followed by oxygen (21 %)(16,17). The remaining percentage corresponds to myriad trace gases, including miniscule amounts of ozone at a concentration of no more than a few molecules per million air particles (0.01 %). However, ozone is essential to preserving life as we know it on the planet because it protects life forms from UV radiation, an important physical carcinogen in both terrestrial and marine animals(16,17). The ozone molecule consists of three oxygen atoms (O3) and is created mainly in two places within the atmosphere. Most (90+%) occurs in the upper stratosphere, about 50 km above the Earthâ&#x20AC;&#x2122;s surface, and is vital to reflecting damaging radiation back into space(16). The remaining 10 % is generated at surface level (i.e. the troposphere) in large urban areas as a component of smog(16,18).

419

Rev Mex Cienc Pecu 2019;10(2):416-432

Since at least the mid-20th Century human activity has altered the ozone layer’s ecological equilibrium by production and emission of what are known as “ozone depleting substances” (ODS) into the atmosphere(1,19). The best known ODS are chlorofluorocarbons (CFC), which were used in the manufacture of aerosols, refrigerators and air conditioning equipment until banned in 1989. The CFC are extremely reactive; for example, a single chlorine molecule can destroy a thousand ozone molecules(1,19). Formation of ozone molecules is a slow process and as ODS concentrations have increased in the atmosphere overall ozone concentration decreases until a new equilibrium is reached between formation speed and degradation(16,17,19). Solar radiation is one of the main environmental factors affecting life on the planet. It governs the functioning of terrestrial and aquatic ecosystems through control of photobiological processes (e.g. photosynthesis, photoperiod, phototropisms). These in turn influence other environmental factors such as temperature, humidity and natural cycles (daily, annual and hydric cycles) which finally affect organism distribution(19,20). This makes life possible on Earth but can be detrimental to it at high intensities or when the proportion of shortwave radiation surpasses certain limits. High intensity radiation and changes in the spectral composition can affect significant processes in organisms(19,21). The quantity and quality of the radiation that reaches the Earth’s surface depends both on the solar energy emitted and atmospheric characteristics at a given site. A wide range of the electromagnetic spectrum reaches the surface with approximately 40 % being visible light or radiation. These wavelengths range from 400 to 700 nm and are used by plants in photosynthesis. Another range is the photobiological range, from 280 to 1,000 nm(21). Both UVA and UVB penetrate the biosphere but only UVB is absorbed by atmospheric ozone, meaning a decrease in ozone concentrations will allow a greater amount of UVB to reach the surface. Only 1.3 % of the UV radiation emitted by the sun which reaches the earth passes through the atmosphere, of which 98 % is UVA and 2 % is UVB.

Animal skin physiology

In animals the skin covers the organism surface and is in direct contact with the external environment. It consists of three strata that harbor additional structures such as sweat and sebaceous glands(22). Different species have developed supplementary forms of protection (hair, wool, feathers) and/or keratinized tissues (nails, hooves). The skin protects against mechanical, physical and chemical threats from the environment(22,23); for example, skin thickness often increases at points regularly subjected to mechanical compression (e.g. 420

Rev Mex Cienc Pecu 2019;10(2):416-432

hooves, paws, hands and feet)(22). It is also relatively impervious to microorganisms and many poisonous and noxious substances. The skin protects against radiation(23), mainly solar radiation of different wavelengths. For this reason in many animal species its superficial stratum, the epidermis, produces pigments (melanin granules) that impede the penetration of radiations to deeper tissues. An example is the skin of the polar bear which has white (refractory) fur and black (protective) skin as an adaptation to an intense luminous environment subject to direct solar radiation and indirect radiation reflected from ice and snow(24). Sweat and sebaceous glands in the skin reach the surface through glandular ducts, making this an excretory tissue(24). Water excretion (sweat) is a means of thermoregulation unrelated to maintenance of organism hydric equilibrium, but rather controls animal thermal conditions vis-Ă -vis the environment. Cutaneous sebum is a mixture of lipids secreted by the sebaceous glands aimed at protecting the skin from moisture and conferring it pliability and resistance(24). The skin plays an important role in animal growth or somatic body development because it is the primary storage area and activation site of vitamin D(23). Entering the organism as D2 (ergocalciferol) or D3 (cholecalciferol), depending on its source, Vitamin D reaches skin tissues via the blood. Here it is stored as calciferol or a precursor, and is transformed into cholecalciferol by UV rays from the Sun. The cholecalciferol returns to the circulatory system, passes through the liver and finally arrives in the kidneys where the parathormone (PTH) effect transmutes it into the vitamin D hormone (1, 25dihydroxycholecalciferol). This hormone acts in the intestinal mucosa by stimulating facultative absorption of calcium, thus preventing rickets(22).

Skin histology

Total cutaneous area varies by animal species; for example, in adult humans it is estimated to be up to 2 m2. Certain portions of the skin of different animals generate specialized formations such as hair, feathers, nails, horns, or hooves, and the presence of sweat and sebaceous glands can range from numerous, to scarce or absent(25). Skin thickness in a given organism can vary but is generally thicker on body dorsal surfaces and limb lateral surfaces, and thinner on body ventral surfaces and limb medial surfaces. These general trends can differ by species, breed and sex(22). In mammals, the thinnest skin areas average from 0.4 mm in mice to 2.4 mm in Holstein dairy cows (Bos

421

Rev Mex Cienc Pecu 2019;10(2):416-432

taurus), while the thickest areas average from 1.9 mm in the domestic cat to 10.7 mm in male horses(24). The skin is divided into three strata: epidermis, the epithelial or surface stratum; dermis, the connective or deep intermediate stratum; and hypodermis, the subcutaneous cellular tissue (Figure 2)(25,26).

Figure 2: Layers of thick rat skin

Epidermis: consists of keratinized stratified layered epithelium; Dermis: connective tissue; Hypodermis: fatty tissue. Technique: paraffin, hematoxilin-eosine(24).

Epidermis. This consists of keratinized stratified layered epithelium, and is generally divided into five strata: stratum germinativum, stratum spinosum, stratum granulosum, stratum lucidum and stratum corneum(25,26,27). Dermis. This connective layer is divided into two regions, the papillary immediately below the epidermis, and the deeper reticular. Named for the numerous papillae projecting from it into the epidermis, the papillary region consists of a dense weave of irregular lax fibrous connective tissue with trophic functions. Its thickness varies widely between species, being thicker in ungulates than in carnivores(25-28). Hypodermis. This layer is mostly connective tissue that adheres the skin to the bones and muscles. Its primary function is to dampen external pressures and allow free movement of the skin over underlying structures. Adipose tissue is present in this layer, from small groups of cells to large masses in the form of pillows or fat pads. In temperate climes, the hypodermis carries out a thermoregulatory function by increasing in thickness in the winter to retain heat(24,25). Ancillary structures such hooves, nails, horns and spurs

422

Rev Mex Cienc Pecu 2019;10(2):416-432

originate in keratinization processes in the stratum corneum and have different thicknesses and consistencies(24,25). Hair. Hairs are epidermal formations that, in most mammals, are present over the entire skin surface save on specialized skin tissues such as the pads of paws, palms of hands, hooves, fingernails, part of the lips of the mouth, the glans, the inner surface of the foreskin, the vulvar labia, the nipples and the contact surface of the limbs. A hair has a root, a stem and a tip, which protrudes from the skin. Hair roots are surrounded by an invagination of epidermal strata spinosum and germinativum into the dermis that reaches the papillary region and thus accesses the blood vessels therein(25). The cortical and medullary layers of hair occur in different proportions in different species. For instance, the hair lining the skin of horses, bovines, dogs and pigs has a thicker cortical layer than the hair of goats and cats. Also, the fine curly hairs of sheep and pigs, manifest in hedgehogs or porcupines as sharp hairs known as thorns or barbs. Hair is generally very fine in young animals and practically lacks marrow(24,25,28,29,30).

Adaptations of the skin in response to environmental conditions

Evolutionary, morphophysiological adaptation of skin to environmental conditions involves the morphological peculiarities of the skin and its ability to allow thermal adjustments to environmental variables and thus regulate organism temperature(28). An excellent example is variation in skin thickness among and between bovine breeds. Histological studies comparing Zebu cattle (Bos indicus), and Holstein breeds (Bos Taurus) have found that skin thickness is not homogeneous across the body surface in the same areas among animals of the same species but different breeds, and can even vary with age. One study of 21 regions on the skin of Holstein-Friesian cattle (Bos taurus) found that skin thickness as measured by skin fold changed within the same area and that overall thickness increased with age. An analysis of different macro- and microscopic skin structures in Holstein and Zebu cows found the Zebu to be better adapted to high temperatures(28,31). This breed has shorter, thicker hair, greater overall skin thickness with a thinner epidermis and a deeper reticulate dermis, a larger number of sweat glands exhibiting dermal implantation, and consequently a greater excretory surface and glandular density per area(28). In contrast Holstein-Friesian is a dairy breed characterized by thinner skin with a thicker epidermis and finer reticulate dermis. Even the shape of sweat glands differs between the breeds with sweat glands in the Holstein having a tubular shape with varying degrees of torsion and those in the Zebu a more sack-like shape. In the latter breed they are also more concentrated, ensuring more efficient heat dissipation and thus greater tolerance to tropical temperatures(28,32). 423

Rev Mex Cienc Pecu 2019;10(2):416-432

How solar radiation affects animals

Animals exposed to solar radiation for long periods, that live at high altitudes and/or in the tropics tend to lack pigment in the epidermis, have little hair or suffer hair loss and/or are at higher risk of skin diseases(33-36). This occurs because UV rays damage cell DNA(33), which induces the cyclobutane pyrimidine dimers (CPD), pyrimidine (6,4) and pyrimidinone (6,4 PP), which cause negative effects such as inhibition of replication and transcription, increased mutations, halting of the cell cycle and cell death(37). One disease associated with these factors is squamous cell carcinoma (SCC) -also known as epidermoid carcinoma(34)- a malignant tumor affecting keratinocytes in the epidermis(35,36), that is locally invasive but not necessarily metastatic(33), but can compromise the dermis(38). Found mainly in bovine species, these tumors are most frequent in the Hereford, Simmental and Holstein breeds, all of which have white skin without pigmentation, particularly in the eyes(34,35). This condition causes heavy financial losses due to eye cancer, known also as pink eye, which is common in these breeds(39). It is genetic in origin but associated with UV exposure. Older individuals are most affected although younger ones can also develop it, especially those with a white face and little pigment(39). Felids and canids are also at risk(40,41), but it is uncommon in sheep and pigs(33,35,36). The most sensitive horse breeds are Belgian, Clydesdale, Shire and Appaloosa, in which lesions appear largely in muco-cutaneous regions (e.g. conjunctiva, vulva, perineum)(34). Squamous cell carcinoma (SCC) occurs in 20 to 30 % of canids and 70 % of felids with no differences by sex, mostly in large breeds and animals older than 10 yr(42). Lesions in canids occur most frequently on the trunk, limbs, scrotum, lips and nail bed(38), while in felids they are mostly on the face and ears of white-haired individuals(42). Exposure to UV light can also cause melanocytomas, formed in melanocytes in the epidermis, the cells that provide pigmentation to the skin, eyelashes and hairs(43). In bovines, from 80 to 90 % of these tumors are benign, they are located mainly in the skin of the extremities, are not age- or sex-dependent and are more prevalent in dark-colored animals (grey, red and black)(43). Called melanomas in other domestic animals, they are usually malignant, are common in canids and equids, and are rare in cats and other species(41,43,44). In dogs melanomas account for 4.7 % of all neoplasms and more than 7 % of malignant tumors(44,45). They are most common in the mouth (56 %), followed by the lips (23 %), skin (11 %), toes (8 %) and other locations (2 %), including the eyes(46). Cutaneous melanomas are relatively frequent, but only 10 % of malignant melanomas are cutaneous and these are largely found on the head and scrotum. Melanoma incidence in canids also 424

Rev Mex Cienc Pecu 2019;10(2):416-432

varies by breed, being more frequent in those with marked cutaneous pigmentation, such as the Schnauzer or Scottish Terrier(45,46). The Irish Setter and Golden Retriever exhibit a higher incidence of subnail melanomas, and the Irish Setter, Chihuahua, Golden Retriever and Cocker Spaniel have a greater risk of labial melanomas(45,46). The German Shepherd and Boxer have a higher risk of developing oral melanomas(47,48). Age at melanoma appearance ranges from 1 to 17 yr with an average of 10. Incidence is higher in males than females(47). Melanoma is uncommon in cats (<1% of oral neoplasms and about 0.5 % of cutaneous neoplasms)(49,50,51). Ocular and cutaneous melanomas are more common than intraoral ones(52,53). The most common locations on the skin are the head, tail, distal extremities and lumbar area(46,53,54). Prognosis is often poor given that half of cases exhibit recurrence and regional metastases(46,54,55). Affected animals range in age from 2 to 18 yr, with a peak between 8 and 12 yr(54,55). There is no apparent effect of sex or breed on frequency(54,55). Another UV-related ailment is appearance of hemangiosarcomas, malignant tumors most common in middle-aged and elderly dogs, especially large breeds such as the greyhound. It affects mainly the spleen, the right atrium of the heart, the subcutaneous/dermal tissue and the liver(56). Hemangiomas are also related to UV light exposure. These are relatively benign neoplasms in the skin capillaries of the trunk, limbs and soft tissues, but are frequently precursors to hemangiosarcomas(57).

Pathological effects of ultraviolet radiation

UVA radiation can induce erythema, immediate or delayed pigmentation, alterations of the dermal connective tissue, release of vasoactive mediators, and photo-oxidative stress. It can also exacerbate UVB erythema, carcinogenesis and elastosis, causing alterations in DNA and other structures such as elastic fibers(58). Exposure to UVA is responsible for many drug photosensitivity reactions, and plays a significant role in diseases such as polymorphic light eruption, chronic actinic dermatitis, actinic reticuloid, lupus erythematosus, solar urticaria, persistent reaction to light and xeroderma pigmentosum (XP)(59,60). Experimental and clinical evidence have established a close causal relationship between prolonged exposure to UV light and skin cancer, primarily malignant melanoma (MM), squamous cell carcinoma (SCC) and basal cell carcinoma (BCC)(59,60). Photosensitivity in animals is classified into three main types. Type I or primary photosensitivity is caused by fluorescent compounds deposited undisturbed on the skin after ingestion since a normal liver is unable to process and excrete the original fluorescent compound. Photosensitizing compounds include hypericin, fagopyrin and 425

Rev Mex Cienc Pecu 2019;10(2):416-432

chemical products such as phenothiazine (sulfoxide phenothiazine). Type II photosensitivity, also known as abnormal synthesis of endogenous pigment or congenital porphyria is caused by accumulation of endogenous pigments from abnormal porphyrin metabolism. Photodynamic agents include uroporphyrin I, coproporphyrin I, and protoporphyrin III. These accumulate in the blood and tissues in response to dysfunction in heme group biosynthesis due to an enzymatic deficiency. For example, congenital protoporphyria in bovines is caused by a deficiency in uroporphyrinogen III cosynthetase, a key enzyme in heme group biosynthesis. Type III or hepatotoxic photosensitivity is more common and can have financial impacts. Animals become sensitized due to accumulation of phylloerythryn, a product of chlorophyll digestion in the peripheral circulatory system. Phylloerythryn is usually excreted in bile by the liver, but in certain types of diffuse lesions, the liver is associated with a variety of vegetable, fungal, and chemical hepatotoxins that are gradually absorbed by the circulatory system until attaining levels that generate photosensitivity. This toxic matter acts directly on the cells of the liver and small bile ducts, causing them to inflame and preventing passage of bile, causing jaundice or yellow coloring(61).

Beneficial effects of ultraviolet radiation

One of the principal benefits of solar radiation is that it allows some homeothermic animals to maintain proper internal body temperature for metabolism(62). Another wellknown benefit, particularly of UVB, is enabling vitamin D metabolism, indeed, insufficient exposure can lead to vitamin D deficiency(62). This can have immediate effects on the skeletal system by increasing the risk of fractures since vitamin D3 is produced daily to control absorption, transport and deposit of calcium (and to a lesser extent phosphorus), a vital function in bone maintenance and growth regulation. Vitamin D is also necessary for hormonal functioning, organ development and embryogenesis(62). Ultraviolet B radiation is important for animal health because it is required for the photochemical processes involved in vitamin D synthesis(62). In other words, even if animals receive an adequate diet and are in an optimum temperature, they will be unable to correctly incorporate many nutrients if not provided with the radiation needed for vitamin D production(62). Irradiation is vital to food safety in that it contributes to preservation by preventing food from degrading and spoiling, and the appearance of undesired conditions such as emergence of tubers. It can also destroy some insects, fungi and bacteria(63).

426

Rev Mex Cienc Pecu 2019;10(2):416-432

Conclusions

Domestic animals are almost constantly exposed to ultraviolet radiation but changes in climate may increase UVB radiation exposure with possible negative health consequences. Sensitivity to exposure varies between species and even between breeds within the same species. Many may develop cutaneous pathologies, including skin cancer, which cause significant financial losses in the agricultural sector, undermine animal health and well-being, and compromise the quality and safety of animal products intended for human consumption.

Literature cited: 1. Toca TC. Impacto ambiental empresarial y fallas de la acción pública: una realidad de las localidades bogotanas. Argos 2011;28:244-269. 2. Albanil E, Ramírez R, Jiménez B. Reporte del Clima en México http://smn. cna.gob.mx/climatologia/analisis/reporte/Anual2014.pdf, Consultado 26 de Feb, 2015. 3. Alonso S, Ramírez N, Taylor PJ. El cambio climático y su impacto en la producción de alimentos de origen animal. http: //www.veterinaria.org/revistas/redvet/ n111112.html, Consultado 29 de May, 2015. 4. Ferramola SA, Sancovich HA. Interacciones de las radiaciones electromagnéticas y especies reactivas del oxígeno sobre la piel. Rev Argent Dermatol 2006;87:113-120. 5. Rivas AM, Rojas EE, Cortés NJ, Santander GE. Efecto de la altura en la radiación solar ultravioleta en Arica Norte de Chile. Revista Facultad de Ingeniería, U.T.A. 2002;10:59-62. 6. Bohórquez BJ, Pérez JF. Radiación ultravioleta. Ciencia & Tecnología para la salud visual y ocular. Rev Lasalle 2007;9:97-104. 7. Navas G, Jairo T, Rodrigo C. Non-Ionizing Radiation Detection. Dyna 2009;76:7181. 8. Guerreo AJ, Peréz AJ. Las radiaciones no ionizantes y su efecto sobre la salud humana. Rev Cubana Med Milit 2006;35:3-11. 427

Rev Mex Cienc Pecu 2019;10(2):416-432

9. Pérez A, Miranda LR. Radiaciones electromagnéticas y salud en la investigación médica. Rev Cubana Med Militar 2010;39:35-43. 10. Mignone C, Barnes R. More than meets the eye: the exotic, high-energy Universe. Sci in School 2012;24:53-58. 11. Rivas A, Rojas E, Madronich S. Aumento del índice solar ultravioleta con la altura. Rev Chilena Ing 2008;16:383-388. 12. Gonzáles PM, Vernhes TM, Sánchez LA. La radiación ultravioleta. Su efecto dañino y consecuencias para la salud humana. Theoria 2009;18:69-80. 13. Vallejo EO, Vargas N, Martínez LM, Agudelo CA, Ortiz IC. Perspectiva genética de los rayos UV y las nuevas alternativas de protección solar. http://www.scielo. org.ar/scielo.php?script=sci_arttext&pid=S1851300X2013000300002Rev, Consultado 17 Sep, 2015. 14. Luigi PG, Rightler AL, Heronc M, Gabbuttc CD. Extending human perception of electromagneticradiation to the UV region through biologically inspired photochromic fuzzy logic (BIPFUL) systems. Chem Commun 2016;52:1474-1477. 15. Byrne SN, Hammond KJ, Chan CY, Rogers LJ, Beaugie C, Rana S, MarshWakefield F, Thurman JM, Halliday GM. The alternative complement component factor B regulates UV-induced oedema, systemic suppression of contact and delayed hypersensitivity, and mast cell infiltration into the skin. Photochem Photobiol Sci 2015;14:801-806. 16. Sánchez C. Consideraciones sobre la capa de ozono y su relación con el cáncer de piel. Rev Méd Chile 2006;134:1185-1190. 17. Erickson DJ, Sulzberger B, Zeppc RG, Austind AT. Eﬀects of stratospheric ozone depletion, solar UV radiation, and climate change on biogeochemical cycling: interactions and feedbacks. Photochem Photobiol 2015;14:127-148. 18. Environment Canada. The UV Index and Ozone http://www.ec.gc.ca/uv/ Default.asp?lang=En&n=C74058DD, Accessed Feb 16, 2015. 19. Bornman JF, Barnes PW, Robinson SA, Ballaré CL, Flinte SD, Caldwell MM. Solar ultraviolet radiation and ozone depletion driven climate change: eﬀects on terrestrial ecosystems. Photochem Photobiol 2015;14:88-10. 20. Baiz AF, McKenzie RL, Bernhard G, Aucamp PJ, Ilyas M, Madronich S, Tourpali K. Ozone depletion and climate change: impacts on UV radiation Photochem Photobiol. Sci 2015;14:19-52. 21. Carrasco RL. Efecto de la radiación ultravioleta–B en plantas. IDESIA Chile 2009;3:59-76. 428

Rev Mex Cienc Pecu 2019;10(2):416-432

22. Castellanos I, Clarena G, Rodríguez T, Iregui G. Estructura histológica normal de la piel del perro. Rev Med Vet 2005;10:104-122. 23. Vega PC. Manual de Histología Esquemática. 1ra ed. La Habana, Cuba: Editorial Pueblo y Educación; 1980. 24. Dellmann HDB. Histología veterinaria. 2a ed. España: Editorial Acribia, Zaragoza; 1994. 25. Megías M, Molist P, Pombal MA. Atlas de histología vegetal y animal. Órganos animales tegumento, https://mmegias.webs.uvigo.es/descargas/o-ategumento.pdf, Consultado 24 Feb, 2016. 26. Paniagua R, Nistal M, Sesma P, Álvarez U, Fraile M, Anadón B, Sáez RFS, De Miguel MP. Citología e histología vegetal y animal. 2a ed. España: Editorial McGrawHill-Interamericana de España; 1997. 27. Ross MH, Pawlina W. Histología Texto y Atlas. 7ª ed. Barcelona, España: Editorial Wolters Kluwer; 2016. 28. Esquivel VC. La raza, el pelo y la piel en función del bienestar animal. Mundo Pecuario 2012;1:73-85. 29. Suro RJ, Gutiérrez FL, Ruiz AJ, Bouhann P. El pelo. Generalidades y funciones. Dermatología CMQ 2007;4:218-223. 30. William J. Applied Veterinary. 2a ed. USA: Editorial Mosby; 1993. 31. Kamwanja LA, Chase CC, Gutierrez JA, Guerriero V, Olson TA, StatusHammond AC, Hansen PJ. Responses of bovine lymphocytes to heat shock as modified by breed and antioxidan. J Anim Sci 1994;72:438-444. 32. Pérez EH. Fisiología Animal II. http://cenida.una.edu.ni/relectronicos/RENL 50P438.pdf. Consultado 28 Sep, 2016. 33. Rosolem MC, Moroz LR, Rodigheri SM. Carcinoma de células escamosas. Pubvet 2012;6:6-14. 34. Ramos AT, Mollerke ND, Elias FM, Gevehr FC. Carcinoma de células escamosas em bovinos, ovinos e eqüinos: estudo de 50 casos no sul do Rio Grande do Sul. Braz Vet Res Anim Sci 2007;44:5-13. 35. Fabricio KL, Dantas AF, Riet CF, De Miranda NE, Simões SV, Azevedo SS. Fatores de risco associados à ocorrência de carcinoma de células escamosas em ruminantes e equinos no semiárido da Paraíba. Pesq Vet Bras 2012;32:881-886.

429

Rev Mex Cienc Pecu 2019;10(2):416-432

36. Targino J, Almeida S, Macedo E, Almeida BE, Santana de OR, Anjos FE, Ocampos PPM. Squamous cell carcinoma in the frontal region of the head in a goat. Acta Scient Vet 2013 41:4-8. 37. Tafurt Y, Marin MA. Principales mecanismos de reparación de daños en la molécula de ADN. Rev Biosalud 2014;132: 95-110. 38. Costa C, Ramos VD, Huppes R, Bardoza DA, Gaspar RA, Rivera CL, Ramirez UR. Cryosurgery in the treatment of squamous cell carcinoma in dog. Rev Colomb Cienc Anim 2013;5:213-221. 39. Heather ST. Combata el cáncer de ojo. Hereford, Bs.As. 1999;(64):38-40. 40. Olinda RG, Frade MT, Soares GS, Aguiar GM, De Costa VM, Lucena RB, De Dantas AF. Bovine demodicosis associated with squamous cell carcinoma of the vulva. Acta Scient Vet 2013;41:29-32. 41. Mukaratirwaa S, Chipunzaa J, Chitangaa S, Chimonyoa M, Bhebhea E. Canine cutaneous neoplasms: prevalence and influence of age, sex and site on the presence and potential malignancy of cutaneous neoplasms in dogs from Zimbabwe. J S Afr Vet Ass 2005;76:59–62. 42. Revista de la Asociación Madrileña de Veterinarios de Animales de Compañía. https://es.scribd.com/document/26893256/Revista-de-La-Asociacion-Madrilena-deVeterinarios, Consultada 14 Ene, 2010. 43. Chávez VC, Astaiza MJ, Benavides MC, Vallejo TD. Tumor maligno derivado de melanocitos en piel de un bovino de presentación inusual: estudio de caso. Rev Med Vet 2015;29:63-72. 44. Iakatos I, Mirela E, Cadar, Ali B. Cutaneous tumors’ incidence in dog. Lucrări Stiinłifice Medicină Veterinară 2009;13:475-381. 45. Silva HG, Juárez BF, López VM, Dávila PM. Squamous cell carcinoma in dogs from Culiacan, Sinaloa, Mexico Retrospective Rev (2006-2014). Rev Cient, FCV-LUZ 2015;25:573-584. 46. Goldschmidt MH, Shofer FS. Skin tumors of the dog and cat. Oxford, UK: Butterworth Heinemann; 1992;2:142-151. 47. Todoroff RJ, Brodey RS. Oral and pharyngeal neoplasia in the dog: a retrospective survey of 361 cases. J Am Vet Med Assoc 1979;175:567-571. 48. Oakes MG, Lewis DD, Hedlund CS, Hosgood G. Canine oral neoplasia. Contin Educ Pract Vet Comp 1993;15:15-30.

430

Rev Mex Cienc Pecu 2019;10(2):416-432

49. Patnaik AK, Mooney S. Feline melanoma: a comparative study of ocular, oral and dermal neoplasms. Vet Pathol 1988;25:105-112. 50. Stebbins KE, Morse CC, Goldschmidt MH. Feline oral neoplasia: a ten-year survey. Vet Pathol 1989;26:121-128. 51. Miller WH, Scott DW, Anderson WI. Feline cutaneous melanocytic neoplasms: a retrospective analysis of 43 cases (1979-1991). Vet Dermatol 1993;4:19-26. 52. Engle CG, Brodey RS. A retrospective study of 395 feline neoplasms. J AM Anim Hosp Assoc 1969;5:21-31. 53. Day MJ, Lucke VM. Melanocytic neoplasia in the cat. J Small Anim Pract 1995;36:207-213. 54. Van Der- Linde SJS, De- Wit MML, Van- Garderen E, Molenbeek RF, Van DerVelde ZD, De- Weger RA. Cutaneous malignant melanomas in 57 cats: identification of (amelanotic) signet-ring and balloon cell types and verification of their origin by immunohistochemistry, electron microscopy, and in situ hybridization. Vet Pathol 1997;34:31-38. 55. Luna LD, Higginbottham ML, Henry CJ, Turnquist SE. Feline non-ocular melanoma: a retrospective study of 23 cases (1991-1999). J Feline Med Surg 2000; 2:173181. 56. Weinborn AR, Issotta CC, Agurto MM, Lara LJ. Descripción clínica de hemangiosarcoma (HSA) cutáneo metastásico en un canino galgo: estudio clínico de un caso. Rev Med Vet 2015;2:107-116. 57. Aita N. Hemangioma of the ileum in a dog. J Vet Med Sci 2010;72:1071-1073. 58. López CC, Aréchiga OE, López CM. Protein kinases and transcription factors activation in response to UV-radiation of skin: Implications for carcinogenesis. Int J Mol Cienc 2012;13:142-172. 59. Duro ME, Campillos P, Causín S. El sol y los filtros solares. Medifam 2003;13: 159165. 60. Alvarez FE. Consecuencias del estrés oxidativo de la piel por radiaciones ultravioleta.http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S0864030019950001 00004, Consultado 10 Nov, 2016. 61. Cruz CF. Fotosensibilización. http://www.ammveb.net/clinica/fotosensibilizacion. pdf, Consultado 20 Oct, 2016.

431

Rev Mex Cienc Pecu 2019;10(2):416-432

62. Fernández L, Poletta GL, Imhof A, Siroski PA. Efectos de la radiación ultravioleta natural y artificial (UVA/ UVB) sobre la concentración plasmática de calcio y fósforo y el crecimiento en crías de Caiman latirostris. InVet 2013;15:75-82. 63. Ross LI, Watson D, Escandarani S, Miranda A, Troncoso A. La radiación a la mesa. Rev Chilena Infect 2009;26:318-330.

432

https://doi.org/10.22319/rmcp.v10i2.4652 Review

Oxidative stress and antioxidant use during in vitro mammal embryo production. Review

Viviana Torres-Osorio a* Rodrigo Urrego b José Julián Echeverri-Zuluaga a Albeiro López-Herrera a

Universidad Nacional de Colombia, Grupo de Investigación BIOGEM. Medellín, Colombia. b

Universidad CES, Facultad de Medicina Veterinaria y Zootecnia, Grupo INCA-CES. Medellín, Colombia.

*Corresponding author: vtorres@unal.edu.co

Abstract: Of the many animal reproduction biotechnologies, in vitro embryo production has developed most over the past twenty years. Procedure success depends on many factors, including the presence of reactive oxygen species in adequate proportions. Both in vitro fertilization and gamete and embryo manipulation exposes cells to endogenous and/or exogenous factors that can affect antioxidant defense mechanisms and quality. This review discusses some sources of reactive oxygen species, the use of enzymatic, nonenzymatic and polyphenolic antioxidants to reduce oxidative stress in in vitro embryo production processes, and their effects on oocyte and embryo quality, gene expression and embryo developmental competence. Key words: Antioxidants, Reactive oxygen species, Oxidative stress, In vitro culture, Embryo development.

433

Rev Mex Cienc Pecu 2019;10(2):433-459

Received: 03/10/2017 Accepted: 29/05/2018

Introduction

In vitro embryo production (IVEP) involves three steps: 1) in vitro maturation (IVM) of oocytes obtained from antral follicles; 2) coincubation of male and female gametes, or in vitro fertilization (IVF); and 3) in vitro culture (IVC) of the presumed zygotes to blastocyst stages. Under normal physiological conditions mammal oocytes grow and are fertilized in the ideal protective environment, the ovary and the female reproductive tract. Under in vitro conditions, however, the gametes and embryos must be manipulated during maturation, fertilization and embryo development in environments that generate oxidative stress. The conditions causing this stress include high oxygen concentration (20 %) compared to the in vivo environment (3 to 5%)(1); exposure to light(2); culture medium composition(3); changes in pH(4); centrifugation processes(5); and many others(6). These can negatively affect both gametes and embryos, altering the functionality of biomolecules such as lipids, nucleic acids and proteins, and thus influencing embryo development(7). Cells have an enzymatic and non-enzymatic antioxidant defense system, but antioxidant molecules have been used to supplement culture media and thus decrease reactive oxygen species (ROS) production in gametes and embryos. This improves their quality and reproductive potential by reducing intracellular ROS(8), and protects against damage to DNA and other biomolecules, raising embryo developmental competence(9-11). The present review is aimed at analyzing the effect of oxidative stress and antioxidant use in in vitro production of embryos on gamete and embryo quality at the metabolic level, as well as gene expression and epigenetic marks.

434

Rev Mex Cienc Pecu 2019;10(2):433-459

Reactive oxygen species and oxidative stress

Reactive oxygen species (ROS) constitute a group of molecules generated through partial reduction of molecular oxygen. Most of these species (except hydrogen peroxide) have one or more unpaired electrons, a configuration called a free radical. Under basal conditions, aerobic metabolism is linked to production of ROS such as hydrogen peroxide (H2O2), the superoxide anion (O2-) and the hydroxyl radical (OH-), while reactive nitrogen species (RNS) such as nitric oxide (NO•) form through conversion of L-arginine to L-citrulline by the enzyme nitric oxide synthase (NOS). Oxidative stress occurs when ROS production exceeds cellular defenses(12), generating oxidative damage to biomolecules such as lipids, proteins, carbohydrates and nucleic acids, and consequently inducing structural and functional changes such as lipid hydroperoxides(13), carbonylated proteins(14) and DNA with oxidized bases (7, 8 dihydro-8-oxoguanine)(15). The mitochondrial respiratory chain is susceptible to oxidative damage (mainly to complexes I and II), by production of superoxide and nitrile radicals. These can affect mitochondrial proteins and alter the function of many metabolic enzymes in the mitochondrial electron transporter chain(16). Mitochondrial DNA (mtDNA) is also known to be more sensitive to oxidative stress than nuclear DNA(17). Possible reasons are that it lacks histones, which protect against damage from free radicals, does not have a suitable repair system, and is located near the internal mitochondrial membrane, the largest ROS production site(18,19). Oxidative damage to the mtDNA can induce mutations and alter mitochondrial function and integrity(20). In humans this can manifest in degenerative mitochondrial diseases such as Alzheimer’s disease, Parkinson’s disease and amyotrophic lateral sclerosis(21,22).

ROS production during in vitro embryo production

Some cellular processes in the reproductive tract are regulated by ROS, which act as second messengers generating a specific cellular response. Macromolecules sensitive to redox modifications (phosphatases, kinases, transcription factors) are important during cell development stages such as proliferation, differentiation and cell death. In the latter, different ROS levels generate different types of cell death; for example, low concentrations promote apoptosis, intermediate concentrations generate (12,23) autophagocytosis and high concentrations promote cell necrosis . During IVM,

435

Rev Mex Cienc Pecu 2019;10(2):433-459

physiological levels of ROS are needed to reinitiate meiosis of the oocytes arrested in diplotene, and to stimulate release of intracellular CA2+ in the oocyte and the protein kinase activated by mitogen (MAPK)(24,25). Physiological levels of ROS are also required for the training, hyperactivation and acrosomal reaction of mammalian sperm(26). During sperm training, ROS such as the anion peroxynitrate, H2O2 and NOâ&#x20AC;˘ have a dose-dependent effect on sperm function. Low ROS concentrations are required to promote cholesterol flow, AMPc production, hyperactivation and oocyte-sperm fusion(27,28). In contrast, excess ROS may affect sperm functionality because the spermatozoa cell membrane is rich in polyunsaturated fatty acids, making it susceptible to lipid peroxidation. It can also negatively affect mitochondrial function in the sperm-zona pellucida interaction by reducing sperm motility, and compromising sperm DNA and therefore male fertility(29-31). Use of antioxidant molecules is thus vital to protecting cells from high ROS levels and their negative effects. Simulation of in vivo conditions in assisted reproduction techniques has improved immensely although two main factors continue to contribute to in vitro ROS generation and accumulation: absence of endogenous defense mechanisms and gamete and embryo exposure to environments which generate ROS. There are two main ROS sources (Figure 1). Endogenous ROS are accumulated by oocytes, sperm and embryos via various metabolic pathways and enzymes, mainly oxidative phosphorylation, NADPH oxidase and xanthine oxidase(32). Exogenous ROS sources include environmental factors such as cryopreservation, oxygen concentration, energy source, culture medium, and light(6,33). Oxygen is a vital component of oviduct and uterine environments and is involved in embryo development regulation, specifically through metabolism regulation. Oxygen tension found in the oviduct and uterus ranges from 5 to 8.7% in several species(34). Levels used in oocyte maturation and cultivation with good results span from 5 to 20 %(35,36). However, the trend is to use 20% O2 during oocyte maturation because the energy production route at low O2 concentrations (5 %) reduces the proportion of oocytes in IVM, which affects oocyte developmental competence(1). In contrast, 5 % O2 during cultivation favors embryonic developmental competence, cellularity and gene expression related to oxidative stress(37). However, exposure to high O2 concentrations (20 % in air) has been reported to intensify ROS level increases and thus reduce embryonic development percentages in rodents(38), swine(39,40), goats(41), bovines(42) and humans(43). This in turn can cause arrested development, DNA damage, apoptosis and lipid peroxidation, which undermine embryo competence(44). Studies evaluating the relative abundance of mRNA in oocytes have found a pattern of better quality when oocytes are matured at low O2 concentrations (5 %)(45,46). Incorrect atmospheric oxygen concentrations can clearly have detrimental effects in mammalian embryo cultivation. Depending on composition and supplements, culture media can contribute to ROS production in IVEP systems(3,47). Culture media contain metal ions, such as Fe2+ and Cu2+, which are inducers of ROS formation through Fenton and Haber-Weiss reactions; iron

436

Rev Mex Cienc Pecu 2019;10(2):433-459

can also act on lipids by generating lipid peroxidation initiated by free hydroxyl radicals(48). Supplementation with biological fluids such as fetal bovine serum (FBS) may increase ROS levels more than other supplements such as bovine serum albumin (BSA). Presence of the enzyme amino oxidase in serum(49), which participates in oxidation of primary amines, generates hydrogen peroxide as a secondary product(50), which could explain the effect of serum amino oxidase concentration on apoptosis percentage(51), cryotolerance and the gene expression pattern in bovine embryos produced in vitro(52). However, this protein supplement improves bovine embryo production rate and quality(53). Maintaining developmental competence in bovine oocytes during in vitro maturation requires control of medium glucose content. High glucose concentrations in the maturation medium raise ROS levels and lower intracellular glutathione (GSH) content in bovine oocytes. This inhibits the enzymes responsible for GSH synthesis, negatively affecting oocyte capacity to reduce ROS(54,55), which, in early embryonic development, can lead to lipid peroxidation of the cell membrane, DNA fragmentation and improper protein synthesis(32,56). Visible light also induces ROS production by generating base oxidation, breaking down DNA chains, and causing oxidative damage in other biomolecules(2). Sperm motility and hyperactivation are affected by excess ROS production caused by exposure to visible light(57). Excess ROS production has also been reported in vitro in embryos transiently exposed to visible light. White fluorescent light, the most common type used in laboratories, was found to generate the most ROS in mouse and hamster zygotes, as reflected in the blastocyst apoptosis index, although use of filters helped to diminish these effects(58). A study assessing the effects of daylight and laboratory light and different exposure times in culture media and porcine embryos found both types of light to reduce embryo quality and parthenogenetic blastocyst percentages(59). This suggests that culture media and embryos need protection from light during in vitro production processes. Centrifuging is a necessary step in semen preparation and training protocols for IVF. However, centrifuge time and force contribute to raising ROS levels, causing oxidative damage and affecting sperm function(5,60). Centrifuging sexed and unsexed sperm for long periods (45 min) at 700 x g caused loss of plasma membrane integrity and DNA fragmentation(61,62). This suggests that the sperm plasma membrane experiences a lipid peroxidation process in response to high ROS levels, thus reducing membrane fluidity and functionality for fertilization. For this reason different sperm preparation techniques have been developed (e.g. swim-up and density gradients) to obtain spermatozoa with higher motility and DNA integrity percentages to improve spermatozoa fertilization capacity during IVEP processes(63). Cryopreservation significantly increases ROS production in spermatozoa, affecting motility, viability and training, and enhancing lipid peroxidation of the spermatic membrane, affecting potential fertility(64). Low fertilization rates in cryopreserved oocytes have been related to freeze damage, including hardening of the zona pellucida due to premature release of cortical granules, spindle disorganization and microtubule

437

Rev Mex Cienc Pecu 2019;10(2):433-459

loss or agglutination(65,66). Use of antioxidants may therefore be a vital factor in sperm survival and function before, during and after cryopreservation.

Figure 1: Effects of oxidative stress and sources of reactive oxygen species during embryo production

IVP = In vitro produced embryos

Enzymatic and non-enzymatic antioxidants

An antioxidant with biological function is defined as a substance that decreases or prevents substrate oxidation, resulting in a more potent reducing agent(67). Reactive oxygen species (ROS) can be inactivated by a defense system consisting of antioxidant enzymes and molecules(2). These antioxidant mechanisms can be mediated by iron- and copper-binding proteins such as transferrin, ferritin and albumin(68), and small antioxidant molecules derived mainly from fruits and vegetables. Enzymatic mechanisms can also mediate them, and include enzymes such as superoxide dismutase (SOD), which catalyzes dismutation of the superoxide anion in oxygen and hydrogen peroxide; catalase (CAT) and glutathione peroxidase (GPX), which convert hydrogen peroxide into water (and oxygen for CAT reactions); hydrophilic molecules such as ascorbate, urate and GSH; and lipophilic molecules such as tocopherols, flavonoids, carotenoids and ubiquinol

438

Rev Mex Cienc Pecu 2019;10(2):433-459

(Figure 2). Other enzymes involved in reduction of oxidized forms of small antioxidant molecules are also part of cell antioxidant mechanisms, including GSH reductase and dehydroascorbate reductase, as well as molecules responsible for maintenance of thiol groups in proteins (thioredoxin)(12).

Figure 2: Action mechanisms of enzymatic and non-enzymatic antioxidants

Reduced glutathione (GSH) is the largest non-protein sulfhydryl component in mammalian cells, and is known to protect the cell from oxidative damage and to regulate the intracellular redox balance(69). Several studies suggest that GSH plays an important role in many biological processes, including DNA and protein synthesis and cell proliferation during embryo development(70). In bovine oocytes, it is considered a vital biochemical marker of oocyte viability and quality(71). Synthesis of GSH has been reported during IVM(72,73), and is associated with formation of the male pronucleus after fertilization(72,74), and early embryo development(70). Intracellular GSH levels are therefore considered a marker of oocyte quality and embryo developmental competence after IVF. The most evaluated antioxidants as culture media supplements are ascorbic acid (AA) and alpha tocopherol (AT). Ascorbic acid decreases ROS production in bovine oocytes, improving their potential to develop embryos(9), while AT benefits blastocyst rate and cellularity(75,76). Alpha tocopherol (AT) can prove useful in IVEP because its hydrophobicity allows it to cross the lipid bilayer, intersperse in it and decrease ROS in the cell. In contrast, AA is hydrosoluble which allows it to act synergistically with tocopherol in some conditions, regenerating tocopherol from tocopheroxyl radicals in a redox cycle(77). It has also been reported to reduce ROS production in the culture medium and augment bovine embryo developmental competence by lowering intracellular ROS

439

Rev Mex Cienc Pecu 2019;10(2):433-459

in oocytes matured with AA(78). Ascorbic acid (AA) can also increase blastocyst rate and cellularity(11), raise intracellular GSH levels and lower ROS production in bovine oocytes(10). During the IVC, AA is also reported to decrease ROS production and expression of pro-apoptotic genes in pig embryos, thus enhancing embryo development(79), and improving the survival rate and quality of vitrified embryos(80,81). Embryo culture medium supplemented with AT or AA is reported to increase development and cellularity capacity, and reduce the proportion of apoptotic cells in porcine blastocysts derived from IVF or somatic cell nuclear transfer (SCNT); however, this effect was not observed with combined supplementation(76). Melatonin has been reported to have beneficial effects in IVEP due to its ability to trap free radicals, reduce ROS concentration, and increase expression of antioxidant enzymes (SOD and glutathione reductase)(82,83), as well as suppress expression of pro-oxidant enzymes and improve mitochondrial function(84,85). Like many antioxidants, melatonin can have positive or negative effects depending on the concentration at which it is administered in a culture medium. When supplemented in IVF medium at low concentrations it improves sperm quality and motility, decreases ROS levels and lipid peroxidation, and acts as an anti-apoptotic agent in bovine sperm(86) and ejaculated human sperm(87-89). In contrast, high concentrations induce fragmentation and oxidation of sperm DNA, decrease the number of viable spermatozoa and generate a decrease in blastocyst rates, without affecting embryo quality(90,91). In embryo culture medium, melatonin augments cleavage, blastocyst and hatching rates, increases embryo cellularity and promotes activation of antioxidant enzymes(92,93).

Phenolic antioxidants

Impressive progress has been made in identification, purification and evaluation of natural-origin antioxidant molecules(94), such as phenolic antioxidants. Because their structure includes aromatic rings and hydroxyl groups they are very stable and can inhibit oxidation of biologically and commercially important compounds(94,95). As a result, they have been suggested as potentially useful for prevention and treatment of diseases caused by free radicals, such as ischemia, atherosclerosis, and neuronal and cardiovascular diseases(96,97). Phenolic antioxidants (ArOH) have two action mechanisms: hydrogen atom transfer (HAT) or electron transfer (SET). In the first (HAT), the free radical (Râ&#x20AC;˘) removes a hydrogen atom from the antioxidant (ArOH), transforming it the radical ArOâ&#x20AC;˘. This is more stable and more efficient because its hydrogen bonds, conjugation and resonance make it a non-reactive phenoxyl radical. In the second mechanism (SET), the antioxidant 440

Rev Mex Cienc Pecu 2019;10(2):433-459

can donate an electron to the free radical, forming, among other products, a radical cation of the antioxidant (ArOâ&#x20AC;˘+) which is stable and does not react with substrates (Figure 3). Both mechanisms can always occur in parallel, although they have different reaction rates(98).

Figure 3: Action mechanisms of phenolic antioxidants

As part of the search for new antioxidants and evaluation of their activity in in vitro reproduction, green tea extract (the principal components of which are polyphenols) has been evaluated in oocytes matured in vitro. It favored blastocyst rate and reduced glutathione concentrations within the oocyte, but exhibited limited repeatability probably due to variability in extract composition(99). Anthocyanins are another type of biological molecule with antioxidant capacity. These were evaluated in pig and bovine oocytes in maturation medium(100,101), and different oocyte quality parameters tested such as free radical production level, intracellular glutathione levels, relative mRNA abundance associated with embryo development, and capacity for in vitro embryo production. The benefits of phenolic compounds from grapes have also garnered attention. Resveratrol (3,5,4'-trans-trihydroxystilbene) and pterostilbene (natural antioxidant analog of resveratrol) are abundant in plants and fruits such as blueberries, blackberries, peanuts, grapes and red wine(102,103). Both compounds have various in vivo and in vitro biological properties, such as antioxidant capacity, cardiac protection, anti-inflammatory, chemoprevention in some cancer models and some positive effects in metabolic diseases(102,104). Given these properties, research has been done into their in vitro biological effects in other animal models and systems, such as IVEP. When added to embryo culture medium, pterostilbene has been reported to reduce ROS levels and the percentage of lipids in embryos(105). However, very few studies have been done on this type of antioxidant in reproductive biotechnology, highlighting the need for more studies on the molecular mechanism by which pterostilbene exerts its effect on embryo metabolism.

441

Rev Mex Cienc Pecu 2019;10(2):433-459

Various studies have been done on resveratrol in IVEP (Table 1). There are studies on the use of resveratrol in in vitro oocyte maturation in swine(106), bovines(10,107-109), and goats(110), which indicate that it increases GSH concentration within the oocyte, decreases ROS production and raises the blastocyst rate. Use of resveratrol during in vitro embryo culture also has a positive effect on embryo development(111), and increases blastocyst cryotolerance(112,113), showing that its antioxidant capacity improves oocyte quality and resistance to cryopreservation processes. High resveratrol concentrations (20 and 40 µM), however, do not provide benefits and are reported to decrease the percentage of bovine oocytes capable of completing the maturation process up to metaphase II(114). Resveratrol’s physiological effect appears to be related to its ability to enhance cellular processes dependent on Sirtuin 1 (SIRT1). This in turn is also associated with adenosine monophosphate-activated protein kinase (AMPK), an energy sensor which controls cell metabolism, including oxidative phosphorylation and fatty acid oxidation(115). Activation of AMPK by resveratrol increases levels of NAD+ (the SIRT1 cofactor), which decreases the acetylation of SIRT1 substrates and activates PGC-1α (coactivator 1 α of the peroxisome proliferator-activated receptor gamma)(116,117). However, despite AMPK activation for observation of resveratrol’s metabolic effects, this compound’s direct target is upstream from AMPK. One proposed mechanism is that resveratrol activates AMPK through competitive inhibition of phosphodiesterases (PDEs), thus increasing AMPc levels(118). This second messenger plays a vital role in oocyte maturation in mammals, which occurs after bonding FSH and LH to their specific receptors in the plasma membrane of granulosa cells through activation of adenylate cyclase(119). Intracellular AMPc levels are regulated by PDEs, which hydrolyze it to 5'-AMP. Use of PDE inhibitors delays meiosis reinitiation and slows cumulus expansion kinetics, which prolongs maintenance of the gap bonds between the oocyte and cumulus cells(120). This extension of gap bonds during in vitro maturation in the presence of PDE4 inhibitors could allow passage of metabolites, ions, nucleotides and amino acids, which improve oocyte cytoplasm maturation, bringing it near synchronization of nuclear and cytoplasmic maturation, which would favor blastocyst production and quality.

442

Rev Mex Cienc Pecu 2019;10(2):433-459

Table 1: Studies of resveratrol as a supplement in culture media for in vitro embryo production Culture

Gametes

Species

Resveratrol Concentrations

Porcine

Improved development in in vitro parthenogenic 0.1, 0.5, 2.0 and and fertilized embryos; increased intracellular 10.0 Μm GSH and decreased ROS levels.

(106)

Porcine

20 µM

Increased SIRT1 expression; improved mitochondrial functioning and oocyte developmental capacity.

(142)

Porcine

2 µM

Improved oocyte resistance cryopreservation-induced damage.

(113)

0.1, 1 and 10 µM

Induced progesterone secretion; increased intracellular GSH; decreased ROS levels; promoted oocyte maturation and subsequent embryo development.

(107)

Bovine

20 µM

Increased ATP content and expression of SIRT1 protein in mature oocytes; improved fertilization by reinforcing mechanisms for blocking polyspermia.

(143)

Bovine

2 μM

Lowered ROS levels; raised development rates and cellularity.

(10)

Bovine

20 and 40 μM

Regulates expression of CYP1A1 gene involved in meiosis reinitiation.

(114)

Bovine

1, 10, 20 and 40 Increased embryo development and μM intracellular GSH, and decreased ROS levels

(108)

Bovine

0.2 µM, 1 µM and Improved oocyte developmental competence; 20 µM increased maturation and blastocyst rates.

(109)

Bovine

2 µM

Affected expression of SIRT1 protein in oocytes and blastocysts of donors of different ages.

(144)

Bovine

2 µM

Lowered ROS levels; increased GSH levels and cleavage and blastocyst rates; decreased expression of pro-apoptotis genes.

(145))

Caprine

Decreased ROS levels; increased GSH levels 0.1, 0.25, 0.5, 2.0 and embryo development rates; decreased and 5.0 µM expression of pro-apoptosis genes in cumulus cells, mature oocytes and blastocysts.

(110)

Mouse

15 µg/ml

Increased oocyte fertilization, decreased ROS generation, glutathione peroxidase activity and lipid peroxidation concentration.

(146)

Human

0.1, 1.0 and 10.0 Prevented damage to DNA caused by μM cryopreservation in sperm from fertile males.

(147)

Porcine

0.05, 0.1, 0.5, 1.0 0.5 µM in culture had positive effect on embryo and 25 µM development.

(111)

Bovine

0, 0.25, 0.5 and 1 0.5 µM improved embryo quality and µM cryotolerance.

(112)

Bovine

IVM

IVF

IVC

Oocytes

Spermatozoids

Embryos

Results

IVM= in vitro maturation; IVF= in vitro fertilization; IVC= in vitro culture.

443

Reference

embryo

Rev Mex Cienc Pecu 2019;10(2):433-459

Changes in gene expression and epigenetic disorders induced by ROS

Oocyte developmental competence is defined as the ability of an oocyte to reinitiate meiosis, be fertilized, divide and attain the blastocyst stage(121). This competence or quality is acquired progressively during folliculogenesis as the oocyte grows and matures through a series of cellular (mitochondrial activity), molecular (gene expression profile) and functional (protein kinase activity) changes(55,122). During oocyte growth and maturation mRNA and proteins are synthesized, which contribute to early development before and after activation of the embryo genome. This mRNA storage occurs during oocyte growth, and a polyadenylation event develops in each transcript, which is a key gene expression regulator and known to be an important step in mammalian embryo development(123). However, IVM conditions can affect polyadenylation levels in maternal mRNA, with implications for embryo quality(124). This suggests that deficiencies in developmental competence in most in vitro matured oocytes are reflected in the composition and abundance of specific RNA transcripts in the oocyte. For this reason, different transcripts have been evaluated in the oocyte in search of associations between them and oocyte quality or embryo developmental competence. Among the most studied are NLRP5 (NLR Family Pyrin Domain containing 5, known as MATER), a maternal effect gene specific to the oocyte which is required for early embryo development in bovines, mice and humans(125-127). Another is POU5F1 (POU domain Class 5, transcription factor 1, also known as OCT-4), which has been validated as a marker for epigenetic and pluripotency reprogramming, and is crucial for normal embryo development(128); increased POU5F1 expression has been reported in pig embryos derived from SCNT treated with vitamin C(129). In an effort to predict fertilization success and maintain oocyte viability, expression of genes such as hyaluronic acid synthetase 2 (HAS2), cyclooxygenase 2 (COX2; PTGS2) and gremlin (GREM1) have been studied in cumulus cells and correlated with oocyte competence and subsequent embryo development(111,130). In the development of bovine embryos, cell viability is determined by alterations in the expression of metabolism-related genes such as GLUT-1 (glucose transporter-1 transcripts)(131), growth factors such as IGF-2 (insulin-like growth factor 2) and IGF-2R (insulin-like growth factor 2 receptor), early differentiation and trophoblastic functions such as IF (interferon tau) and Mash2 (mammalian achaete-scute homologue)(132,133). Changes occur in gene expression during IVEP processes, and epigenetic disorders can arise that alter DNA methylation patterns in some genes (DNA methyltransferase, DNMT1a, DNMT3a and DNMT3b), affecting the gene expression profiles that encode for a specific tissue(134).

444

Rev Mex Cienc Pecu 2019;10(2):433-459

Evaluations have been done on the effect of antioxidant supplements in culture media on gene expression regulation. Supplementation with resveratrol during IVM of oocytes from pigs(106,111,135) and goats(110) decreased the transcription levels of genes related to apoptosis (e.g. BAX, BAK and caspase-3) but caused no changes in expression of the BCL2 gene. This suggests that resveratrol suppresses expression of pro-apoptotic genes in matured oocytes, and exerts a protective effect on embryos produced in vitro. Medium supplementation with AA has been reported to positively regulate pluripotent gene expression in porcine parthenogenetic blastocysts, and decrease expression of the proapoptotic gene Bax(79). Ascorbic acid (AA) supplementation in culture medium and vitrification-thawing media increases expression of the GPX1 and SOD1 genes, both associated with oxidative stress, thus improving survival rates and decreasing peroxide levels 24 h post-thaw(136). A study in bovines found that the relative abundance of GPX1 is higher in excellent quality blastocysts (Grade 1) than in good blastocysts (Grade 2), suggesting that less expression of GPX1 is associated with lower embryo quality(137). Reactive oxygen species (ROS) produced either endogenously or exogenously during IVEP may also induce epigenetic changes. Culture conditions that include changes in pH, osmolarity, temperature, visible light exposure, oxygen concentration and cell centrifuging can influence the epigenetic pattern during the in vitro process thus affecting gamete and embryo quality(134). Oxidative stress may produce alterations in DNA methylation patterns and modification of histone proteins in the gametes; these are transmissible from gametes to embryos, and generate variations in the epigenome that could alter subsequent embryo development(138-140). The mechanisms for transmission of these alterations to the embryo during fertilization and cleavage have not yet been elucidated. It has been suggested that oxidative stress damage in the gamete epigenome -which increases the adducts in DNA and alterations in the methylation profilesâ&#x20AC;&#x201C; is transferred to the embryo, manifesting in phenotypic alterations that can be observed in newborns(141). For example, induction of oxidative stress in spermatozoa using H2O2 causes oxidative damage in the spermatozoa epigenome, which subsequently reduces embryo development rates and alters cell differentiation in blastocysts. This causes reductions in implantation rates, reduced fetal growth, increased adipose tissue, decreased lean mass and lower glucose tolerance. These findings implicate ROS as one of the mechanisms responsible for transmitting health signals from parents to children(141).

445

Rev Mex Cienc Pecu 2019;10(2):433-459

Conclusions

In vitro embryo production techniques are used commercially in animal production, but myriad factors can generate oxidative stress and potentially affect the quality of matured oocytes and consequently embryo development rates. The environment and the procedures to which embryos and gametes are subjected generate increases in ROS levels that surpass the physiological levels required to regulate various cellular functions, thus affecting cell morphology and functionality. These factors can affect different biomolecules, causing damage to DNA, lipid peroxidation, changes in gene expression levels and epigenetic disorders. Use of molecules with antioxidant activity can ameliorate in vitro maturation conditions, but novel substances of natural origin are still needed to reduce oxidative stress during in vitro embryo production processes and improve oocyte quality and embryo developmental competence.

Acknowledgements

The research reported here was financed by the Banco de la República (Convenio 201633 Proyecto No. 3,862).

Literature cited: 1.

Park JI, Hong JY, Yong HY, Hwang WS, Lim JM, Lee ES. High oxygen tension during in vitro oocyte maturation improves in vitro development of porcine oocytes after fertilization. Anim Reprod Sci 2005;87(1–2):133–141.

Du Plessis SS, Makker K, Desai NR, Agarwal A. Impact of oxidative stress on IVF. Expert Rev Obstet Gynecol 2008;3(4):539–554.

Martín-Romero FJ, Miguel-Lasobras EM, Domínguez-Arroyo JA, González-Carrera E, Alvarez IS. Contribution of culture media to oxidative stress and its effect on human oocytes. Reprod Biomed Online 2008;17(5):652–661.

446

Rev Mex Cienc Pecu 2019;10(2):433-459

Will MA, Clark NA, Swain JE. Biological pH buffers in IVF: help or hindrance to success. J Assist Reprod Genet 2011;28(8):711–724.

Li Z, Zhou Y, Liu R, Lin H, Liu W, Xiao W, et al. Effects of semen processing on the generation of reactive oxygen species and mitochondrial membrane potential of human spermatozoa. Andrologia 2012;44(3):157–163.

Agarwal A, Durairajanayagam D, du Plessis SS. Utility of antioxidants during assisted reproductive techniques: an evidence based review. Reprod Biol Endocrinol 2014;12:112.

Blanco MR, Demyda S, Moreno Millán M, Genero E. Developmental competence of in vivo and in vitro matured oocytes: A review. Anim Reprod Sci 2012;9(3):281– 289.

Ali AA, Bilodeau JF, Sirard MA. Antioxidant requirements for bovine oocytes varies during in vitro maturation, fertilization and development. Theriogenology 2003;59(3–4):939–949.

Vásquez NA, Torres V, Rojano BA. Efecto del ácido ascórbico durante maduración in vitro de oocitos bovinos en la producción de especies reactivas de oxígeno (ERO) y competencia para el desarrollo embrionario. Inf Tecnol 2014;25(2):141–150.

10. Sovernigo T, Adona P, Monzani P, Guemra S, Barros F, Lopes F, et al. Effects of supplementation of medium with different antioxidants during in vitro maturation of bovine oocytes on subsequent embryo production. Reprod Domest Anim 2017;52:561–569. 11. Kere M, Siriboon C, Lo N-W, Nguyen NT, Ju J-C. Ascorbic acid improves the developmental competence of porcine oocytes after parthenogenetic activation and somatic cell nuclear transplantation. J Reprod Dev 2013;59(1):78–84. 12. Covarrubias L, Hernández-García D, Schnabel D, Salas-Vidal E, Castro-Obregón S. Function of reactive oxygen species during animal development: Passive or active? Dev Biol 2008;320(1):1–11. 13. Rikans LE, Hornbrook KR. Lipid peroxidation, antioxidant protection and aging. Biochim Biophys Acta. 1997;1362(2–3):116–127. 14. Dalle-Donne I, Rossi R, Giustarini D, Milzani A, Colombo R. Protein carbonyl groups as biomarkers of oxidative stress. Clin Chim Acta 2003;329(1–2):23–38. 15. David SS, O’Shea VL, Kundu S. Base-excision repair of oxidative DNA damage. Nature. 2007;21;447(7147):941–950. 16. Selivanov VA, Votyakova T V, Pivtoraiko VN, Zeak J, Sukhomlin T, Trucco M, et al. Reactive oxygen species production by forward and reverse electron fluxes in the 447

Rev Mex Cienc Pecu 2019;10(2):433-459

mitochondrial respiratory chain. Beard DA, editor. PLoS Comput Biol 2011 Mar 31;7(3):e1001115. 17. Yakes FM, Van Houten B. Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc Natl Acad Sci U S A. 1997;21;94(2):514–519. 18. Finkel T, Holbrook NJ. Oxidants, oxidative stress and the biology of ageing. Nature 2000;9;408(6809):239–247. 19. Chinnery PF, Elliott HR, Hudson G, Samuels DC, Relton CL. Epigenetics, epidemiology and mitochondrial DNA diseases. Int J Epidemiol 2012;41(1):177– 187. 20. Han Y, Chen JZ. Oxidative stress induces mitochondrial DNA damage and cytotoxicity through independent mechanisms in human cancer cells. Biomed Res Int 2013;2013:1–8. 21. Guo C, Sun L, Chen X, Zhang D. Oxidative stress, mitochondrial damage and neurodegenerative diseases. Neural Regen Res 2013;8(21):2003–2014. 22. Kirkinezos IG, Moraes CT. Reactive oxygen species and mitochondrial diseases. Semin Cell Dev Biol 2001;12(6):449–457. 23. Hernández-García D, Wood CD, Castro-Obregón S, Covarrubias L. Reactive oxygen species: A radical role in development? Free Radic Biol Med 2010;49(2):130–143. 24. Shkolnik K, Tadmor A, Ben-Dor S, Nevo N, Galiani D, Dekel N. Reactive oxygen species are indispensable in ovulation. Proc Natl Acad Sci 2011;108(4):1462–1467. 25. Morado SA, Cetica PD, Beconi MT, Dalvit GC. Reactive oxygen species in bovine oocyte maturation in vitro. Reprod Fertil Dev 2009;21(4):608–614. 26. Park EJ, Pezzuto JM, Novelle MG, Wahl D, Diéguez C, Bernier M, et al. [Resveratrol: distribution, properties and perspectives]. J Reprod Dev 2011 Aug 1;1852(3):92–99. 27. Jin S-K, Yang W-X. Factors and pathways involved in capacitation: how are they regulated? Oncotarget 2017;8(2):3600–3627. 28. Gangwar DK, Atreja SK. Signalling events and associated pathways related to the mammalian sperm capacitation. Reprod Domest Anim 2015;50(5):705–711. 29. Henkel RR. Leukocytes and oxidative stress: dilemma for sperm function and male fertility. Asian J Androl. 2011;13(1):43–52. 30. Kothari S, Thompson A, Agarwal A, du Plessis SS. Free radicals: their beneficial

448

Rev Mex Cienc Pecu 2019;10(2):433-459

and detrimental effects on sperm function. Indian J Exp Biol 2010;48(5):425–435. 31. Bromfield EG, Aitken RJ, Anderson AL, McLaughlin EA, Nixon B. The impact of oxidative stress on chaperone-mediated human sperm–egg interaction. Hum Reprod 2015;30(11):2597–2613. 32. Guerin P, Mouatassim S, Menezo Y. Oxidative stress and protection against reaction oxygen species in the pre-implantation embryo and its surroundings. Reprod Updat 2001;7(2):175–189. 33. Gupta S, Sekhon L, Kim Y, Agarwal A. The role of oxidative stress and antioxidants in assisted reproduction. Curr Womens Health Rev 2010;6(3):227–238. 34. Fischer B, Bavister BD. Oxygen tension in the oviduct and uterus of rhesus monkeys, hamsters and rabbits. Reproduction 1993;99(2):673–679. 35. Oyamada T, Fukui Y. Oxygen tension and medium supplements for in vitro maturation of bovine oocytes cultured individually in a chemically defined medium. J Reprod Dev 2004;50(1):107–117. 36. Corrêa GA, Rumpf R, Mundim TCD, Franco MM, Dode MAN. Oxygen tension during in vitro culture of bovine embryos: Effect in production and expression of genes related to oxidative stress. Anim Reprod Sci 2008;104(2–4):132–142. 37. Balasubramanian S, Son WJ, Kumar BM, Ock SA, Yoo JG, Im GS, et al. Expression pattern of oxygen and stress-responsive gene transcripts at various developmental stages of in vitro and in vivo preimplantation bovine embryos. Theriogenology 2007;68(2):265–275. 38. Karagenc L, Sertkaya Z, Ciray N, Ulug U, Bahçeci M. Impact of oxygen concentration on embryonic development of mouse zygotes. Reprod Biomed Online 2004;9(4):409–417. 39. Kitagawa Y, Suzuki K, Yoneda A, Watanabe T, Agarwal A, Sharma RK, et al. Effects of oxygen concentration and antioxidants on the in vitro developmental ability, production of reactive oxygen species (ROS), and DNA fragmentation in porcine embryos. Theriogenology 2004;1;62(7):1186–1197. 40. Booth PJ, Holm P, Callesen H. The effect of oxygen tension on porcine embryonic development is dependent on embryo type. Theriogenology. 2005;63(7):2040–2052. 41. Batt P, Gardner D, Cameron A. Oxygen concentration and protein source affect the development of preimplantation goat embryos in vitro. Reprod Fertil Dev 1991;3(5):601. 42. Takahashi M, Keicho K, Takahashi H, Ogawa H, Schultz RM, Okano A. Effect of oxidative stress on development and DNA damage in in-vitro cultured bovine 449

Rev Mex Cienc Pecu 2019;10(2):433-459

embryos by comet assay. Theriogenology 2000;54(1):137–145. 43. Bontekoe S, Mantikou E, van Wely M, Seshadri S, Repping S, Mastenbroek S. Low oxygen concentrations for embryo culture in assisted reproductive technologies. Cochrane database Syst Rev 2012;(7):CD008950. 44. Takahashi M. Oxidative stress and redox regulation on in vitro development of mammalian embryos. J Reprod Dev 2012;58(1):1–9. 45. Bermejo-Álvarez P, Lonergan P, Rizos D, Gutiérrez-Adan A. Low oxygen tension during IVM improves bovine oocyte competence and enhances anaerobic glycolysis. Reprod Biomed Online 2010;20(3):341–349. 46. Rinaudo P, Giritharan G, Talbi S, Dobson A, Schultz R, Katoh Y, et al. Effects of oxygen tension on gene expression in preimplantation mouse embryos. Fertil Steril 2006;86(4):1265.e1-1265.e36. 47. Combelles CMH, Gupta S, Agarwal A. Could oxidative stress influence the in-vitro maturation of oocytes? Reprod Biomed Online 2009;18(6):864–880. 48. Guerin P. Oxidative stress and protection against reactive oxygen species in the preimplantation embryo and its surroundings. Hum Reprod Update. 2001;7(2):175–189. 49. Conklin DJ, Langford SD, Boor PJ. Contribution of serum and cellular semicarbazide-sensitive amine oxidase to amine metabolism and cardiovascular toxicity. Toxicol Sci 1998;46(2):386–392. 50. Stites TE, Mitchell AE, Rucker RB. Physiological importance of quinoenzymes and the O-quinone family of cofactors. J Nutr 2000;130(4):719–727. 51. Sudano MJ, Paschoal DM, da Silva Rascado T, Magalhães LCO, Crocomo LF, de Lima-Neto JF, et al. Lipid content and apoptosis of in vitro-produced bovine embryos as determinants of susceptibility to vitrification. Theriogenology 2011;75(7):1211–1220. 52. Rizos D, Gutiérrez-Adán A, Pérez-Garnelo S, De La Fuente J, Boland MP, Lonergan P. Bovine embryo culture in the presence or absence of serum: implications for blastocyst development, cryotolerance, and messenger RNA expression. Biol Reprod 2003;68(1):236–243. 53. Almeida T, Tetzner D, Saraiva NZ, Perecin F, Cristina S, Niciura M, et al. The effects of ovalbumin as a protein source during the in vitro production of bovine embryos. Rev Bras Zootec 2011;40(10):2135–2141. 54. Hashimoto S, Minami N, Yamada M, Imai H. Excessive concentration of glucose during in vitro maturation impairs the developmental competence of bovine oocytes after in vitro fertilization: Relevance to intracellular reactive oxygen species and 450

Rev Mex Cienc Pecu 2019;10(2):433-459

glutathione contents. Mol Reprod Dev 2000;56(4):520–526. 55. Krisher RL, Brad AM, Herrick JR, Sparman ML, Swain JE. A comparative analysis of metabolism and viability in porcine oocytes during in vitro maturation. Anim Reprod Sci 2007;98(1–2):72–96. 56. Hashimoto S, Minami N, Takakura R, Yamada M. Low oxygen tension during in vitro maturation is beneficial for supporting the subsequent development of bovine cumulus ± oocyte complexes. Mol Reprod Dev 2000;57:353–60. 57. Shahar S, Wiser A, Ickowicz D, Lubart R, Shulman A, Breitbart H. Light-mediated activation reveals a key role for protein kinase A and sarcoma protein kinase in the development of sperm hyper-activated motility. Hum Reprod 2011;26(9):2274– 2282. 58. Takenaka M, Horiuchi T, Yanagimachi R. Effects of light on development of mammalian zygotes. Proc Natl Acad Sci U S A. 2007;104(36):14289–14293. 59. Li R, Liu Y, Pedersen HS, Callesen H. Effect of ambient light exposure of media and embryos on development and quality of porcine parthenogenetically activated embryos. Zygote 2015;23(03):378–383. 60. Lampiao F, Strijdom H, Du Plessis S. Effects of sperm processing techniques involving centrifugation on nitric oxide, reactive oxygen species generation and sperm function. Open Androl J 2010;2:1–5. 61. Urrego R, Ríos A, Ángel MO, Camargo O. Efecto de la centrifugación sobre la membrana plasmática y el ADN de espermatozoides bovinos. Rev Colomb Ciencias Pecu 2008;21(1):19–26. 62. Ángel D, Pérez N, Pareja A, Camargo O, Urrego R. Efecto de la preparación espermática previo a la fertilización sobre la membrana plasmática y el adn de semen bovino sexado in vitro. Rev CES 2009;4(2):29–37. 63. Jayaraman V, Upadhya D, Narayan PK, Adiga SK. Sperm processing by swim-up and density gradient is effective in elimination of sperm with DNA damage. J Assist Reprod Genet 2012;29(6):557–563. 64. Bilodeau JF, Chatterjee S, Sirard MA, Gagnon C. Levels of antioxidant defenses are decreased in bovine spermatozoa after a cycle of freezing and thawing. Mol Reprod Dev 2000;55(3):282–288. 65. Hwang IS, Hochi S. Recent progress in cryopreservation of bovine oocytes. Biomed Res Int 2014;2014:1-11. 66. Carroll J, Depypere H, Matthews CD. Freeze-thaw-induced changes of the zona pellucida explains decreased rates of fertilization in frozen-thawed mouse oocytes. J 451

Rev Mex Cienc Pecu 2019;10(2):433-459

Reprod Fertil 1990;90(2):547–53. 67. Tirzitis G, Bartosz G. Determination of antiradical and antioxidant activity: Basic principles and new insights. Acta Biochim Pol 2010;57(2):139–142. 68. Kirschvink N, Moffarts B De, Lekeux P. The oxidant/antioxidant equilibrium in horses. Vet J 2008;177(2):178–191. 69. Battin EE, Brumaghim JL. Antioxidant activity of sulfur and selenium: A review of reactive oxygen species scavenging, glutathione peroxidase, and metal-binding antioxidant mechanisms. Cell Biochem Biophys 2009;55(1):1–23. 70. De Matos DG, Gasparrini B, Pasqualini SR, Thompson JG. Effect of glutathione synthesis stimulation during in vitro maturation of ovine oocytes on embryo development and intracellular peroxide content. Theriogenology. 2002;57(5):1443– 1451. 71. Zuelke KA, Jeffay SC, Zucker RM, Perreault SD. Glutathione (GSH) concentrations vary with the cell cycle in maturing hamster oocytes, zygotes, and pre-implantation stage embryos. Mol Reprod Dev 2003;64(1):106–112. 72. Miyamura M, Yoshida M, Hamano S, Kuwayama M. Glutathione concentration during maturation and fertilization in bovine oocytes. Theriogenology 1995;43(1):282. 73. De Matos DG, Furnus CC, Moses DF, Martinez AG, Matkovic M. Stimulation of glutathione synthesis of in vitro matured bovine oocytes and its effect on embryo development and freezability. Mol Reprod Dev 1996;45(4):451–457. 74. de Matos DG, Furnus CC, Moses DF. Glutathione synthesis during in vitro maturation of bovine oocytes: role of cumulus cells. Biol Reprod. 1997;57(6):1420– 1425. 75. Olson SE, Seidel GE. Culture of in vitro-produced bovine embryos with vitamin E improves development in vitro and after transfer to recipients. Biol Reprod 2000;62(2):248–252. 76. Jeong YW, Park SW, Hossein MS, Kim S, Kim JH, Lee SH, et al. Antiapoptotic and embryotrophic effects of alpha-tocopherol and L-ascorbic acid on porcine embryos derived from in vitro fertilization and somatic cell nuclear transfer. Theriogenology 2006;66(9):2104–2112. 77. Halliwell B, Gutteridge JM. The antioxidants of human extracellular fluids. Arch Biochem Biophys 1990;280(1):1–8. 78. Vásquez NA, Torres V, Rojano BA. Efecto del ácido ascórbico durante maduración in vitro de oocitos bovinos en la producción de especies reactivas de oxígeno (ERO) 452

Rev Mex Cienc Pecu 2019;10(2):433-459

y competencia para el desarrollo embrionario. Inf Tecnol 2014;25(2):141–50. 79. Hu J, Cheng D, Gao X, Bao J, Ma X, Wang H. Vitamin C enhances the in vitro development of porcine pre-implantation embryos by reducing oxidative stress. Reprod Domest Anim 2012;47(6):873–879. 80. Castillo-Martín M, Yeste M, Soler A, Morató R, Bonet S. Addition of l-ascorbic acid to culture and vitrification media of IVF porcine blastocysts improves survival and reduces HSPA1A levels of vitrified embryos. Reprod Fertil Dev 2015;27(7):1115– 1123. 81. Castillo-Martín M, Bonet S, Morató R, Yeste M. Comparative effects of adding βmercaptoethanol or L-ascorbic acid to culture or vitrification-warming media on IVF porcine embryos. Reprod Fertil Dev 2014;26(6):875–882. 82. Kaur H, Bhatla SC. Melatonin and nitric oxide modulate glutathione content and glutathione reductase activity in sunflower seedling cotyledons accompanying salt stress. Nitric Oxide 2016;59:42–53. 83. Li B, He X, Zhuang M, Niu B, Wu C, Mu H, et al. Melatonin ameliorates busulfaninduced spermatogonial stem cell oxidative apoptosis in mouse testes. Antioxid Redox Signal 2018;28(5):385–400. 84. Zhang HM, Zhang Y. Melatonin: A well-documented antioxidant with conditional pro-oxidant actions. J Pineal Res 2014;57(2):131–146. 85. Loren P, Sánchez R, Arias ME, Felmer R, Risopatrón J, Cheuquemán C. Melatonin scavenger properties against oxidative and nitrosative stress: Impact on gamete handling and in vitro embryo production in humans and other mammals. Int J Mol Sci 2017;18(6):1–17. 86. Pang Y-W, Sun Y-Q, Jiang X-L, Huang Z-Q, Zhao S-J, Du W-H, et al. Protective effects of melatonin on bovine sperm characteristics and subsequent in vitro embryo development. Mol Reprod Dev 2016;83(11):993–1002. 87. Espino J, Ortiz Á, Bejarano I, Lozano GM, Monllor F, García JF, et al. Melatonin protects human spermatozoa from apoptosis via melatonin receptor– and extracellular signal–regulated kinase-mediated pathways. Fertil Steril 2011;95(7):2290–2296. 88. Espino J, Bejarano I, Ortiz Á, Lozano GM, García JF, Pariente JA, et al. Melatonin as a potential tool against oxidative damage and apoptosis in ejaculated human spermatozoa. Fertil Steril 2010;94(5):1915–1917. 89. Karimfar M, Niazvand F, Haghani K, Ghafourian S, Shirazi R, Bakhtiyari S. The protective effects of melatonin against cryopreservation-induced oxidative stress in

453

Rev Mex Cienc Pecu 2019;10(2):433-459

human sperm. Int J Immunopathol Pharmacol 2015;28(1):69–76. 90. Cheuquemán C, Arias ME, Risopatrón J, Felmer R, Álvarez J, Mogas T, et al. Supplementation of IVF medium with melatonin: Effect on sperm functionality and in vitro produced bovine embryos. Andrologia 2015;47(6):604–615. 91. Succu S, Pasciu V, Manca ME, Chelucci S, Torres-Rovira L, Leoni GG, et al. Dosedependent effect of melatonin on postwarming development of vitrified ovine embryos. Theriogenology 2014;81(8):1058–1066. 92. Mehaisen GMK, Saeed AM, Gad A, Abass AO, Arafa M, El-Sayed A. Antioxidant Capacity of melatonin on preimplantation development of fresh and vitrified rabbit embryos: Morphological and molecular aspects. Fraidenraich D, editor. PLoS One. 2015;10(10):e0139814. 93. Dehghani-Mohammadabadi M, Salehi M, Farifteh F, Nematollahi S, Arefian E, Hajjarizadeh A, et al. Melatonin modulates the expression of BCL-xl and improve the development of vitrified embryos obtained by IVF in mice. J Assist Reprod Genet 2014;31(4):453–461. 94. Dimitrios B. Sources of natural phenolic antioxidants. Trends Food Sci Technol 2006;17(9):505–512. 95. Wright JS, Johnson ER, DiLabio GA. Predicting the activity of phenolic antioxidants: theoretical method, analysis of substituent effects, and application to major families of antioxidants. J Am Chem Soc 2001;123(6):1173–1183. 96. Negi G, Kumar A, Kaundal RK, Gulati A, Sharma SS. Functional and biochemical evidence indicating beneficial effect of Melatonin and Nicotinamide alone and in combination in experimental diabetic neuropathy. Neuropharmacology 2010;58(3):585–592. 97. Kumar A, Sharma SS. NF-kB inhibitory action of resveratrol: A probable mechanism of neuroprotection in experimental diabetic neuropathy. Biochem Biophys Res Commun 2010;394(2):360–365. 98. Rojano B, Gaviria CA, Gil MA, Saez JA, Schinella G, Tournier H. Actividad antioxidante del isoespintanol en diferentes medios. Vitae, Rev La Fac Quim Farm 2008;15(63):173–181. 99. Wang ZG, Yu SD, Xu ZR. Effect of supplementation of green tea polyphenols on the developmental competence of bovine oocytes in vitro. Braz J Med Biol Res 2007;40(8):1079–1085. 100. You J, Kim J, Lim J, Lee E. Anthocyanin stimulates in vitro development of cloned pig embryos by increasing the intracellular glutathione level and inhibiting reactive

454

Rev Mex Cienc Pecu 2019;10(2):433-459

oxygen species. Theriogenology 2010;74(5):777–785. 101. Sakatani M, Suda I, Oki T, Kobayashi S, Kobayashi S, Takahashi M. Effects of purple sweet potato anthocyanins on development and intracellular redox status of bovine preimplantation embryos exposed to heat shock. J Reprod Dev 2007;53(3):605–614. 102. Gambini J, Inglés M, Olaso G, Lopez-Grueso R, Bonet-Costa V, Gimeno-Mallench L, et al. Properties of resveratrol: In vitro and in vivo studies about metabolism, bioavailability, and biological effects in animal models and humans. Oxid Med Cell Longev 2015;2015:837042. 103. Rimando AM, Kalt W, Magee JB, Dewey J, Ballington JR. Resveratrol, pterostilbene, and piceatannol in Vaccinium berries. J Agric Food Chem 2004;52(15):4713–4719. 104. McCormack D, McFadden D. A review of pterostilbene antioxidant activity and disease modification. Oxid Med Cell Longev 2013;2013:575482. 105. Sosa F, Fernando de la Torre J, Alvarez H, Perez S, Kjelland ME, Romo S. 84 Pterostilbene can reduce the percentage of lipids and reactive oxygen species in in vitro-produced bovine embryos [resumen]. Reprod Fertil Dev 2017;29(1):149. 106. Kwak S-S, Cheong S-AA, Jeon Y, Lee E, Choi K-CC, Jeung E-BB, et al. The effects of resveratrol on porcine oocyte in vitro maturation and subsequent embryonic development after parthenogenetic activation and in vitro fertilization. Theriogenology 2012;78(1):86–101. 107. Wang F, Tian X, Zhang L, He C, Ji P, Li Y, et al. Beneficial effect of resveratrol on bovine oocyte maturation and subsequent embryonic development after in vitro fertilization. Fertil Steril 2014;101(2):577–586. 108. Torres V, Urrego R, Echeverry JJ, Lopez A. 181 Resveratrol during in vitro maturation improves the quality of bovine oocyte and enhances embryonic. Reprod Fertil Dev 2016;29:199–209. 109. Kordowitzki P, Bernal SM, Herrmann D, Aldag P, Niemann H. Resveratrol supplementation during in vitro maturation and fertilisation enhances developmental competence of bovine oocytes [resumen]. Reprod Fertil Dev 2016;28(2):230. 110. Mukherjee A, Malik H, Saha AP, Dubey A, Singhal DK, Boateng S, et al. Resveratrol treatment during goat oocytes maturation enhances developmental competence of parthenogenetic and hand-made cloned blastocysts by modulating intracellular glutathione level and embryonic gene expression. J Assist Reprod Genet 2014;31(2):229–239.

455

Rev Mex Cienc Pecu 2019;10(2):433-459

111. Lee K, Wang C, Chaille JM, Machaty Z. Effect of resveratrol on the development of porcine embryos produced in vitro. J Reprod Dev 2010;56(3):330–335. 112. Salzano A, Albero G, Zullo G, Neglia G, Abdel-Wahab A, Bifulco G, et al. Effect of resveratrol supplementation during culture on the quality and cryotolerance of bovine in vitro produced embryos. Anim Reprod Sci 2014;151(3–4):91–96. 113. Giaretta E, Spinaci M, Bucci D, Tamanini C, Galeati G. Effects of resveratrol on vitrified porcine oocytes. Oxid Med Cell Longev 2013;2013. 114. Pocar P, Augustin R, Fischer B. Constitutive expression of CYP1A1 in bovine cumulus oocyte-complexes in vitro: Mechanisms and biological implications. Endocrinology 2004;145(4):1594–1601. 115. Price NL, Gomes AP, Ling AJY, Duarte FV, Martin-Montalvo A, North BJ, et al. SIRT1 is required for AMPK activation and the beneficial effects of resveratrol on mitochondrial function. Cell Metab 2012;15(5):675–690. 116. Kulkarni SS, Cantó C. The molecular targets of resveratrol. Biochim Biophys Acta 2015;1852:1114–1123. 117. Chang HC, Guarente L. SIRT1 and other sirtuins in metabolism. Trends Endocrinol Metab 2014;25(3):138–145. 118. Park S, Ahmad F, Philp A, Baar K, Williams T, Ke H, et al. Resveratrol ameliorates aging-related metabolic phenotypes by inhibiting cAMP phosphodiesterases. Cell 2012;148(3):421–433. 119. Mayes MA, Sirard M-A. Effect of type 3 and type 4 phosphodiesterase inhibitors on the maintenance of bovine oocytes in meiotic arrest. Biol Reprod 2002;66(1):180– 184. 120. Thomas RE, Thompson JG, Armstrong DT, Gilchrist RB. Effect of specific phosphodiesterase isoenzyme inhibitors during in vitro maturation of bovine oocytes on meiotic and developmental capacity. Biol Reprod 2004;71(4):1142–1149. 121. Sirard MA, Richard F, Blondin P, Robert C. Contribution of the oocyte to embryo quality. Theriogenology 2006;65(1):126–136. 122. Torner H, Ghanem N, Ambros C, Hölker M, Tomek W, Phatsara C, et al. Molecular and subcellular characterisation of oocytes screened for their developmental competence based on glucose-6-phosphate dehydrogenase activity. Reproduction 2008;135(2):197–212. 123. Lequarre AS, Traverso JM, Marchandise J, Donnay I. Poly(A) RNA is reduced by half during bovine oocyte maturation but increases when meiotic arrest is maintained with CDK inhibitors. Biol Reprod 2004;71(2):425–431. 456

Rev Mex Cienc Pecu 2019;10(2):433-459

124. Bilodeau-Goeseels S, Panich P. Effects of oocyte quality on development and transcriptional activity in early bovine embryos. Anim Reprod Sci 2002;71(3– 4):143–155. 125. Tong Z-B, Bondy CA, Zhou J, Nelson LM. A human homologue of mouse mater, a maternal effect gene essential for early embryonic development. Hum Reprod 2002;17(4):903–911. 126. Pennetier S, Perreau C, Uzbekova S, Thélie A, Delaleu B, Mermillod P, et al. MATER protein expression and intracellular localization throughout folliculogenesis and preimplantation embryo development in the bovine. BMC Dev Biol 2006;6:26. 127. Urrego R, Herrera-Puerta E, Chavarria NA, Camargo O, Wrenzycki C, RodriguezOsorio N. Follicular progesterone concentrations and messenger RNA expression of MATER and OCT-4 in immature bovine oocytes as predictors of developmental competence. Theriogenology 2015;83(7):1179–1187. 128. Habermann FA, Wuensch A, Sinowatz F, Wolf E. Reporter genes for embryogenesis research in livestock species. Theriogenology 2007;68(Supl. 1):116–124. 129. Huang Y, Tang X, Xie W, Zhou Y, Li D, Zhou Y, et al. Vitamin C enhances in vitro and in vivo development of porcine somatic cell nuclear transfer embryos. Biochem Biophys Res Commun 2011;411(2):397–401. 130. McKenzie LJ, Pangas SA, Carson SA, Kovanci E, Cisneros P, Buster JE, et al. Human cumulus granulosa cell gene expression: A predictor of fertilization and embryo selection in women undergoing IVF. Hum Reprod 2004;19(12):2869–2874. 131. Lopes AS, Wrenzycki C, Ramsing NB, Herrmann D, Niemann H, Løvendahl P, et al. Respiration rates correlate with mRNA expression of G6PD and GLUT1 genes in individual bovine in vitro-produced blastocysts. Theriogenology 2007;68(2):223– 236. 132. Wrenzycki C, Wells D, Herrmann D, Miller A, Oliver J, Tervit R, et al. Nuclear transfer protocol affects messenger RNA expression patterns in cloned bovine blastocysts. Biol Reprod 2001;65(1):309–317. 133. Rizos D, Lonergan P, Boland MP, Arroyo-García R, Pintado B, de la Fuente J, et al. Analysis of differential messenger RNA expression between bovine blastocysts produced in different culture systems: Implications for blastocyst quality. Biol Reprod 2002;66(3):589–595. 134. Urrego R, Rodriguez-Osorio N, Niemann H. Epigenetic disorders and altered gene expression after use of assisted reproductive technologies in domestic cattle. Epigenetics 2014;9(6):803–815.

457

Rev Mex Cienc Pecu 2019;10(2):433-459

135. Lee S, Park EJ, Moon JH, Kim SJ, Song K, Lee BC. Sequential treatment with resveratrol-trolox improves development of porcine embryos derived from parthenogenetic activation and somatic cell nuclear transfer. Theriogenology 2016;84(1):145–154. 136. Castillo-Martín M, Bonet S, Morató R, Yeste M. Supplementing culture and vitrification-warming media with l-ascorbic acid enhances survival rates and redox status of IVP porcine blastocysts via induction of GPX1 and SOD1 expression. Cryobiology 2014;68(3):451–458. 137. Cebrian-Serrano A, Salvador I, García-Roselló E, Pericuesta E, Pérez-Cerezales S, Gutierrez-Adán A, et al. Effect of the bovine oviductal fluid on in vitro fertilization, development and gene expression of in vitro-produced bovine blastocysts. Reprod Domest Anim 2013;48(2):331–338. 138. Brykczynska U, Hisano M, Erkek S, Ramos L, Oakeley EJ, Roloff TC, et al. Repressive and active histone methylation mark distinct promoters in human and mouse spermatozoa. Nat Struct Mol Biol 2010;17(6):679–687. 139. Heinzmann J, Hansmann T, Herrmann D, Wrenzycki C, Zechner U, Haaf T, et al. Epigenetic profile of developmentally important genes in bovine oocytes. Mol Reprod Dev 2011;78(3):188–201. 140. De Castro LS, De Assis PM, Siqueira AFP, Hamilton TRS, Mendes CM, Losano JDA, et al. Sperm oxidative stress is detrimental to embryo development: A dosedependent study model and a new and more sensitive oxidative status evaluation. Oxid Med Cell Longev 2016;2016:1–12. 141. Lane M, McPherson NO, Fullston T, Spillane M, Sandeman L, Kang WX, et al. Oxidative stress in mouse sperm impairs embryo development, fetal growth and alters adiposity and glucose regulation in female offspring. PLoS One. 2014;9(7):1– 9. 142. Sato D, Itami N, Tasaki H, Takeo S, Kuwayama T, Iwata H, et al. Relationship between mitochondrial DNA copy number and SIRT1 expression in porcine oocytes. Ling F, editor. PLoS One 2014;9(4):e94488. 143. Takeo S, Sato D, Kimura K, Monji Y, Kuwayama T, Kawahara-Miki R, et al. Resveratrol improves the mitochondrial function and fertilization outcome of bovine oocytes. J Reprod Dev 2014;60(2):92–99. 144. Kordowitzki P, Klein S, Hadeler K-G, Aldag P, Nowak-Imialek M, Lucas-Hahn A, et al. SIRT1-A possible marker for reproductive aging of in vivo-derived bovine oocytes? [resumen]. Reprod Fertil Dev 2017;29(1):109. 145. Lee S, Park EJ, Moon JH, Kim SJ, Song K, Lee BC. Sequential treatment with

458

Rev Mex Cienc Pecu 2019;10(2):433-459

resveratrol-trolox improves development of porcine embryos derived from parthenogenetic activation and somatic cell nuclear transfer. Theriogenology 2015;84(1):145–154. 146. Mojica-Villegas MA, Izquierdo-Vega JA, Chamorro-Cevallos G, Sánchez-Gutiérrez M. Protective effect of resveratrol on biomarkers of oxidative stress induced by iron/ascorbate in mouse spermatozoa. Nutrients 2014;6(2):489–503. 147. Branco CS, Garcez ME, Pasqualotto FF, Erdtman B, Salvador M. Resveratrol and ascorbic acid prevent DNA damage induced by cryopreservation in human semen. Cryobiology 2010;60(2):235–237.

459

https://doi.org/10.22319/rmcp.v10i2.4454 Technical note

DL-malic acid supplementation improves the carcass characteristics of finishing Pelibuey lambs

José Lenin Loya-Olguina,c Fidel Ávila Ramosb Sergio Martínez Gonzalezc Iván Adrián García Galiciad Alma Delia Alarcón Rojod Francisco Escalera Valentea,c*

Universidad Autónoma de Nayarit. Posgrado en Ciencias Biológico Agropecuarias, Tepic, Nayarit, México. b

Universidad de Guanajuato. Programa de Medicina Veterinaria y Zootecnia, Guanajuato, México. c

Universidad Autónoma de Nayarit. Unidad Académica de Medicina Veterinaria y Zootecnia. Compostela Nayarit, México. d

Universidad Autónoma de Chihuahua. Facultad de Zootecnia y Ecología, Chihuahua, Chih. México.

*Corresponding author: franescalera@hotmail.com

Abstract: The aim of the present study was to evaluate the effect of DL-malic acid addition in Pelibuey finishing diet on average daily gain, carcass characteristics and non-carcass components. Sixteen (16) male lambs with a mean body weight of 27 ± 1.92 kg, were used in a 48-d feeding experiment. Animals were fed a high-energy diet containing corn stover, as the only forage source, with and without the DL-malic acid (MA) addition. Animals were assigned randomly in two treatments with eight lambs each: 1) Addition of 460

Rev Mex Cienc Pecu 2019;10(2):460-472

4 g of DL-malic acid per kg of feed and 2) Control (diet 1 without MA). Four male lambs of each treatment were harvested after feeding experiment to measure carcass characteristics and non-carcass components. Lambs fed with MA presented a larger (P<0.05) Longissimus lumborum muscle area. Nevertheless, there were no effects (P>0.05) of MA on daily average weight gain and non-carcass components weight. In conclusion, addition of 4 g DL-malic acid to a high-energy feed enhances muscle accretion, which improves carcass quality of finishing lambs. Key words: Malic acid, Animal performance, Carcass characteristics.

Received: 30/03/2017 Accepted: 08/05/2018

Meat production is the main purpose(1) of ovine farms in many regions of the world. While ovine meat quality can be improved under an intensive feed system utilizing high grain diets(2), feed costs and ruminal disorders, mainly acidosis, increase. It is necessary to search for alternative feeding strategies to enhance the energy efficiency of rations and prevent metabolic disorders. Studies on malic acid (MA) have reported its ability to stimulate lactate utilization by Selenomonas ruminantium(3), which can account for up to 51 % of the total viable bacterial count in rumen(4,5). MA has also been shown to cause increased pH(6), microbial protein(3) and total volatile fatty acid production(7). Increases in pH, total volatile acids and propionic acid had been observed utilizing ground corn and soluble starch to feed microorganisms in vitro(8) since the hydrogen is utilized to convert malic acid to propionate(9); decrease in hydrogen availability reduce the methane production(10). Results obtained with MA supplementation are not constant(11). The roughage and concentrate proportions in rations influence the success of this additive(12), with more favorable results being found with diets containing lower levels of forage(13) in which MA is naturally present(14,15). Limited in vivo research has been conducted to evaluate the effects of MA on ruminant performance(9,16). Therefore, researchers recommend further studies to test its effects on lamb performance(2). Regarding with the influence of MA on carcass characteristics, there is evidence of an increase of hot carcass yield due to a greater average daily gain with malic acid inclusion in the concentrate of cross male lambs(17), but, some authors have not found effect on carcass yield of heifers(18). The authors of this study are not aware of information relating to the effects of DL-malic acid on the productive performance and carcass characteristics of Pelibuey, a hair sheep breed (HSB).

461

Rev Mex Cienc Pecu 2019;10(2):460-472

The number of HSB has increased in several Latin American countries due to their ease of management and their resistance to parasites(19) and elevated environmental temperature and humidity. However, HSBs have presented lower daily gain and poorer meat quality than wool breeds(20). It should be noted that consumer demands for lean meats are increasing(21). The objective of this study was evaluate the effect of DL-malic acid addition in the concentrated finishing diet of Pelibuey male lambs on average daily gain, carcass characteristics and non-carcass components. Animal management procedures were conducted within the guidelines of locally approved techniques for animal use and care (NOM-051-ZOO-1995; humanitarian care of animals during mobilization of animals; NOM-062-ZOO-1995: technical specifications for the care and use of laboratory animals. Livestock farms, farms, centers of production, reproduction and breeding, zoos and exhibition hall must meet the basic principles of animal welfare; NOM-024-ZOO-1995; animal health stipulations and characteristics during transportation of animals. This experiment was conducted at a commercial Pelibuey farm called Los Limones, located in Nayarit, Mexico (21° 03' 48.11" N and 104° 31' 34.76" W). Sixteen (16) male lambs with a mean body weight of 27 ± 1.92 kg were used. Animals were divided randomly into two treatment groups of eight lambs each and placed in elevated pens with plastic slat flooring equipped with shade, feed and automatic waterers, with the two treatments comprising the addition of 4 g of DL-malic acid (MA) per kg of feed, and the control (the diet from the first treatment but without additive). The DL-Malic acid was purchased from the Sigma-Aldrich Chemical Company (St. Louis, MO, USA). Animals were fed ad libitum once daily at 0800 h. The first 7 d were used for adaptation to treatment followed by a 48 d trial. The composition and ingredients of the experimental diets are shown in Table 1. Basal diet was prepared weekly. Batch was divided in two parts, and MA was added to one part; mixing MA with 20 kg of feed followed by the incorporation with the rest of the feed.

462

Rev Mex Cienc Pecu 2019;10(2):460-472

Table 1: Ingredient and chemical composition of the experimental diets1 Ingredient, % Cracked corn Sorghum grain Canola meal Soybean meal Cane molasses Corn straw Minerals Calcium Sodium bicarbonate Grease DL-malic acid Chemical composition, % Dry matter Crude protein NE g, Mcal/kg NE m, Mcal/kg Crude fiber Neutral detergent fiber Acid detergent fiber Ether extract

Control2

MA2

12.48 53.05 9.82 4.91| 7.66 6.48 2.95 0.98 0.69 0.98 -

12.43 52.84 9.78 4.89 7.63 6.46 2.94 0.98 0.68 0.98 0.39

88.70 14.01 1.14 1.77 4.12 16.44 5.76 3.88

89.09 13.95 1.13 1.76 4.10 16.37 5.74 3.87

Expressed on a dry-matter basis. NE g = Net energy of gain.

NE m = Net energy of maintenance.

The daily feed allotments for each pen were adjusted to allow for minimal (<5 %) feed refusal at the feed bunk. Daily adjustments were undertaken to either increase or decrease daily feed delivery and weekly intake was recorded. One sample per week of the feed that had been offered to the animals was collected in order to determine dry matter content (DM, method 930,15) in accordance with the AOAC(22). Initial, weekly and final body weights were obtained after the animalsâ&#x20AC;&#x2122; morning meal using an electronic scale (TOR REY TIL/S:107-2691, TORREY electronics Inc, Houston TX, USA). Body weight gains were calculated by subtracting the previous weight from the current weight, while the average daily body weight gains were calculated by dividing body weight gain by the number of days that had passed since the last weighing. Four male lambs for each treatment were harvested in an ovine slaughterhouse (AsociaciĂłn de Ovinocultores del Centro de Nayarit) after feeding period. Hot carcass weight was recorded immediately after animals were slaughtered. The carcasses were 463

Rev Mex Cienc Pecu 2019;10(2):460-472

then covered with plastic to avoid cooling loss, and chilled for 24 h at -4 Â°C. Carcasses were ribbed between the 12th and 13th rib and back fat thickness measured with a metallic rule, with the Longissimus lumborum muscle then drawn on an acetate sheet in order to obtain the Longissimus muscle area (LMA) using a plastic grid. Data was analyzed using a completely randomized design. The significance of the differences (P<0.05) between treatment means were determined using the Student t-test for independent samples utilizing the SPSS software(23). The productive performance of finishing male lambs is shown in Table 2. In this study, lambs supplemented with DL-malic acid (MA) had similar (P>0.05) average daily gains, feed intake, feed efficiency and initial and final body weight compared to the nonsupplemented ones.

Table 2: Productive performance of finishing Pelibuey male lambs Variable Days of feed Male lambs, n Initial BW, kg Final BW, kg DMI, g/d ADG, g/d FE, g/g

Control1 48 8 27.80 38.25 983 218 0.233

MA 48 8 25.90 38.50 1022 263 0.247

SEM

P-value

1.92 0.94 64.75 58.05 0.6

0.69 0.75 0.69 0.87 0.89

Control = no malic acid supplementation. MA= 4 g of malic acid supplementation/kg of feed; SEM= Standard error of the mean. BW= Body weight, DMI= dry matter intake; ADG= average daily gain; FE= feed efficiency.

The influence of MA on the lambsâ&#x20AC;&#x2122; carcass characteristics is presented in Table 3. The addition of malic acid to male finishing diets did not alter (P>0.05) hot carcass weight, back fat thickness (FT), or dressing percentage. Longissimus muscle area (LMA) was significantly (P<0.01) larger in supplemented animals, while the MA did not affect noncarcass components (Table 4).

464

Rev Mex Cienc Pecu 2019;10(2):460-472

Table 3: Carcass characteristics of Pelibuey male finishing lambs Variable HCW, kg Dressing2, % LL area, cm2 Fat thickness, cm

Control1

SEM

P-value

21.5 56.2 11.8 0.105

21.3 55.3 13.0 0.125

0.67 0.81 0.42 0.03

0.87 0.23 0.002 0.67

Control = no malic acid supplementation. MA= 4 g of malic acid supplementation/kg of feed; SEM= standard error of the mean. HCW= hot carcass weight; LL= Longissimus lumborum muscle. 2 Dressing = (HCW/Final weight)*100.

Table 4: Non-carcass components of Pelibuey male finishing lambs Variable1 Skin Feet Heart Liver Lungs Spleen 1

Control2 11.04 2.15 0.48 2.25 1.99 0.30

MA 12.16 2.19 0.51 2.26 2.01 0.38

SEM 0.52 0.66 0.05 0.15 0.90 0.01

P-value 0.08 0.77 0.60 0.92 0.15 0.06

Weight of each non-carcass component is expressed as a percentage of final body weight. 2 Control = no malic acid supplementation. MA = 4 g of malic acid supplementation/kg of feed; SEM= Standard error of the mean.

Feed intake was similar for both groups 0.983 and 1.022 kg for the control and supplemented animals, respectively. Results of other authors show that malic acid does not alter the DMI of finishing lambs(2), lactating Pelibuey ewes(24), dairy goats(15), dairy cows(8,25,26), and feedlot cattle (27). Some authors mention that doses of MA lower than 2.6 % do not affect DMI(28). In this experiment, a 0.4 % MA level was evaluated because similar doses were used in previous research conducted with both the same(2,24) and different breeds of sheep(11). Average daily gains (ADG) observed with MA corresponded to the mean weight for Pelibuey lambs fed high energy diets(29,30). The null effect of MA on ADG in this experiment is in agreement with other reports on the MA supplementation of lambs(11;31) and bull calves(8) fed with a high concentrate diet. However, some studies have reported the positive effect of MA on the daily live weight gain of cattle fed with a high concentrate diet(16). Malate content varies with plant age (mature < early) and plant type (gramineous < legumes)(32). Therefore, a significant ADG increase was expected since lambs were fed with a high concentrate diet comprising only corn straw (which is low in malate content) as source of forage. Incorporation of DL-malate into soluble starch and cracked corn fermentations with mixed ruminal microorganisms have modify final pH, CH4, and

465

Rev Mex Cienc Pecu 2019;10(2):460-472

volatile fatty acids (VFA) in a manner analogous to ionophore effects(33). However, according to this experiment, as other factors such as days on feed may influence the effects of MA, not only the concentrate forage ratio or type of grain should be criteria for the positive effects of this additive on ADG. The degree to which MA effects ADG may depends on diet composition(11), in terms of grain type, dosage, chemical form (salt or free acid) or the productive stage of the animal(8). MA levels ranging from 0.6 to 1.1 % have enhanced the ADG of steers fed with high energy corn-based diets(34). Also, steer ADG have increased linearly as more DL-malate was added to high energy diets based on rolled corn(16). This study used a lower level of MA than 0.06 %(34), due to the favorable results obtained in a previous experiment on lactating Pelibuey ewes fed with a similar diet(24). It is likely that significant differences could be found by prolonging the feeding experiment because ADG differences among treatments tended to be higher the more feeding days passed. However, in the region of Mexico where this study was conducted, retail customers, looking for leaner carcasses, prefer animals with a final body weight (FBW) of between 35 and 40 kg. Hot carcass weight (HCW) and dressing percentage were not influenced by MA supplementation. Similarly, some researchers reported null effect of malate on HCW, cold carcass weight, and dressing percentage when it was added to a Merino lamb diet at 0.4 and 0.8 %(11). The MA supplementation of finishing male lambs increased (P=0.002) L. lumborum muscle area (LMA). Greater LMA is associated with higher yield and wholesale cuts of the carcass(35). Malate supplementation have increased nitrogen retention in sheep and steers(34). Higher muscle growth may be attributed to an increase of microbial protein production(3,36), or to the high availability of propionate converted from the added MA as it â&#x20AC;&#x2DC;sinksâ&#x20AC;&#x2122; H2 when reducing methanogenesis in rumen(7,37). Both high nitrogen and propionate levels in rumen could increase muscle size firstly by depositing more nitrogen directly into the tissue, and secondly through the higher level of alanine bioavailability produced by the propionate metabolism through gluconeogenesis(38). Moreover, higher amounts of propionate lead to the hypertrophy of intramuscular adipocites(39) and bovine muscle(40). The use of propionate, a primary precursor for gluconeogenesis as energy for production has been documented mainly for milk synthesis. A significant effect of MA has been found in the milk protein yield from early lactation Pelibuey ewes(24), early lactation dairy cows(28), and mid lactation dairy cows(25). This effect is attributed to an increase in microbial efficiency resulting from increased carbohydrate use for microbial N production(25). However, propionate could also be used for higher muscle gain, as proposed in this study. Furthermore, percentage corresponding to each tissue may vary considerably among carcasses of similar weight, depending on the breed and type of feed(41). Subcutaneous fat thickness (FT) was not different between treatments. It is likely that MA did not affect subcutaneous fat in Pelibuey sheep because hair sheep breeds deposit a small amount of subcutaneous fat(42) and, most importantly, because the animals were harvested young when the fat deposition in pre-formed subcutaneous adiposities is not

466

Rev Mex Cienc Pecu 2019;10(2):460-472

complete. In this case, higher amounts of ruminal propionate and, subsequently, glucose in the tissue does not result in the formation of higher levels of subcutaneous adiposities, as occurs with intramuscular adiposities(39). Typically, body fat increases as harvest weights increase(43,44). Thicker subcutaneous fat in Pelibuey lambs and a heavier final weight (>43 kg) have been reported(45). Smooth muscle growth was not affected by MA supplementation, with non-carcass components, expressed as a percentage of final body weight, similar for both treatments. These research results are in agreement with others authors, who found similar increases in total splanchnic tissue across the finishing phase that were consistent with similar rates of live and carcass gain observed in other studies(46). There is a negative relationship between carcass residues (organs and offals) and carcass yield(47). The weight of organs such as gastrointestinal tract and liver decrease during subnutrition periods(48). Therefore, bigger differences in nutrients intake would be necessary to influence the weight of organs. DL-malic acid supplementation (4 g per kilogram of feed) in finishing male Pelibuey lambs does not significantly improve average daily gain. While DL-malic acid supplementation does improve the Longissimus muscle area, it does not affect noncarcass components. Larger Longissimus muscle area could have a positive economic impact since it implies higher muscle proportion.

Acknowledgments

This work was financed by CONACyT (Consejo Nacional de Ciencia y Tecnologia) Project ď&#x20AC;Ł 147693.

Literature cited: 1.

KĂśnig EZ, Ojango JMK, Audho J, Mirkena T, Strandberg E, Okeyo AM, et al. Live weight, conformation, carcass traits and economic values of ram lambs of Red Maasai and Dorper sheep and their crosses. Trop Anim Health Prod 2017;(49):121129.

467

Rev Mex Cienc Pecu 2019;10(2):460-472

González-Momita MI, Kawas JR, García-Castillo R, González-Morteo C, AguirreOrtega J, Hernández-Vidal G, et al. Nutrient intake, digestibility, mastication and ruminal fermentation of Pelibuey lambs fed finishing diets with ionophore (monensin lasalocid) and sodium malate. Small Ruminant Res 2009;(83):1-6.

Evans J, Martin SA. Factors affecting lactate and malate utilization by Selenomonas ruminantium. Appl Environ Microbiol 1997;(63):4853-4858.

Caldwell DR, Bryant MP. Medium without rumen fluid for nonselective enumeration and isolation of rumen bacteria. Appl Microbiol 1966;(14):794-801.

Nisbet DJ, Martin SA. Effect of a Saccharomyces cerevisiae culture on lactate utilization by the ruminal bacterium Selenomonas ruminantium. J Anim Sci 1991;(69):4628-4633.

Callaway TR, Martin SA. Effects of organic acid and monensin treatment on in vitro mixed ruminal microorganism fermentation of cracked corn. J Anim Sci 1996;(74):1982-1989.

Kung LJr, Huber JT, Krummrey JD, Allison L, Cook RM. Influence of adding malic acid to dairy cattle rations on milk production, rumen volatile acids, digestibility, and nitrogen utilization. J Dairy Sci 1982;(65):1170-1174.

Khampa S, Wanapat M. Supplementation of urea level and malate in concentrate containing high cassava chip on rumen ecology and milk production in lactating cows. Pak J Nutr 2006;(5):530-535.

Castillo C, Benedito JL, Pereira V, Vazquez P, Lopez AM, Mendez J, et al. Malic acid supplementation in growing/finishing feedlot bull calves: Influence of chemical form on blood acid-base balance and productive performance. Anim Feed Sci Tech 2007;(135):222-235.

10. Sarkar S, Mohini M, Nampoothiri VM, Mondal G, Pandita S. Effect of tree leaves and malic acid supplementation to wheat straw based substrates on in vitro rumen fermentation parameters. Indian J Anim Nutr 2016;(33):421-426. 11. Carro MD, Ranilla MJ, Giraldez FJ, Mantecon AR. Effects of malate on diet digestibility, microbial protein synthesis, plasma metabolites, and performance of growing lambs fed a high-concentrate diet. J Anim Sci 2006;(84):405-410. 12. Sirohi SK, Pandey P, Sinhi B, Goel N, Mohini M. Effect of malic acid supplementation on rumen fermentation, digestibility and methanogenesis in wheat straw sorghum based total mixed diets in vitro. Indian J Anim Sci 2012;(82):10381045.

468

Rev Mex Cienc Pecu 2019;10(2):460-472

13. Foley PA, Kenny DA, Lovett DK, Callan JJ, Boland TM, O Mara FP. Effect of DLmalic acid supplementation on feed intake, methane emissions, and performance of lactating dairy cows at pasture. J Dairy Sci 2009;(92):3258-3264. 14. Muck RE, Wilson RK, O´Kiely P. Organic acid content of permanent pasture grasses. Irish J Agr Res 1991;(30):143-152. 15. Salama AAK, Caja G, Gardin D, Albanell E, Such X, Casals R. Effects of adding a mixture of malate and yeast culture (Saccharomyces cerevisiae) on milk production of Murciano-Granadina dairy goats. Anim Res 2002;(51):295-303. 16. Martin SA, Streeter MN, Nisbet DJ, Hill GM, Williams SE. Effects of DL- malate on ruminal metabolism and performance of cattle fed a high concentrate diet. J Anim Sci 1999;(77):1008-1015. 17. Díaz-Royón F, Arroyo JM, Alvir MR, Sánchez S, González J. Effects of protein protection with orthophosphoric or malic acids and heat on fattening lamb diets. Small Ruminant Res 2016;(134):58-61. 18. Carrasco C, Medel P, Fuentetaja A, Ranilla MJ, Carro MD. Effect of disodium/calcium malate or Saccharomyces cerevisiae supplementation on growth performance, carcass quality, ruminal fermentation products, and blood metabolites of heifers. J Anim Sci 2016;(94):4315-4325. 19. Avendaño-Reyes L, Macías-Cruz U, Álvarez-Valenzuela FD, Águila-Tepato E, Torrentera-Olivera NG, Soto-Navarro SA. Effects of zilpaterol hydrochloride on growth performance, carcass characteristics, and wholesale cut yield of hair-breed ewe lambs consuming feedlot diets under moderate environmental conditions. J Anim Sci 2011;(89):4188-4194. 20. Notter DR. Potential for hair sheep in the United Sates. J Anim Sci 2000;(77):1-8. 21. Dwyer CM, Lawrence AB, Bishop SC. The effects of selection for lean tissue content on maternal and neonatal lamb behaviors in Scottish Blackface sheep. Anim Sci 2001;(72):555-571. 22. AOAC. Official Methods of Analysis. 17th ed. Washington, DC, USA: Association of Official Analytical Chemists. 2000. 23. SPSS. Statistical Package for the Social Sciences for Windows (Version 20.0). Armonk, NY: IBM Corp. 2011. 24. Martínez-González S, Escalera-Valente F, Gómez-Danés AA, Plascencia A, LoyaOlguin JL, Ramírez–Ramírez JC, et al. Influence of levels of DL-malic acid

469

Rev Mex Cienc Pecu 2019;10(2):460-472

supplementation on milk production and composition in lactating Pelibuey ewes and pre-weaning weight gain of their suckling kids. J Appl Anim Res 2015;(43):92-96. 25. Sniffen CJ, Ballard CS, Carter MP, Cotanch KW, Dann HM, Grant RJ, et al. Effects of malic acid on microbial efficiency and metabolism in continuous culture of rumen contents and on performance of mid-lactation dairy cows. Anim Feed Sci Technol 2006;(127):13-31. 26. Khampa S. Effects of malate level and cassava hay in high-quality feed block on rumen ecology and digestibility of nutrients in lactating dairy cows raised under tropical condition. Int J Livest Prod 2009;(1):6-11. 27. Montaño MF, Chai W, Zinn-Ware TE, Zinn RA. Influence of malic acid supplementation on ruminal pH, lactic acid utilization, and digestive function in steers fed high-concentrate finishing diets. J Anim Sci 1999;(77):780-784. 28. Wang C, Liu Q, Yang WZ, Dong Q, Yang XM, He DC, et al. Effects of malic acid on feed intake, milk yield, milk components and metabolites in early lactation Holstein dairy cows. Livest Sci 2009;(124):182-188. 29. Macías-Cruz U, Álvarez-Valenzuela FD, Rodríguez-García J, Correa-Calderón A, Torrentera-Olivera NG, Molina-Ramírez L, et al. Crecimiento y características de canal en corderos Pelibuey puros y cruzados F1 con razas Dorper y Katahdin en confinamiento. Arch Med Vet 2010;(42):147-154. 30. Plata FX, Hernandez PA, Mendoza GD, Martínez JA. Efecto de una α amilasa (ec 3.2.1.1) en el patrón de consumo y eficiencia productiva de corderos alimentados con una dieta alta en concentrado. Arch Med Vet 2015;(47):161-166. 31. Aksu ED, Sahin T, Kaya I, Unal Y. Effects of supplementation with different amounts of malic acid to Tuj lambs diets on fattening performance, rumen parameters and digestibility. Rev Med Vet 2012;(2):70-75. 32. Callaway TR, Martin SA, Wampler JL, Hill NS, Hill GM. Malate content of forage varieties commonly fed to cattle. J Dairy Sci 1997;(80):1651-1655. 33. Martin SA. Manipulation of ruminal fermentation with organic acids: a review. J Anim Sci 1998;(76):3123-3132. 34. Sanson DW, Stallcup OT. Growth response and serum constituents of Holstein bulls fed malic acid. Nutr Rep Int 1984;(30):1261-1267. 35. Shackelford SD, Cundiff LV, Gregory KE, Koohmaraie M. Predicting beef carcass cutability. J Anim Sci 1995;(73):406–413.

470

Rev Mex Cienc Pecu 2019;10(2):460-472

36. Khampa S, Wanapat M, Wachirapakorn C, Nontaso N, Wattiaux MA, Rowlison P. Effect of Levels of Sodium DL-malate Supplementation on Ruminal Fermentation Efficiency of Concentrates Containing High Levels of Cassava Chip in Dairy Steers. Asian Australasian J Anim Sci 2006;(19):368–375. 37. Khampa S, Chaowarat P, Singhalert R, Wanapat M. Manipulation of rumen ecology by yeast and malate in dairy heifer. Pak J Nutr 2009;(8):787-791. 38. Ortigues I, Visseiche AL. Whole-body fuel selection in ruminants: nutrient supply and utilization by major tissues. P Nutr Soc 1995;(54):235–251. 39. Wan R, Du J, Ren L, Meng Q. Selective adipogenic effects of propionate on bovine intramuscular and subcutaneous preadipocytes. Meat Sci 2009;(82):372–378. 40. Hosseini A, Behrendt C, Regenhard P, Sauerwein H, Mielenz M. Differential effects of propionate or β-hydroxybutyrate on genes related to energy balance and insulin sensitivity in bovine white adipose tissue explants from a subcutaneous and a visceral depot. J Anim Physiol Anim Nutr (Berl) 2012;(96):570-580. 41. Ríos-Rincón FG, Bernal BH, Cerrillo SMA, Estrada AE, Juarez RAS, Obregon JF, et al. Carcass characteristics, primal cuts yields and tissue composition of Katahdin x Pelibuey lambs fed cull-chickpeas. Rev Mex Cienc Pecu 2012;(3):357-371. 42. Castellanos-Ruelas AF. Técnicas para estimar la composición corporal. En: Técnicas de Investigación en Rumiología. Primera ed. México DF. México. Consultores en producción animal. 1990:257-267. 43. Owens FN, Gill DR, Secrist DS, Coleman SW. Review of some aspects of growth and development of feedlot cattle. J Anim Sci 1995;(73):3152-3172. 44. Partida PJA, Martínez RL. Body composition in Pelibuey lambs in terms of feed energy concentration and slaughter weight. Vet México 2010;(41):177-190. 45. Ríos-Rincón FG, Estrada-Angulo A, Plascencia A, López-Soto MA, Castro-Pérez BI, Portillo-Loera JJ, et al. Influence of protein and energy level in finishing diets for feedlot hair lambs: growth performance, dietary energetics and carcass characteristics. Asian Austral J Anim Sci 2014;(27):55-61. 46. Hersom MJ, Krehbiel CR, Horn GW, Hersom MJ, Horn GW, Krehbiel CR, et al. Effect of live weight gain of steers during winter grazing: II. Viceral organ mass, cellularity, and oxygen consumption. J Anim Sci 2004;(82):184-197. 47. Ruiz-Ramos J, Chay-Canul AJ, Ku-Vera JC, Magaña-Monforte JG, GómezVázquez A, Cruz-Hernández A, et al. Carcass and non-carcass components of

471

Rev Mex Cienc Pecu 2019;10(2):460-472

pelibuey ewes subjected to three levels of metabolizable energy intake. Ecosistemas y Recursos Agropecuarios 2016;(3):21-31. 48. Martins SR, Chizzotti ML, Yamamoto SM, Rodrigues RTS, Busato KC, Silva TS. Carcass and non-carcass component yields of crossbred Boer and Brazilian semiarid indigenous goats subjected to different feeding levels. Trop Anim Health Prod 2014;(46):647-653.

472

https://doi.org/10.22319/rmcp.v10i2.4551 Technical note

Prediction of carcass characteristics of discarded Pelibuey ewes by ultrasound measurements

Alfonso J. Chay-Canula Juan José Pineda-Rodriguezab Jaime Olivares-Pérezb Francisco G. Ríos-Rincónc Ricardo García-Herreraa* Ángel T. Piñeiro-Vázquezd Fernando Casanova-Lugoe

Universidad Juárez Autónoma de Tabasco. División Académica de Ciencias Agropecuarias, Carretera Villahermosa-Teapa, km 25, R/A. La Huasteca 2ª Sección, Tel. (993) 358-1585, 142-9151. 86280, Villahermosa, Tabasco, México. b

Universidad Autónoma de Guerrero. Unidad Académica de Medicina Veterinaria y Zootecnia. Ciudad Altamirano, Guerrero, México. c

Universidad Autónoma de Sinaloa. Facultad de Medicina Veterinaria y Zootecnia, Culiacán, Sinaloa, México. d

Tecnológico Nacional de México. Instituto Tecnológico de Conkal. Conkal, Yucatán, México. e

Tecnológico Nacional de México. Instituto Tecnológico de la Zona Maya, Othón P. Blanco, Quintana Roo, México.

*Corresponding author: ricardogarciaherrera@hotmail.com

473

Rev Mex Cienc Pecu 2019;10(2):473-481

Abstract: The objective of present study was to predict the carcass characteristics of 28 discarded Pelibuey ewes (41.01 Âą 8.43 kg) using ultrasonography. The ultrasonic measurements of fat thickness (FT), area, (LDA), depth (DLD) and width (WLD) of the Longissimus dorsi, between the 12th and 13th thoracic vertebra and between the 3rd and 4th lumbar vertebra, were performed 24 h before slaughter. At the slaughter, hot carcass, internal organs and internal fat were weighed. The carcasses were divided in two half, refrigerated (1 Â°C; 24 h) and the chilled carcass were weighed. Then were dissected and weighed in the main tissues. With the data it was calculated the correlation coefficients between the variables and their relationships were estimated using regression models. It was observed that the ultrasonic measurements of thoracic and lumbar backfat thickness had a positive r2 that ranged from 0.51 to 0.66 (P<0.001) for prediction of the carcass weights; and an r2 from 0.44 to 0.57 (P<0.001) to predict the carcass muscle quantity. It is possible to use the measurements of ultrasound as a tool for the evaluation of carcass characteristics in discarded Pelibuey ewes and it is possible to predict the carcass weights and edible tissues. Key words: Backfat, Hair ewes, Regression, Longissimus dorsi area.

Received: 15/07/2017 Accepted: 30/04/2018

The sheep population in the States of Tabasco and Yucatan during the period of 2002 to 2011, increased by 37 and 95 %(1), respectively; both entities are located in the Southeastern region of Mexico and are characterised by tropical climate. In this region, the main breed used in mixed grazing systems due for their high prolificacy, good rusticity, resistance to parasites and great capacity of adaptation to various environmental conditions is the Pelibuey breed(1,2). In Mexico, the wide range of productive systems gives rise to seasonal fluctuations in the availability of sheep for the slaughter and causes a lot of irregularity in the type and condition of the animals that are produced, which is reflected in the quality of the final product; all this causes seasonal fluctuations with a strong irregularity in the offer of animals throughout the year, and leads to marked differences in their characteristics and conditions at the time of sale, since it provides the market with very varied, ranging from young lambs of specialized breeds to discarded animals with advanced in age and in very low-quality meat(3). To predict the carcass characteristics of animals in vivo, non-invasive techniques have been established that are preferred on the techniques that involve the destruction of the 474

Rev Mex Cienc Pecu 2019;10(2):473-481

carcass(4,5). In Pelibuey ewes, the ultrasound have been used for predict of the carcass characteristics(5), the body fat depots(6) and carcass energy content(7). Also, body measurements have been evaluated to the prediction of the carcass characteristics(8). On the other hand, cull or discarded ewes, with carcass weights ranging from 20 to 40 kg, are more difficult to market due to the low acceptability in the consumer market, which is related to a low price for sale due to the lack of commercial importance of this category. Moreover, studies related to the quality of the carcass and meat are scarce(9,10,11). As described above, the objective of this study was to predict the carcass characteristics of discarded Pelibuey ewes by ultrasonic measurement. The Pelibuey ewes were selected from one commercial flock in the “El Rodeo” farm, located at 17° 84 N, 92° 81 W; 10 m asl and 14 km from the road Villahermosa-Jalapa, Tabasco, Mexico; average of annual temperature of 28.2 °C, and annual rainfall of 2,299.5 mm(12). Twenty eight (28) 4-yr-old, non-pregnant and non-lactating, clinically healthy Pelibuey ewes with a mean of body weight (BW) of 41.01 ± 8.43 kg and body condition score (BCS) of 2.82 ± 1.29, were drawn from a commercial flock. The ewes were in confinement, in group pens in a roofed building with concrete floor and no walls. The diet offered consisted of 66 % forage and 34 % concentrate, with an estimated of metabolizable energy of 12 MJ/kg DM and 10% CP(13). The dietary ingredients were cereal grains (corn or sorghum), soybean meal, hay tropical grasses, vitamins, and minerals. The BCS was evaluated by two procedures using the technique of Russel et al(14). The animals were assigned according to their BCS in six groups: 1 (n= 4); 2 (n= 8); 2.5 (n= 3); 3 (n= 5); 4 (n= 5) and 5 (n= 3). The ultrasound measurements (USM) were taken 24 h before slaughter were determined using a real-time ultrasound equipment Aloka 500 B mode, with a 5 MHz linear probe. Ewes were shaved previously between the 12.th and 13.th thoracic vertebrae and the 3.rd and 4.th lumbar vertebrae regions according to what is described in the literature(5,6). The USM included the fat thickness (FT), area (LDA), depth (DLD) and width (WLD) of Longissimus dorsi in both thoracic and (TFT, TLDA, TLDD and TLDW) and the lumbar region (LFT, LLDA, LLDD and LLDW). The ewes were manually immobilized and acoustic gel was used to create good contact between the probe and the skin of ewes. The pressure over the transducer head was kept to a minimum to avoid compression of the subcutaneous fat(5,6). All measurements were taken on the left side of ewes. After capturing the scan image, the area of the muscle (TLDA and LLDA) and the fat thickness (TFT and LFT) in both regions were measured using the digital callipers of the equipment and the USM were recorded on all animals by the same operator as elsewhere described(5,6). Ewes were humanely slaughtered following the Mexican Official norms(15,16) established for the slaughtering and processing of meat animals. Before slaughter, shrunk BW (SBW) was measured after feed and water were withdrawn for 24 h. The limbs, pelt, head and all internal organs were separated. The data recorded at the slaughter were internal organs 475

Rev Mex Cienc Pecu 2019;10(2):473-481

and hot carcass weights. Internal fat (TIF, internal adipose tissue) was dissected, weighed and grouped as either pelvic (around kidneys and pelvic region) or omental and mesenteric fat. Subsequently, the carcasses were split at the level of the dorsal midline in two equal halves, weighed, and chilled at 6 °C for 24 h. After refrigeration, the left halfcarcass was completely dissected into subcutaneous and intermuscular fat (carcass fat, CF), muscle, bone plus cartilage and each component was weighed separately. Dissected tissues of the left carcass were adjusted as whole carcass. Correlation coefficients among variables were analysed by the PROC CORR procedure of SAS(17). Relationships between BW, BCS, USM and CEC were estimated by linear regression models using PROC REG(17). The STEPWISE option was used in the SELECTION statement for significant (P<0.05) variables to be included in the statistical models. The accuracy of the models was evaluated by the determination coefficient (r2) and the mean square error (MSE). The means (±SD), minimum and maximum values of BW, BCS, carcass characteristics and USM of adult Pelibuey ewes are shown in Table 1. The correlation coefficients (r) of USM in thoracic region (TFT, TLDA and TLDW) between CCW, carcass muscle (CM) and CF were all significant (P<0.01) with values that ranged from 0.37 to 0.76; nonetheless, the relations with CB were not significant (P>0.05). Also, a similar trend was observed for relation to lumbar USM and carcass, the r values ranged from 0.34 to 0.73.

Table 1: Descriptive analysis of the data on carcass characteristics and ultrasound measures of discarded Pelibuey ewes (n=28) Variable BW BCS HCW CCW CM CF CB TFT TLDA TLDD TLDW LFT LLDA LLDD LLDW

Description Body weight, kg Body condition score Hot carcass weight, kg Cold carcass weight, kg Carcass muscle, kg Carcass fat, kg Carcass bone, kg Thoracic fat thickness, mm Thoracic L. dorsi area, cm2 Thoracic L. dorsi depth, cm Thoracic L. dorsi width, cm Lumbar fat thickness, mm Lumbar L. dorsi area, cm2 Lumbar L. dorsi depth, cm Lumbar L. dorsi width, cm

Mean ± SD 41.01± 8.43 2.77± 1.22 19.65±5.14 18.86±4.99 10.80±2.05 4.25±2.81 3.82± 0.46 0.81±0.49 7.00±2.04 1.69± 0.36 5.14± 0.63 0.91±0.99 6.32±1.71 1.72± 0.33 5.09± 0.49

SE: standard deviation. 476

Minimum Maximum 29.80 59.80 1.00 5.00 13.42 31.48 12.68 30.52 8.33 15.44 0.68 10.62 3.18 5.27 0 1.80 4.09 12.95 1.10 2.77 3.64 5.94 0 5.50 3.79 9.56 1.20 2.67 4.02 5.75

Rev Mex Cienc Pecu 2019;10(2):473-481

For the prediction of both HCW and CCW (Equations 1 to 4) the equations obtained had an r2 that ranged from 0.51 to 0.66 (Table 2), in these models the TFT and LFT were included (P<0.05). Regression equations developed to predict the carcass muscle had an r2 that ranged from 0.44 to 0.57; the USM that were included in the models were the fat thickness (TFT and LFT). Also, for the relationship between CF and USM, as the intercept of this equation was not significant, we fitted linear regressions through the origin (Equations 7 and 8). For the prediction of the CB does not match any equation based on the USM.

Table 2: Regressions equations to predict the carcass traits using ultrasound measurements in discarded Pelibuey ewes (n =28) Eq. No 1 2

3 4

5 6

7 8

Equation Hot carcass weight (HCW): HCW (kg) = 13.54 (±1.34 ***)+ 7.50 (±1.42 ***)×TFT HCW (kg) = 13.35 (±1.16 ***)+ 5.22 (±1.42 ***)×TFT + 2.23 (±0.70**)×LFT Cold carcass weight (CCW): CCW (kg) = 12.94 (±1.12**)+ 7.26 (±1.38***)×TFT CCW (kg) = 12.75 (±1.30***)+ 5.01 (±1.37**)× TFT + 2.21 (±0.68**)×LFT Carcass muscle (CM): CM (kg)= 8.53 (±0.57***)+ 2.77 (±0.60 ***)×TFT CM (kg)= 8.46 (±0.51***)+ 1.90 (±0.63 **)×TFT + 0.85 (±0.31 *)×LFT Carcass fat (CF): CF (kg)= 4.99 (±0.36 ***)×TFT CF (kg)= 3.66 (±0.49***)×TFT + 1.22 (±0.35**)×LFT

CME RSD

0.51

13.24 3.63 <.0001

0.65

9.83 3.13 <.0001

0.52

12.50 3.53 <.0001

0.66

9.14 3.02 <.0001

0.44

2.41 1.55 0.0001

0.57

1.93 1.38 <.0001

0.87 0.91

3.41 1.84 <.0001 2.41 1.55 <.0001

R2= determination coefficient; MSE= mean square error; RSD= residual standard deviation; P= P-value; * P<0.05; **P<0.001; ***P<0.0001; ns= non-significant; HCW= hot carcass weight; CCW= cold carcass weight; CM= carcass muscle; CF= carcass fat; CB= carcass bone; TFT= thoracic fat thickness; LFT= lumbar fat thickness.

The real-time ultrasound is a noninvasive method that allows you to predict the body fat, the area and depth of the Longissimus dorsi muscle in sheep(5,18,19). On the other hand, Silva et al(20) indicate that the use of the ultrasound measurements provided good estimates of fat content and energy in the body of the sheep of two racial groups. A researcher group(21) reported that to include the BW and some USM is possible to predict the chemical composition of lambs. However, in the specialized literature the availability 477

Rev Mex Cienc Pecu 2019;10(2):473-481

of studies on the prediction of the composition and of the energy content of the carcass of sheep is limited(7,21). In Mexico, the Pelibuey breed is one of the most important maternal breeds in the tropical zone and it supports the production of sheep meat; in spite of this, the information about the prediction of the carcass characteristics of discarded Pelibuey ewes is very scarce in the scientific literature(5). Other authors(22) who evaluated Akkaraman sheep with a mean body weight of 42 kg, the value for TLDA was 8.86 cm2, as well as for TFT of 4.03 mm; the TLDA was higher than that recorded in the present study; also(5), reported for the TLDA and LLDA values of 7.06 and 6.81 cm2, respectively, which is consistent with the present study; moreover, they found values of 7.00 and 6.32 cm2 for TLDAT and LLDA, respectively. In the case of the TFT this value was higher in the order of the double for the values found in adult Pelibuey ewes. In Churra breed sheep with a mean body weight of 36 kg, reported average values in GT and GL of 0.38 and 0.44 mm, respectively(23); these values are lower than those found in the present study (0.81 and 0.91 mm for the TFT and LFT, respectively); in a recent study(5) reported average values of 1.91 and 1.99 mm for TFT and LFT respectively, these average values are higher than those recorded in the present study. On the other hand, it was indicated(22) that ultrasound measurements alone showed lower r2 values than that obtained when the BW was included as a variable in the equations. A similar situation was observed by Aguilar-Hernรกndez et al(5) and in same way in the present work. It was also reported(23) that use the BW and the TFT in multiple equations to predict the total fat in the carcass had a r2 of 0.88, which differs from that found by other authors(5) , who using the same variables in the equation had an r2 of 0.51 and the TFT was not significant in the model; a similar situation was observed in the present study, so that it was able to deduce that the inclusion of ultrasound measurements improve slightly (4 %) the prediction of this tissue (Equation 5). It was also pointed out(23) that the weight of the bone is highly associated with the BW of the sheep, and registering an r2 of 0.92; in this regard, other reserchers(5) reported in Pelibuey ewes that this relationship achieved a r2 of 0.22, which resembles the value obtained in Aragon lambs(24), in assessing this same relationship (r2= 0.19). In the present investigation it was observed that the BW alone predicts the weight of the bone with the r2 value of 0.41. In this sense, it was found that the measures by ultrasound in animals in vivo, were highly related to the measurements determined in the carcass, as well as conclude that these measurements can be used for the prediction of the carcass characteristics of the cull ewes(25); this is consistent with the results observed in the present work. Several authors conclude that the use of ultrasound is a valuable tool for the prediction of the carcass and body composition of the meat producer animals(20,26). It is possible to use the ultrasound measurements as a tool for carcass characteristics evaluation in discarded Pelibuey ewes and it is possible to predict the hot carcass weight and the protein and fat quantity in carcass. In this way, a higher value will be able to assign to the ovine carcass, depending on its yield and attributes, besides improve the

478

Rev Mex Cienc Pecu 2019;10(2):473-481

body condition in animals next to slaughter to improve their meat quality and to achieve a greater position in the commercial scale.

Conflicts of interest

The authors declare they have no conflicts of interest with regard to the work presented in this report.

Acknowledgments

To Dr. Jose Manuel Piña Gutiérrez who provided the facilities of Rancho “El Rodeo”. To the Programa para el Mejoramiento del Profesorado (PROMEP) for financial support to conduct this experiment (Project: UJAT- PTC-110): Body composition and energy reserves in hair ewes and its relationship with their reproductive activity.

Literature cited: 1.

Muñoz-Osorio GA, Aguilar-Caballero AJ, Sarmiento-Franco LA, Wurzinger M, Cámara-Sarmiento R. Technologies and strategies for improving hair lamb fattening systems in tropical regions: a review. Ecosist Rec Agrop 2016;3: 267-278.

Chay-Canul AJ, Magaña-Monforte JG, Chizzotti ML, Piñeiro-Vázquez AT, CanulSolís JR, Ayala-Burgos AJ, Ku-Vera JC, et al. Energy requirements of hair sheep in the tropical regions of Latin America. Review. Rev Mex Cien Pecu 2016:7:105-125.

Arbiza S, De Lucas J. Producción de carne ovina (Ovine meat production). México: Editores Mexicanos Unidos; 1996.

Scholz AM, Bünger L, Kongsro J, Baulain U, Mitchell AD. Non-invasive methods for the determination of body and carcass composition in livestock: dual-energy Xray absorptiometry, computed tomography, magnetic resonance imaging, and ultrasound: invited review. Animal 2015;9:1250-1264.

479

Rev Mex Cienc Pecu 2019;10(2):473-481

Aguilar-Hernández E, Chay-Canul AJ, Gómez-Vázquez A, Magaña-Monforte JG, Ríos FG, Cruz-Hernández A. Relationship of ultrasound measurements and carcass traits in Pelibuey ewes. J Anim Plant Sci 2016;26:325-330.

Chay-Canul AJ, Garcia-Herrera RA, Meza-Villalvazo VM, Gomez-Vazquez A, Cruz-Hernandez A, Magaña-Monforte JG, Ku-Vera JC. Body fat reserves and their relationship to ultrasound back fat measurements in Pelibuey ewes. Esosist Recur Agropec 2016;3:407-413.

Rodríguez-Valenzuela E, Salazar-Cuytun R., García-Herrera RA, Piñeiro-Vázquez ÁT, Casanova-Lugo F, Velázquez-Martínez JR, Herrera-Camacho J, et al. Prediction of carcass energy content in Pelibuey ewes by ultrasound measurements. Ecosist Rec Agrop 2017 [in press].

Bautista-Díaz E, Salazar-Cuytun ER, Chay-Canul AJ, García-Herrera RA, PiñeiroVázquez AT, Magaña-Monforte JG, Tedeschi LO, et al. Determination of carcass traits in Pelibuey ewes using biometric measurements. Small Ruminant Res 2017;147:115–119.

Civit D, Díaz MD, Rodríguez E, González CA. Características de la canal y efecto de la maduración sobre la calidad de la carne de ovejas de desvieje de raza Corriedale. ITEA, 2014;110(2):160-170.

10. Cacere RAS, Morais MG, Alves FV, Feijó GLD, Ítavo CCBF, Ítavo LCV, Ribeiro CB. Quantitative and qualitative carcass characteristics of feedlot ewes subjected to increasing levels of concentrate in the diet. Arq Bras Med Vet Zootec 2014;66:16011610. 11. Ruiz-Ramos J, Chay-Canul, AJ, Ku-Vera JC, Magaña-Monforte JG, GómezVázquez A, Cruz-Hernández A, Gonzalez-Garduño R, et al. Carcass and non-carcass components of Pelibuey ewes subjected to three levels of metabolizable energy intake. Ecosist Rec Agrop 2016;3:21-31. 12. COMISIÓN NACIONAL DEL AGUA (CONAGUA). http://www.conagua. gob.mx/. Consultado 26 May, 2016. 13. AFRC. Energy and protein requirements of ruminants. Agricultural and Food Research Council. CAB International, Wallingford, UK. 1993. 14. Russel A, Doney J, Gunn R. Subjective assessment of body fat in live sheep. J Agric Sci (Cambridge) 1969;72:451-454. 15. Norma Oficial Mexicana. NOM-009-ZOO-1994. Proceso sanitario de la carne. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. Diario Oficial de la Federación: 31/07/2007. México, DF. 16. Norma Oficial Mexicana. NOM-033-SAG/ZOO. Métodos para dar muerte a los animales domésticos y silvestres. Secretaría de Agricultura, Ganadería, Desarrollo 480

Rev Mex Cienc Pecu 2019;10(2):473-481

Rural, Pesca y Alimentación. Diario Oficial de la Federación: 26/08/2015. México, DF. 17. SAS. Institute Inc., SAS/STAT. Software, Ver. 9.00, Cary, NC27512-8000. USA. 2002. 18. Silva SR, Afonso JJ, Santos VA, Monteiro A, Guedes CM, Azevedo JMT, Dias-daSilva A. In vivo estimation of sheep carcass composition using real-time ultrasound with two probes of 5 and 7.5 MHz and image analysis. J Anim Sci 2006;84(12):34333439. 19. Ripoll G, Joy M, Alvarez-Rodriguez J, Sanz A, Teixeira A. Estimation of light lamb carcass composition by in vivo real-time ultrasonography at four anatomical locations. J Anim Sci 2009;87(4):1455–1463. 20. Silva SR, Afonso J, Guedes CM, Gomes MJ, Santos VA, Azevedo JMT, Dias-daSilva A. Ewe whole body composition predicted in vivo by real-time ultrasonography and image analysis. Small Ruminant Res 2016;136:173-178. 21. Silva SR, Gomes MJ, Dias-da-Silva A, Gil LF, Azevedo JMT. Estimation in vivo of the body and carcass chemical composition of growing lambs by real-time ultrasonography. J Anim Sci 2005;83:350–357. 22. Sahin EH, Yardimci M, Cetingu IS, Bayram I, Sengor E. The use of ultrasound to predict the carcass composition of live Akkaraman lambs. Meat Sci 2008;79:716721. 23. Teixeira A, Matos S, Rodrigues S, Delfa, R., Cadavez V. In vivo estimation of lamb carcass composition by real-time ultrasonography. Meat Sci 2006;74:289-295. 24. Delfa R, Teixeira A, Gonzalez C, Blasco I. Ultrasonic estimates of fat thickness and longissimus dorsi muscle depth for predicting carcass composition of live Aragon lambs. Small Ruminant Res 1995;16(2):159-164. 25. Pinheiro RSB, Jorge AM, Yokoo MJ. Correlações entre medidas determinadas in vivo por ultrassom e na carcaça de ovelhas de descarte. Rev Bras Zootec 2010;39(6):1161-1167. 26. Silva SR. Use of ultrasonographic examination for in vivo evaluation of body composition and for prediction of carcass quality of sheep. Small Ruminant Res 2017;152(2):144-157.

481

https://doi.org/10.22319/rmcp.v10i2.4759 Technical note

Genome association with Cooperia punctata resistance in crossbreed cattle in the sub-humid tropics of Mexico

Adriana García-Ruíz a Felipe de Jesús Ruíz-López a Miguel Alonso-Díaz b Elke Von-Son-de-Fernex b Sara Olazarán-Jenkins c Vicente Eliezer Vega-Murillo d Maria Eugenia López-Arellano e*

Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias (INIFAP). Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal. Ajuchitlán, Querétaro. b

Universidad Nacional Autónoma de México (UNAM). Centro de Enseñanza, Investigación y Extensión en Ganadería Tropical. Martínez de la Torre, Veracruz. México. c

INIFAP. Sitio Experimental las Margaritas, Hueytamalco, Puebla. México.

INIFAP. Campo Experimental La Posta, Paso del Toro, Veracruz. México.

INIFAP. Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad. Jiutepec, Morelos. México.

*Corresponding author: mlopez.arellano@gmail.com

Abstract: This study is an evaluation of resistance to natural infection by Cooperia spp. in Zebu x Holstein crossbreed calves in the tropics. Fourteen four-month-old calves were dewormed and moved to pastures naturally infested with gastrointestinal nematodes under sub-humid tropical conditions. Fecal samples were collected from each animal every seven days for three months to quantify the number of eggs per gram of feces 482

Rev Mex Cienc Pecu 2019;10(2):482-489

(EPG), and nematode species identified with end-point PCR. Hair samples were collected for genotyping using the GeneSeek Genomic Profiler HD-V3 panel, which contains 139,376 SNP markers. Variation in EPG per individual ranged from a minimum of 7+7 to a maximum of 4,657+1,886 EPG. The PCR identified breed differences between the Zebu x Holstein crossbreeds. Genome-wide association studies detected five statistically significant haplotypes (P<0.001). The haplotype in chromosome 2 includes four markers, that in chromosome 10 includes three, that in chromosome 15 includes two, that in chromosome 23 includes four and chromosome X includes three. Of these regions only chromosome 23 was found to be associated with parasite resistance, measured as EPG phenotypes. The remaining chromosomes exhibited no association in the studied animals. These regions could be sequenced and tested for gene expression against Cooperia and other gastrointestinal nematodes. Key words: SNP markers, Genomic association studies, Nematode resistance, Crossbreed calves.

Received: 30/01/2018 Accepted: 08/05/2018

Gastrointestinal (GI) nematode infection in young cattle is one of the main health problems affecting livestock under grazing conditions in tropical climates(1). The Cooperia species are GI parasites which negatively affect growth and productivity in cattle by compromising small intestine function(2). Several mechanisms have been studied to combat Cooperia infection, including pharmaceuticals and genetic resistance(3). Availability of high density DNA marker panels for single nucleotide polymorphisms (SNP) has made it possible to map the loci of traits of commercial interest and thus increase the presence of desirable genes in a population. Haplotypes are regions of the genome (comprising between 100 and 150 base pairs) that are jointly inherited in a specific population and may have significant effects on genes located within a region of the chromosome(4). Genome-wide association studies (GWAS) allow identification of these regions in genetic material. Recently, genome regions have been identified that indicate resistance to disease and parasites(5). The present study objective was to identify regions of the genome associated with parasite load (number of eggs per gram of feces) of Cooperia species in crossbreed cattle (Zebu x Holstein and vice versa) in a grazing system in the tropics of Mexico. The study was carried out in the Center for Education, Research and Extension in Tropical Livestock (Centro de Enseñanza, Investigación y Extensión en Ganadería Tropical - CEIEGT), of the Faculty of Veterinary Medicine and Zootechnic, National Autonomous University of Mexico, located in the municipality of Tlapacoyan, in the state of Veracruz, Mexico. Study area altitude is 112 m asl. Its climate is warm humid, 483

Rev Mex Cienc Pecu 2019;10(2):482-489

with rains year round and no defined dry season (Af(m) w”(e)(6), an average temperature of 23.5 ± 0.5 °C, and average annual rainfall of 1,991 mm ± 392 mm. Gastrointestinal (GI) nematode prevalence in the area exceeds 75% year round(7). The experimental animals were fourteen crossbreed calves (¾ Zebu x ¼ Holstein [n = 6] and ¼ Zebu x ¾ Holstein [n = 8]), four months of age in a grazing system. Prior to weaning, both calves and mothers were treated with 7.5 mg Levamisole by intramuscular injection to eliminate any possible GI nematode contamination. All animals were naturally infected with Cooperia punctata (L3) infectious larvae (confirmed by end-point PCR as a dominant genus) by ingestion. The first record of eggs per gram of feces (EPG) was taken 21 days after infection by grazing was initiated, and then continued every seven days for three months. Eggs counts were done following the McMaster technique. Samples were collected directly from the rectum to prevent contamination and processed immediately. Average EPG was calculated during sampling, and the results included in a cases and controls study, considering cases to be animals exhibiting a >200 EPG(8,9). Infection level was classified by EPG counts for parasitic nematodes (Table 1). Blood samples were taken to measure the percentage of the package cell volume (PCV), using 24% as the level for a non-anemic individual(9). Levels for PCV were measured using a 22 + 1.6% minimum and a 28 + 3.3% maximum. It is important to mention that the Cooperia genus exhibits tissue-feeding habits and thus does not directly affect PCV percentage. This genus was prevalent throughout the three-months study period, meaning that PCV low percentage was a response to animal nutritional status; this was how six individuals were identified as resilient.

484

Rev Mex Cienc Pecu 2019;10(2):482-489

Table 1: Selection of resistant, susceptible and resilient calves vis-a-vis Cooperia punctata based on eggs per gram of feces (EPG) and package cell volume (PCV) percentage ID 62 58 61 57 55 56 51 67 65 63 59 53 54 64 X ± SE

EPG Mean ± SE 7±7 164 ± 89 200 ± 107 178 ± 154 86 ± 291 650 ± 291 557 ± 291 607 ± 165 764 ± 283 1193 ± 636 1221 ± 558 1378 ± 291 3100 ± 291 4657 ± 1886 1055 ± 1155

PCV (%) Mean ± SE 24 ± 2.2 24 ± 1.1 26 ± 2.2 23 ± 2.8 22 ± 0.7 28 ± 1.7 24 ± 3.3 22 ± 1.5 23 ± 1.5 25 ± 3.3 25 ± 0.8 26 ± 2.7 22 ± 2.3 23 ± 2.1 24 ± 2.0

C RR RR RR RR Rs Rs Rs Rs Rs Rs SS SS SS SS

ID= individual identification; SE= standard error; C= individual phenotype classification; RR= resistant; Rs= resilient; SS= susceptible.

Hair samples including the follicle were taken from all animals for DNA isolation. These were then genotyped using the GeneSeek Genomic Profiler HD-V3 platform, which contains 139,376 SNP. A genotype quality control analysis was run, eliminating markers with a call rate <0.90, an allele frequency <0.05 and a Hardy-Weinberg equilibrium value of P<0.001. After quality control, 120,405 SNP were included in identification of 3,054 haplotypes. As a correction for the effect of source breed, principal component analyses (PCA) were done and included as an adjustment factor in the association analyses. The GWAS were implemented with a logistic regression model, corrected using the Bonferroni test and the false discovery rate. All genomic analyses were run with the SVS-Golden Helix ver. 8.6 software(10). Molecular identification of the GI nematode genera showed Cooperia to be the dominant genus in the region, since no other genera were identified during the threemonths follow-up. Individual infection level ranged from a minimum of 7 ± 7 to a maximum of 4,657 ± 1,886 (Table 1). The PCA showed that differences in animal breed composition could be identified (Figure 1), with those having more Zebu genes to the left and those with more Holstein genes to the right.

485

Rev Mex Cienc Pecu 2019;10(2):482-489

Figure 1: Principal components analysis (PCA) of studied animals and grouping by breed composition

Some breeds, crosses or specific populations exhibit genetic predispositions for some traits and/or diseases(11). However, no such tendencies were found to be associated with the presence of Cooperia cases and controls by crossing (Figure 2).

Figure 2: Cooperia cases and controls distribution in studied animals

486

Rev Mex Cienc Pecu 2019;10(2):482-489

The GWAS identified five significant haplotypes (Pâ&#x2030;¤0.001; Figure 3). Chromosome 2 includes four markers (BTA-55603-no-rs, BovineHD4100001149, BovineHD0200010866 and BovineHD0200010867); chromosome 10 includes three (BovineHD1000009272, ARS-BFGL-NGS-44351 and BovineHD10000 30584); chromosome 15 includes two (ARS-BFGL-NGS-18481 and ARS-BFGL-NGS-103542); chromosome 23 includes four (BovineHD2300011368, BovineHD2300011369, BovineHD2300011370 and BovineHD2300011371); and chromosome X includes three (BovineHD3000031659, BovineHD3000031667 and BovineHD3000031676).

Figure 3: Manhattan graph of association analysis of haplotypes identified in Cooperia cases and controls study. Chromosome X is indicated as chromosome 30

Due to the limited number of genomic association studies to disease resistance, there are few annotations in the genome for references. Of the significant regions found in the present study for chromosomes 2, 10, 15 and X, no genes were identified that could be related to the found regions (results verified in NCBI database)(12). Only the significant region of chromosome 23 has a previous report associated with the infection rate for trypanosome in N'Dama and Boran cattle in West a protozoan parasite in Africa(13). Since most of the identified regions are not associated with EPG traits, nor specifically with Cooperia, they might be candidates for sequencing and testing the existence of genes for resistance to this nematode and other GI parasites. In conclusion, despite of the low number of calves included in the present study, the results suggest existence of SNP associated with nematode resistance, mainly on chromosome 23. However, more data is required to define this relationship. Study of the host/parasite interaction implies greater knowledge of the diversity of immune evasion mechanisms, and anthelmintic detoxification in nematodes. The present contribution to 487

Rev Mex Cienc Pecu 2019;10(2):482-489

understanding the factors associated with the host genome and Cooperia punctata infection processes suggests that in the future, mechanisms may be found that make feasible the use of markers associated with nematodes in cattle under grazing conditions in the tropics.

Acknowledgements

The research reported here was financed by Proyecto Fiscal INIFAP No. 16573433030. Thanks are due the CEIEGT, FMVZ-UNAM for their support.

Literature cited: 1.

Borges FA, Almeida GD, Heckler RP, Lemes RT, Onizuka MKV, Borges, DGL. Anthelmintic resistance impact on tropical beef cattle productivity: effect on weight gain of weaned calves. Trop Anim Health Prod 2013;45:723‐727.

Stromberg BE, Gasbarre LC, Waite A, Bechtol DT, Brown MS, Robinson NA, Newcomb H. Cooperia punctata: Effect on cattle productivity? Vet Parasitol 2013;183(3–4):284–291.

Geary TG, Hosking BC, Skuce PJ, von Samson-Himmelstijerna G, Maeder S, Holdsworth P, Pomroy W, Vercruysse J. World Association for the Advancement of Veterinary Parasitology (W.A.A.V.P.) Guideline: Anthelmintic combination products targeting nematode infections of ruminants and horses. Vet Parasitol 2012;190:306-316.

Fritz S, Capitan A, Djari A, Rodriguez SC, Barbat A. Detection of haplotypes associated with prenatal death in dairy cattle and identification of deleterious mutations in GART, SHBG and SLC37A2. PLoS ONE 2013;8(6):e65550.

Coppieters W, Mes TH, Druet T, Farnir F, Tamma N, Schrooten C, Ploeger HW. Mapping QTL influencing gastrointestinal nematode burden in Dutch HolsteinFriesian dairy cattle. BMC Genomics 2009;10(1):96.

488

Rev Mex Cienc Pecu 2019;10(2):482-489

García E. Modificaciones al Sistema de Clasificación Climática de Köppen. 3a. ed. Instituto de Geografía. UNAM. México. D.F. 1981.

Alonso-Díaz MA, Arnaud-Ochoa RA, Becerra-Nava R, Torres-Acosta JFJ, Rodriguez-Vivas RI, Quiroz-Romero RH. Frequency of cattle farms with ivermectin resistant gastrointestinal nematodes in Veracruz, Mexico. Vet Parasitol 2015;212:439-443.

Coles GC, Bauer C, Borgsteede FHM, Geerts S, Klei TR, Taylor MA, Waller P, World Association for the Advancement of Veterinary Parasitology (W.A.A.V.P.) methods for the detection of anthelmintic resistance in nematodes of veterinary importance. Vet Parasitol 1992;44:35-44.

Encalada-Mena L, Tuyub-Solis H, Liébano-Hernández E, Ramirez-Vargas G, Mendoza-de-Gives P, Aguilar-Marcelino L, López-Arellano ME. Phenotype and genotype traits of gastrointestinal nematodes resistant to benzimidazole in infected calves from tropical regions of Campeche State, Mexico. Vet Parasitol 2014;205:246-254.

10. Golden Helix Inc. SNP & Variation Suite Manual Version 8.6.0 Copyright © 20002016 Golden Helix, Inc. 2016. 11. Zhang H, Wang Z, Wang S, Li H. Progress of genome wide association study in domestic animals. J Anim Sci Biotech 2012;3:26. 12. National Center for Biotechnology Information.

https://www.ncbi.nml.nih.gov

Accessed Jul 15, 2017. 13. Gelhaus A, Horstmann R, Teale A. Mapping of quantitative trait loci controlling trypanotolerance in a cross of tolerant West African N’Dama and susceptible East African Boran cattle. Proc Nat Acad Sci USA 2003;100(13):74.

489

https://doi.org/10.22319/rmcp.v10i2.4370 Technical note

Similarity in plant species consumed by goat flocks in the tropical dry forest of the Cañada, Oaxaca Salvador Mandujano a* Ariana Barrera-Salazar a Antonio Vergara-Castrejón b a

Instituto de Ecología A.C. Red Biología y Conservación de Vertebrados, km 2.5 Carretera Antigua Coatepec No. 351, Congregación del Haya, Xalapa 91070, Veracruz, México. b

Benemérita Universidad Autónoma de Puebla. Escuela de Ingeniería Agrohidráulica, Unidad Chiautla de Tapa. Puebla, México.

* Corresponding author: salvador.mandujano@inecol.mx

Abstract: Management of goats (Capra hircus) in extensive systems is a common practice in the Tehuacán-Cuicatlán Biosphere Reserve (TCBR), Mexico. This study analyzes the similarity in plant consumed by goat flocks in landscape at the Cañada region, Oaxaca. Eight (8) flocks were sampled in different locations during the 2012 rainy season and 2013 dry season. To determine spatial and temporal similarity among the flocks, depending upon the consumed plant species, it was used hierarchical agglomerative clustering methods in the R program. The goats consumed a total of 84 plant species, of which 30 constituted 75 % of the diet. According to the similarity analysis, Mimosa sp. and Acacia cochiliacantha were the species consumed by all flocks in both seasons; while Eleusine indica, Prosopis leavigata and Opuntia sp. were the next most important, depending on the season. The Tecomavaca herd showed lower similarity than the other flocks. The results of the present study contribute to furthering the knowledge regarding the foraging habits of goats in tropical dry regions where the seasonality of the resources is very contrasting. Key words: Capra hircus, Extensive systems, Multivariate methods, Tehuacán-Cuicatlán Biosphere Reserve.

490

Rev Mex Cienc Pecu 2019;10(2):490-505

Received: 18/02/2017 Accepted: 23/03/2018

In Mexico, goats represent an important source of protein(1,2). For example, the national census of 2011 estimated a population of 9 million goats(3). Management of goats is a particularly widespread practice in the state of Puebla(4,5), but it is less developed in Oaxaca(6). The Tehuacán-Cuicatlán Biosphere Reserve (TCBR) in the states of Puebla and Oaxaca in central Mexico is characterized by high biodiversity of species and endemism(7). Within the Tehuacán-Cuicatlán Valley, there are estimated to be around 5,000 goat farmers(8), who mainly practice subsistence farming(9). The goats have been present since their introduction during the colonial period and currently represent one of the main productive activities in many villages in and around the TCBR(4). In common with other arid and semi-arid regions(2,3), the extensive system is the main practice in the TCBR. This is based on leading the herds along fixed or migratory routes to browse on the hills, roadsides and riparian areas(4). Considering that the TCBR is a natural protected area, it is important to evaluate the influence of goats on the vegetation structure(2,10,11) and identify possible competitive interactions with wild ungulates such as the white-tailed deer Odocoileus virginianus(12). In this context, this study analyzes the similarity in plant consumed by goat herds in landscape at the Cañada region, Oaxaca, using hierarchical agglomerative clustering methods. To determine similarities among the herds in terms of the plant species consumed, in this study were used hierarchical agglomerative clustering methods through multivariate cluster analyses(13). The objective of clustering is to recognize discontinuous subsets in an environment that is sometimes discrete and most often perceived as continuous in ecology(14). Specifically, clustering consists of partitioning the collection of objects under study. For this propose several similarity indices, as for example Sorensen, Jaccard and Morisita, had been employed for computing similarity or dissimilarity among pairwise collection objects. Clustering methods, as for example, single linkage, complete-linkage, average agglomerative and Ward's minimum variance, are employed to agglomerate objects on basis of pairwise distance given the similarities or dissimilarities, depending on each case(13). To interpret and compare the hierarchical clustering results, cophenetic correlation distances were calculated for each clustering. Briefly, the cophenetic index between two objects in a dendogram is the distance at which the objects become members of the same group. The interpretation of this index is similar to the Pearson’s r correlation coefficient(14). Therefore, to test the hypothesis of the present study, hierarchical agglomerative clustering methods were employed. The study was conducted at the region of the Cañada in Oaxaca, within the TehuacánCuicatlán Biosphere Reserve (TCBR) in Mexico (Figure 1). The TCBR is locate in the extreme southeast of the state of Puebla and northeast of Oaxaca, between 17° 39' - 18° 53' 491

Rev Mex Cienc Pecu 2019;10(2):490-505

N and 96° 55' - 97° 44' W. It is 490,187 ha in area and the altitude ranges from 600 to 2,950 m asl. Annual mean temperature ranges from 18 and 22 °C, while the annual precipitation varies between 250 and 500 mm(15). The main vegetation types in the region are: crassicaule scrub dominated by columnar cacti of the genus Neobuxbaumia (8 % of the reserve territory) and rosetophyllous scrub (10 %), mostly in the northern area of the TCBR; while tropical dry forest (29 %) dominate mainly in the Cañada region; oak and pine forest in the upper mountains (21 %); as well as other vegetation types (10 %). Land use is mostly for agriculture, livestock and forestry (22 %)(15). Figure 1: Geographic location of the eight studied sites at La Cañada in the TehuacánCuicatlán Biosphere Reserve, Mexico. Sites: Casa Blanca (1), Coxcatlán (2), Teotitlán (3), Toxpalan (4), Los Cues (5), Tecomavaca (6), Cuicatlán (7) and Chicozapotes (8)

The study was conducted in eight locations: Coxcatlán state of Puebla, and Casa Blanca, Teotitlán, Toxpalan, Los Cues, Tecomavaca, Cuicatlán and Chicozapotes state of Oaxaca (Figure 1). At each location, it was follow the same flock once during the rainy season (September to November 2012) and once again in the dry season (April to June 2013). The selection of these flocks depended on the interest of the goat farmers in participating in the study. Traditionally, the extensive system consists of moving the flock daily to foraging sites along predefined routes. In addition, the flock size and total foraging time depends upon the owner’s experience, among other factors(16). In the studies sites, the mean herd size and forage time were 70 goats and 4.2 h, respectively. 492

Rev Mex Cienc Pecu 2019;10(2):490-505

To determine the main plants consumed by the goats, the animals were directly observed during foraging(17). The selection of these herds depended on the interest of the goatherds in participating in the study. In the study site, the goat farmers move their animals to forage outside the villages almost every day. The goats are therefore accustomed to the presence of people, which eliminates the possibility of bias during observation of foraging activities(18). Every 20 min, a different focal animal was selected and the number of plants of each species consumed was recorded over a period of 10 min. For each flock, it was recorded the number of plants species consumed per the flock during both the rainy and dry seasons, was recorded(18,19). The number of focal animals varied depending of the travel time of the sampled flock (n= 57 and 58 goats for rainy and dry seasons, respectively). Simultaneously, there were collected plants for taxonomic determination in the herbarium strata and by other sources(20). However, the rugged topography, dense vegetation and speed of movement by the goats made it impossible to collect all plants consumed. Individually observed goats cannot be true replicates as they do not take grazing decisions independently from one another(21). Therefore, the information was grouped considering flock as replicate. It was calculated the cumulative curve of the number of species consumed by the goats during the rainy and dry seasons. A relatively arbitrary shortcut of 75 % was employed to determine the principal plant species and was used a Chi-square test to evaluate differences between seasons(22). To determine similarities among the eight flocks in terms of the plant species consumed, hierarchical agglomerative clustering methods were used through multivariate cluster analyses(23). For this purpose, the species that represented 75 % of the total consumed plants was employed for clustering the flocks. This shortcut percent is subjective but represents the point where the cumulative curve of the relationship between number of species consumed species, begins to reach the asymptote. Analyses were performed separately for each season. The Horn-Morisita similarity index was selected for the number of plants consumed by species in this study. Four clustering methods were calculated: single linkage, completelinkage, average agglomerative (UPGMA) and Ward's minimum variance(23). To examine the species content of the clusters depending on group memberships, it was used the vegan R package(23). This package provides tools for descriptive community ecology. Specifically, it has the most basic functions of diversity analysis, community ordination and dissimilarity analysis. Finally, the results of these analyses are presented as a heat map of the doubly ordered table of the consumed plants, with a dendrogram of cluster sites. All analyses in this study were performed in R version 3.2.3(24). The goats consumed 82 and 65 species during the rainy and dry season, respectively (Table 1). However, according to the cumulative curve, 75 % of the diet was constituted by 30 species: 24 species during the rainy season and 20 species in the dry season (Figure 2). The main species in both seasons were Mimosa sp., Acacia cochiliacantha and Eleusine indica; during the rainy season was Dalea carthagenensis; while in the dry season were Prosopis 493

Rev Mex Cienc Pecu 2019;10(2):490-505

leavigata, Opuntia sp. and Ceiba parvifolia, which differed significantly (Figure 3; P= 0.0001).

Table 1: List of plant species consumed by goats during the rainy and dry seasons at La CaĂąada, Oaxaca Rainy season

Dry season

Plant species

Abbreviation

Number of plants % *

Number of plants %

Eleusine indica Mimosa sp.1 Acacia cochliacantha Dalea carthagenensis Agrostis stolonifera Viguiera dentata Cordia curassavica Eysenhardthia polystachya Senna wislizeni Aegopogon sp. Opuntia sp. Ceiba parvifolia Waltheria indica Amphipterygium adstringens Lippia graveolens nd Phragmites australis Parkinsonia praecox Prosopis leavigata Ziziphus pedunculata Bursera linanoe Glycyrrhiza glabra nd Bursera sp. Sanvitalia procumbens nd Cyrtocarpa procera Leucaena diversifolia nd

Elin Misp Acco Daca Agst Vide Cocu Eypo Sewi Aesp Opsp Cepa Wain Amad Ligr nd Phau Papr Prle Zipe Buli Glgl nd Busp Sapr nd Crpr Ledi nd Mame

56 51 49 27 21 16 16 14 14 13 13 12 12 9 8 8 8 7 7 7 7 7 6 6 5 5 5 5 5 4

28 50 61 10 10 18 5 8 10 16 24 22 14 3 2 16 43 11 2 2 5 6 4 12 6 -

494

8.6 7.8 7.5 4.2 3.2 2.5 2.5 2.2 2.2 2.0 2.0 1.8 1.8 1.4 1.2 1.2 1.2 1.1 1.1 1.1 1.1 1.1 0.9 0.9 0.8 0.8 0.8 0.8 0.8 0.6

5.4 9.6 11.7 1.9 1.9 3.4 1.0 1.5 1.9 3.1 4.6 4.2 2.7 0.6 0.4 3.1 8.2 2.1 0.4 0.4 1.0 1.1 0.8 2.3 1.1 -

Rev Mex Cienc Pecu 2019;10(2):490-505

Malpighia mexicana Ipomoea sp. Citrus limon Portulaca oleracea Brachiaria decumbens Lantana camara Solanum sp. Agave horrida Ageratina espinosarum Lysiloma acapulcense Lysiloma tergeminum nd Passiflora foetida Plumeria rubra Solanum tridynamum Turnera diffusa Manilkara zapota Simsia lagascaeformis Acacia farnesiana Antigonon leptopus Bursera sp.1 Calea zacatechichi Guazuma ulmifolia Leucaena leucocephala Matelea trachyantha Pachycereus weberi Pithecellobium dulce Platanus sp. Plocosperma buxifolium Polygonum sp. Salix alba Spondias purpurea Amaranthus hybridus Tithonia tuberformis Allionia choisyi Cnidoscolus tehuacanensis Acacia coulteri Acrocomia mexicana Agave kerchovei Agave potatorum

Ipsp Cili Pool Brde Laca Sosp Agho Ages Lyac Lyte nd Pafo Plru Sotr Tudi Maza Sila Acfa Anle Busp1 Caza Guul Lele Matr Pawe Pidu Plsp Plbu Posp Saal Sppu Amhy Titu Alch Cnte Acco Acme Agke Agpo Bufa

4 4 3 3 3 3 3 3 3 3 3 3 3 3 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 1 1 1 1 1 1 1 495

0.6 0.6 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2

4 5 3 3 2 1 4 4 7 2 12 2 7 9 3 3 11 2 11 4 2 2 1 1 1 1 1 1

0.8 1.0 0.6 0.6 0.4 0.2 0.8 0.8 1.3 0.4 2.3 0.4 1.3 1.7 0.6 0.6 2.1 0.4 2.1 0.8 0.4 0.4 0.2 0.2 0.2 0.2 0.2 0.2

Rev Mex Cienc Pecu 2019;10(2):490-505

Bursera fagaroides Ceiba sp. Celtis pallida Commicarpus scandens Condalia mexicana Hechtia tehuacana Moringa oleifera Pseudosmodingium andrieuxii Schinopsis balansae Solanum rostratum nd nd Astianthus viminalis Panicum decolorans Stenocereus pruinosus

Cesp Cepa Cosc Come Hete Mool Psan Scba Soro nd nd Asvi Pade Stpr

1 1 1 1 1 1 1 1 1 1 1 1

0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2

1 2 1 2 1 1 2 1 1 5 2 4

(*) percentage of the total in each season, (nd) non-determined species.

496

0.2 0.4 0.2 0.4 0.2 0.2 0.4 0.2 0.2 1.0 0.4 0.8

Rev Mex Cienc Pecu 2019;10(2):490-505

Figure 2: Cumulative curve of the relationship between number of species consumed by goats during the dry and rainy seasons. Dashed red lines show that, considering arbitrary shortcut of 75 %, 20 and 24 plants species were consumed in each season

Figure 3. Percentage of the principal plant species (75 % of the total) consumed by goats during the dry and rainy seasons.

497

Rev Mex Cienc Pecu 2019;10(2):490-505

The four clustering methods (single linkage, complete-linkage, UPGMA and Ward) produced slightly different dendrograms. Calculation of the cophenetic distance correlation coefficient (r= 0.92 in the rainy season and r= 0.86 in the dry season) suggested that UPGMA was the optimum clustering method for the matrix data. The Horn-Morisita similarity coefficients varied among pairwise locations and seasons (Table 2). Mimosa sp. and Acacia cochiliacantha were the species consumed by all flocks in both seasons; while Eleusine indica, Prosopis leavigata and Opuntia sp. were the next most important, depending on the season. During the rainy season flocks from Tecomavaca and Teotitlรกn showed lower similarity relative to the other flocks; while dry season, flocks from Tecomavaca and Casa Blanca showed lower similarity relative to the other flocks (Figure 4).

Table 2. Horn-Morisita similarity coefficients among pairwise sites during the rainy and dry seasons CB+

CHI

COX

TOX

CUI

LCU

TEO

Rainy season CHI

0.582

COX

0.707

0.72

TOX

0.471

0.604

0.601

CUI

0.536

0.640

0.694

0.685

LCU

0.549

0.723

0.664

0.800

0.499

TEO

0.353

0.547

0.401

0.481

0.401

0.495

TEC

0.080

0.369

0.138

0.088

0.04

0.256

Dry season CHI

0.610

COX

0.590

0.685

TOX

0.480

0.678

0.611

CUI

0.454

0.718

0.808

0.700

LCU

0.633

0.705

0.579

0.761

0.526

TEO

0.456

0.844

0.669

0.675

0.617

0.673

TEC

0.381

0.477

0.35

0.463

0.615

0.275

0.511

+ Sites abbreviations: Coxcatlรกn (COX), Casa Blanca (CB), Teotitlรกn (TEO), Toxpalan (TOX), Los Cues (LCU), Tecomavaca (TEC), Cuicatlรกn (CUI) and Chicozapotes (CHI).

498

Rev Mex Cienc Pecu 2019;10(2):490-505

Figure 4: Classification of the sites according with the similarity in plant species consumed by goats during the dry and rainy seasons. The darkâ&#x20AC;&#x201D;light color gradient represents from more to less species consumed. Very low or no consumption it is represent by gray color. In the upper part, the dendrogram of studied sites classification uses the UPGMA average agglomerative clustering method

The species richness of plants consumed by the goats in the region of La CaĂąada was similar to that reported in regions neighboring the TCBR. For example, in the northern region, between 40 and 80 species have been reported to be consumed by the goats in the dry and rainy seasons, respectively(5,25). Among the principal genera consumed by goats were Bursera, Jatropha, Fouquieria, Leucaena, Pithecellobium, Acacia, Guazuma, and Prosopis(25,26). In other tropical region has been reported that, of the 19 trees species consumed during the year, Mimosa was by far the most frequently selected species; grass was a large component of the goat diet in the early wet period, while browsed leaves were an important source of forage during the dry periods(28). In particular, the dry season is the most critical phase for the maintenance of flocks in this region. It has been documented that the goats lose bodyweight significantly during this period due to deficiencies in dietary protein

499

Rev Mex Cienc Pecu 2019;10(2):490-505

and phosphorus(29). The animals mainly browse on leguminous plants during the dry season(30).

During periods of forage scarcity, goats typically increase their search effort as nutrient intake decreases. The increased consumption of woody species observed during this period increases the grazing pressure on local vegetation(29). For this reason, such as Opuntia spp. and Agave salmiana have been suggested as dietary supplements, along with the fruits of Yucca periculosa and pods of Prosopis laevigata and Acacia subangulata combined with the traditional maize stubble(29). In other semiarid regions, Prosopis laevigata and Opuntia sp. are used as supplements, considering their nutritional characteristics and their capacity for growth in conditions of low water availability(31). In particular, the cladodes of the cacti and their fruits are used as an emergency food source, providing energy and water in times of drought, while the herbaceous plants provide protein in the rainy season(3).

Small ruminants, such as goats and sheep, and even wild animals such as the white-tailed deer, select their diet from a broad range of plant species, which differ in terms of nutrient content and availability over the course of the year(19). At the end of fall and beginning of winter, there is a lack of quality forage for which reason it is necessary to supplement the diet of the goats. The deficiency of crude protein in the goatÂ´s diet limits the digestion of fiber and minerals by the animals, causing slow growth, reduced immunological function, anemia, edema and death(32). Of the plant species consumed, those with the highest contents of protein (>20 %) are Ziziphus pedunculata, Prosopis laevigata and Ceiba parvifolia; other species that fulfill the minimum requirements for the goats are Mimosa sp., Viguiera dentate, Walteria indica and Solanum tridynamum(33). Fiber contributes significantly to balance nutritional requirements(32,34). Of the plants analyzed, the highest fiber content is presented by Agrostis stolonifera collected in the rainy season. Of the consumed plants, those with the highest quantity of neutral detergent fiber, acid detergent fiber were Mimosa sp., Opuntia sp., Viguiera dentate, Acacia farnesiana, Opuntia sp. and Ziziphus pedunculata(33). The shrub species of the genera Prosopis, Mimosa and Acacia presented high metabolizable energy compared to some tree, cactus and herbaceous plants(3). The metabolizable energy in Prosopis and Acacia during the dry season exceeded the requirements of the goats(35). Hierarchical agglomerative clustering methods through multivariate cluster analyses(13) allowed determination of similarities among the eight flocks depending upon the consumed plant species. These methods are common in taxonomic and ecological studies(14). Based on 75 % of the principal species consumed and using heat maps, the eight studied flocks were classified into different clusters in each season. Specifically, the Tecomovaca flock showed lower similarity compared to the other flocks. Local differences in plant species abundance

500

Rev Mex Cienc Pecu 2019;10(2):490-505

and the presence of some specific species, explained the clustering of the flocks in the rainy and dry seasons.

Finally, the results of the present study contribute to furthering the knowledge regarding the foraging habits of goats in tropical dry landscapes where the seasonality of the resources is very contrasting, as is the case in the Cañada which has been little studied compared to the arid and semiarid zones of Mexico. Some of the plants consumed could be used in the production of silage by family microbusinesses in order to feed the goats with native plants. Due to their availability in the zone as well as nutritional content, the species Ceiba parvifolia, Waltheria indica, Prosopis leavigata, Solanum sp. and Sanvitalia procumbens could be collected in the rainy season for tedding or ensilaging and subsequent use as a food supplement in the dry season or when the animals are corralled. These results are valuable for the management and conservation of the studied habitats as they further the understanding of goat habitat and diet selection in different periods.

The studied goat flocks consumed 65 to 82 plant species during the dry and rainy seasons in the Cañada region of Oaxaca State. However, the main species were Mimosa sp., Acacia cochiliacantha, Eleusine indica, Dalea carthagenensis, Prosopis leavigata, Opuntia spp. and Ceiba parvifolia. Some of these species have been reported in other regions. Hierarchical agglomerative clustering methods through multivariate cluster analyses allowed the determination of similarities among the eight flocks according to the plant species consumed. These analyses show that the goats of different locations in the Cañada region consumed relatively similar plant species.

Acknowledgements The study received financial and logistical support of the CONACYT projects CB2009-01-130702 and CB-2015-01-256549; and the Red de Biología y Conservación de Vertebrados del Instituto de Ecología A.C. Thank also to T. Pérez-Pérez, R. Rodriguez, and A. Sandoval-Comte. We thank the authorities and people of the studied sites. K. MacMillan reviewed the English version of the manuscript.

501

Rev Mex Cienc Pecu 2019;10(2):490-505

Literature cited: 1. Rebollar S, Hernández J, Rojo R, Guzmán E. Gastos e ingresos en la actividad caprina extensiva en México. Agron Mesoam 2012;23(1):159-165. 2. Zárate JL. Livestock and natural resources in a nature reserve in south Sonora, Mexico. Trop Subtrop Agroecosyst 2012;15(2):187-197. 3. Guerrero-Cruz MM. La caprinocultura en México, una estrategia de desarrollo. Rev Universt Digital Cienc Soc 2010;1(1):2-7. 4. Hernández-H ZJS. The goat farming in the Puebla (Mexico) livestock production: goat contribution and production systems. Arch Zootec 2000;49(187):341-352. 5. Hernández-H JE, Franco FJ, Villarreal- Espino OA, Aguilar LM, Sorcia MG. Identificación y preferencia de especies arbóreo-arbustivas y sus partes consumidas por el ganado caprino en la Mixteca Poblana, Tehuaxtla y Maninalcingo, México. Zootec Trop 2008;26(3):379-382. 6. Mendoza A, Ortega-Sánchez JL. Capriculture characterization in the municipality of Tepelmeme Villa de Morelos, Oaxaca, Mexico. Rev Chapingo Zonas Áridas 2009;8(1):75-80. 7. Dávila P, Arizmendi MC, Valiente-Banuet A, Villaseñor JL, Casas A, Lira R. Biological diversity in the Tehuacán-Cuicatlán Valley, Mexico. Biodivers Conserv 2002;11(3):421442. 8. Baraza E, Estrella-Ruiz JP. Manejo sustentable de los recursos naturales guiado por proyectos científicos en la mixteca poblana mexicana. Ecosistemas 2008;17(2):3-9. 9. Ortega RH, Ortega-Paczka R, Zavala-Hurtado JA, Baca del Moral J, Martínez-Alfaro MA. Diagnóstico ambiental y estrategias campesinas en la Reserva de la Biosfera Tehuacán-Cuicatlán, municipio de Zapotitlán, estado de Puebla. Rev Geografía Agr 2008;41(1):55-71. 10. Baraza E, Valiente-Banuet A. Efecto de la exclusión de ganado en dos especies palatables del matorral xerófilo del Valle de Tehuacán, México. Rev Mex Biodivers 2012;83(4):1145-1151. 11. Castro HG, Figueroa DG, Hernández FG, de Coss AL, Ruiz RP. Evaluación de áreas ganaderas en la zona de amortiguamiento de una reserva natural en Chiapas, México. Rev Asoc Interprofesional Desarrollo Agrario 2013;1(1):69-85. 502

Rev Mex Cienc Pecu 2019;10(2):490-505

12. Vasquez Y, Tarango L, López-Pérez EN, Herrera J, Mendoza G, Mandujano S. Variation in the diet composition of the white-tailed deer (Odocoileus virginianus) in the TehuacánCuicatlán Biosphere Reserve. Rev Chapingo S Cienc Forestales Ambientales 2016;22(3):87-98. 13. Bocard D, Gillet F, Legendre P. Numerical Ecology with R. Springer. 2011 14. Legendre P, Legendre L. Numerical ecology. 2nd Eng ed. Amsterdam: Elsevier; 1998. 15. Comisión Nacional de Áreas Protegidas (CONANP). Programa de Manejo Reserva de la Biosfera Tehuacán-Cuicatlán. Comisión Nacional de Áreas Naturales Protegidas. Secretaría de Medio Ambiente y Recursos Naturales. México, DF. 2013. 16. Reséndiz-Melgar RC, Díaz MJ, Lemos-Espinal JA. Forrajeo de ganado caprino en el Valle de Zapotitlán de las Salinas, Puebla, México. Rev Mex Cienc Forest 2005;30(1):4592. 17. Agreil C, Meuret M. An improved method for quantifying intake rate and ingestive behavior of ruminants in diverse and variable habitats using direct observation. Small Ruminant Res 2004;54(1-2):99-113. 18. González-Pech PG, Torres JFJ, Sandoval CA. Adapting a bite coding grid for small ruminants browsing a deciduous tropical forest. Trop Subtrop Agroecosyst 2014;17(1):63-70. 19. Franco-Guerra F, Gómez G, Villarreal-Espino OA, Camacho JC, Hernández J, Rodríguez EL, Marcito O. Bites rate on native vegetation by trashumance goats grazing in mountain rangeland in nudo mixteco, Mexico. Trop Subtrop Agroecosyst 2014;17(2):249-253. 20. Dávila P, Villaseñor JL, Medina R, Ramírez A, Salinas A, Sánchez-Ken J, Tenorio P. Listado Florístico del Valle de Tehuacán-Cuicatlán. Listados Florísticos VIII. Instituto de Biología, Universidad Nacional Autónoma de México, México; 1993. 21. Goetsch AL, Gipson TA, Askar AR, Puchala R. Feeding behavior of goats. J Anim Sci 2014;88(1)361–373. 22. Crawley MJ. The R Book. U.K: John Wiley & Sons; 2013. 23. Oksanen J, Blanchet FG, Kindt R, Legendre P, O’Hara B, Simpson GL, Solymos P, Stevens MHH, Wagner H. vegan: Community ecology package. R package version 1.173; 2010.

503

Rev Mex Cienc Pecu 2019;10(2):490-505

24. R Development Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL http://www.R-project.org.; 2015. 25. Franco-Guerra F, Gómez G, Mendoza G, Barcena R, Ricalde R, Plata F, Hernández J. Influence of plant cover on dietary selection by goats in the Mixteca region of Oaxaca, Mexico. J Appl Anim Res 2005;27(2):95-100. 26. Sánchez CM, Gómez G, Álvarez M, Daza H, Garmendia J. Nutritional characterization of goat forage resources in extensive systems. Archivos Latinoamericano Prod Anim 2004;12(4):63-66. 27. Ramírez-Orduña R, Ramírez RG, Romero-Vadillo E, González-Rodríguez H, ArmentaQuintana JA, Ávalos-Castro R. Diet and nutrition of range goats on a sarcocaulescent shurbland from Baja California Sur, Mexico. Small Ruminant Res 2008;76(3):166-176. 28. Kronberg SL, Malechek JC. Relationships between nutrition and foraging behavior of free-ranging sheep and goats. J Animal Sci 1997;75(7):1756-1763. 29. Baraza E, Ángeles S, García A, Valiente-Banuet A. Nuevos recursos naturales como complemento de la dieta de caprinos durante la época seca en el Valle de Tehuacán, México. Interciencia 2008;33(12):891-896. 30. Kanani J, Lukefahr SD, Stanko RL. Evaluation of tropical forage legumes (Medical sativa, Dolichos lablab, Leucaena leucocephala and Desmanthus bicornutus) for growing goats. Small Ruminant Res 2006;65(1-2):1-7. 31. Andrade-Montemayor HM, Cordova-Torres AV, García-Gasca T, Kawas JR. Alternative foods for small ruminants in semiarid zones, the case of Mesquite (Prosopis laevigata) and Nopal (Opuntia sp). Small Ruminant Res 2011;98(1-3):83-92. 32. Darrell L, Rankins JR, Debra CR, Pugh DG. Feeding and Nutrition. In: Pugh DG, Baird NN editors. Sheep & goat medicine., Missouri: Elsevier Health Sciences; 2012. 33. Landa-Becerra A, Mandujano S, Martiń ez-Cruz NS, López E. Análisis del contenido nutricional de plantas consumidas por caprinos en una localidad de la Cañada, Oaxaca. Trop Subtrop Agroecosyst 2016;19(3):295-304. 34. Lu CD, Kawas JR, Mahgoub, OG. Fibre digestion and utilization in goats. Small Ruminant Res 2005;60(1-2):45-52.

504

Rev Mex Cienc Pecu 2019;10(2):490-505

35. National Research Council (NRC). Nutrient Requirements of small ruminants: sheep, goats, cervids, and new world camelids. Washington, DC, USA. National Academy Press; 2007.

505

https://doi.org/10.22319/rmcp.v10i2.4791 Technical note

Serological evidence of caprine herpesvirus type 1 infection in goats in Mexico

Montserrat E. García-Hernández a Rosa E. Sarmiento-Silva a Liliana M. Valdés-Vázquez a Laura Cobos-Marín a*

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Departamento de Microbiología e Inmunología,. Av. Universidad 3000, Circuito Exterior S/N col. Universidad Nacional Autónoma de México, CU. Ciudad Universitaria Delegación Coyoacán 04510, Ciudad de México. México.

*Corresponding author: laura.cobosmarin@gmail.com

Abstract: Serologic studies of caprine herpesvirus type 1 infection (CpHV-1) have not been done to date in Mexico. A serological survey was conducted to identify the presence of antiCpHV antibodies with two widely used blocking ELISA tests for detection of antibodies against bovine herpesvirus type 1 glycoprotein B (gB) and anti-glycoprotein E (gE). Of the 838 tested animals, 123 (14.68 %) were positive with the ELISA test. Anti-CpHV-1 antibodies were detected in samples from the states of Puebla, Morelos, Nuevo Leon, Mexico City, Guanajuato and Queretaro. This is the first report of the presence of antibodies against caprine herpesvirus-1 in Mexico. Key words: Caprine, Herpesvirus, Mexico, Goats, Seroprevalence, ELISA.

Received: 02/03/2018 Accepted: 04/04/2018

506

Rev Mex Cienc Pecu 2019;10(2):506-510

Viruses belonging to the Herpesviridae family are distributed widely in nature and affect a large number of animal species(1,2). One of the main herpesviruses affecting goat production is caprine herpesvirus type 1 (CpHV-1) which causes significant financial losses in goat production systems. Distributed worldwide, CpHV-1 has especially high seroprevalences in the Mediterranean basin(3-8). It infects epithelial cells in vivo and in vitro, producing a cytolytic infection and establishing a latent infection in the sacral and trigeminal ganglia. The latent state remains throughout an animal’s life and can be reactivated under stressful conditions. The virus causes abortions, neonatal death, vulvovaginitis and balanoposthitis in adults, as well as systemic disease in kids(2,6). Caprine herpesvirus type 1 (CpHV-1) is a wrapped virus containing a large number of glycoproteins, with glycoprotein B (gB), glycoprotein C (gC) and glycoprotein D (gD) being the most abundant(9). Phylogenetic analysis of the nucleotide and amino acid sequences of gB and gD has revealed that CpHV-1 is the most distant virus among the alphaherpesvirus affecting ruminants, which include bovine herpesvirus type 1 (BoHV1), bovine herpesvirus type 5 (BoHV-5), cervid herpesvirus type 1 and 2 (CvHV-1, CvHV-2), and moose herpesvirus (RanHV-1)(10). Based on the complete gB sequence, which is the most frequently preserved among the herpesviruses, the identity percentage between CpHV-1 and BoHV-1 is 78.5%(9). Due to the presence of a homology between bovine herpesvirus and caprine herpesvirus, and the lack of commercial CpHV-1 antibodies for serological diagnosis, commercial detection kits for infectious bovine rhinotracheitis (IBR) gB antibodies have been used to detect CpHV-1(8,11). No seroepidemiological studies for CpHV-1 have been done in Mexico to date, although the disease may have been responsible for a suspicious outbreak in a goat herd in the state of Queretaro in 2008(12). With the aim of beginning characterization of CpHV-1 epidemiological status in Mexico, a serological study was done of goats from eight states using a commercial ELISA for antibody detection of BoHV-1. Antigenic difference between BoHV-1 and CpHV-1 allowed use of an antibody detection test against gE from BoHV-1 to distinguish between the two viruses. Analyses were done of 838 serum samples from seven states: Queretaro, Puebla, Guanajuato, Mexico City, Veracruz, Nuevo León and Morelos. Two commercial ELISA blocking tests were used [ Herdchek Anti-IBR gB (Idexx, Germany) and Herdchek Anti-IBR gE (Idexx, Germany)], and samples processed following manufacturer instructions(3). Antibodies against CpHV-1 were in samples from the states of Puebla, Morelos, Nuevo León, Mexico City and Guanajuato. Of the 838 samples, gB antibodies were detected in 123 (14.68 %). Analyses for gE were done in 93 of these 123 positives, and produced two positives and two suspected positive samples. Positivity was 33.33 % in Puebla, 32.72 % in Nuevo León and 27.34 % in Mexico City, but only 10 % in Queretaro and negative in Veracruz (Table 1). Positive results for the gB of BoHV-1 in 14.68 % of the analyzed samples, as well as the lack of positivity in most of the samples in the confirmation gE 507

Rev Mex Cienc Pecu 2019;10(2):506-510

detection test (99.9 %), suggest that these animals could have be in contact with CpHV1 based on previous reports(1, 3,7).

Table 1: ELISA results by State ELISA gB States QuerĂŠtaro Puebla Guanajuato Mexico City Veracruz Nuevo LeĂłn Morelos Total

Samples analyzed 427 51 106 139 52 55 8 838

Positives

(%)

43 17 3 38 0 18 4 123

10.07 33.33 2.83 27.34 0.00 32.73 50.00 14.68

ELISA gE Positives

Suspicious

0 1 0 2

1 0 2

In one study the anti-gB blocking ELISA test exhibited 93% sensitivity in experimental goats infected with CpHV-1, so this method is considered effective in detection of caprine herpesvirus infection via gB cross-antigenicity(9). Natural BoHV-1 infection in goats is rare(11), suggesting that the two gE positives may be due to high immunization levels caused by recent contact. Of note is that both gE-positive samples had blocking levels greater than 90% in the gB test. Another reason for this positivity could be a certain degree of cross-antigenicity between CpHv-1 gE and BoHV1 gE due to the epitopes shared between the two; this has been reported for the pseudorabies virus(13). The present is the first report of the presence of antibodies against herpesvirus in goats in Mexico. The results suggest that caprine herpesvirus type 1 is found in Mexico. In cases of abortion in goats, CpHv-1 should be considered as a presumptive diagnosis. Although only 10.47% of the samples from Queretaro were positive these came from a herd with suspicious lesions possibly due to CpHV-1, a situation reported previously(12). In addition, the CpHV-1 positive tissue samples were identified by immunohistochemistry using monoclonal antibodies. These results suggest that CpHV-1 circulates in this region of Mexico.

508

Rev Mex Cienc Pecu 2019;10(2):506-510

Acknowledgements

The research reported here was funded by the Dirección General de Apoyos al Personal Académico (DGAPA) of the Universidad Nacional Autónoma de México (UNAM), PAPIIT IN228511-3. Thanks are due the Centro de Enseñanza, Investigación y Extensión en Producción Animal del Altiplano (CEIEPAA), and María Grisel Anaya Santillán and Hugo César Sánchez Rivera for access to facilities. This study was done with the authorization of animal owners.

Literature cited: 1.

Thiry J, Keuser V, Muylkens B, Meurens F, Gogev S, Vanderplasschen A, et al. Ruminant alphaherpesviruses related to bovine herpesvirus 1. Vet Res 2006;37(2):169-190.

Tempesta M, Pratelli A, Greco G, Martella V, Buonavoglia C. Detection of caprine herpesvirus 1 in sacral ganglia of latently infected goats by PCR. J Clin Microbiol 1999;37(5):1598-1599.

Thiry J, Saegerman C, Chartier C, Mercier P, Keuser V, Thiry E. Serological evidence of caprine herpesvirus 1 infection in Mediterranean France. Vet Microbiol 2008;128(4):261-268.

Keuser V, Espejo-Serrano J, Schynts F, Georgin JP, Thiry E. Isolation of caprine herpesvirus type 1 in Spain. Vet Rec 2004;154(13):395-399.

Koptopoulos G, Papanastasopoulou M, Papadopoulos O, Ludwig H. The epizootiology of caprine herpesvirus (BHV-6) infections in goat populations in Greece. Comp Immunol Microbiol Infect Dis 1988;11(3):199–205.

Saito JK, Gribble DH, Berrios PE, Knight HD, Mc Kercher DG. A new herpesvirus isolate from goats: Preliminary report. Am J Vet Res 1974;35:847–848.

Mettler F, Engels M, Wild P, Bivetti A. Herpesvirus-Infektion bei Zicklein in der Schweiz. Arch Thierheilkd 1979; 655-662.

Keuser V, Schynts F, Detry B, Collard A, Robert B, Vanderplasschen A, et al. Improved antigenic methods for differential diagnosis of bovine, caprine, and cervine Alphaherpesviruses related to bovine herpesvirus 1. J Clin Microbiol 2004;42(3):1228–1235.

509

Rev Mex Cienc Pecu 2019;10(2):506-510

Ros C, Belák S. Characterization of the glycoprotein B gene from ruminant alphaherpesviruses. Virus Genes 2002;24(2):99–105.

10. Ros C, Belák S. Studies of genetic relationships between bovine, caprine, cervine, and rangiferine alphaherpesviruses and improved molecular methods for virus detection and identification. J Clin Microbiol 1999;37(5):1247–1253. 11. Marinaro M, Bellacicco AL, Tarsitano E, Camero M, Colao V, Tempesta M, et al. Detection of Caprine herpesvirus 1-specific antibodies in goat sera using an enzymelinked immunosorbent assay and serum neutralization test. J Vet Diagn Invest 2010;22(2):245–248. 12. Candanosa AE, Sierra GM, Sánchez AC, Salas GG, Méndez AB, Cobos LM, et al. Vulvovaginitis y balanopostitis pustular sugerente a herpesvirus caprino-1 en cabras (Querétaro México). Vet Mex 2011;42(3):233-243. 13. Jacobs L, Kimman TG. Epitope-specific antibody response against glycoprotein E of pseudorabies virus. Clin Diagn Lab Immunol 1994;1(5):500–505.

510

https://doi.org/10.22319/rmcp.v10i2.4638 Technical note

Analysis of rotavirus in rabbits in the State of Mexico

Emmanuel Reynoso Utrera a Linda Guiliana Bautista Gómez a* José Simón Martínez Castañeda b Camilo Romero Núñez a Virginia Guadalupe García Rubio a Gabriela López Aguado Almazán a Pedro Abel Hernández García b Enrique Espinosa Ayala b

Universidad Autónoma del Estado de México. Centro Universitario UAEM Amecameca, Km 2.5, Carretera Amecameca Ayapango, 59000. México. b

Universidad Autónoma del Estado de México. Centro de Investigación y Estudios Avanzados en Salud Animal, Facultad de Medicina Veterinaria y Zootecnia. Toluca, Estado de México, México.

*Corresponding author: lin_bag@yahoo.com.mx; lgbautistag@uaemex.mx

Abstract: Enteric diseases can severely impact livestock production systems, causing financial losses due to mortality, compromised growth performance and reduced conversion rates. Rotavirus is considered a principal cause of acute viral gastroenteritis in young humans and animals worldwide, and is associated with dehydrating diarrhea in livestock. A study was done to identify rotavirus in 39 small backyard rabbit production systems in thirteen municipalities in the south-eastern region of the State of Mexico. A total of 147 samples were analyzed with RT-PCR, 99 from healthy rabbits and 48 from animals exhibiting 511

Rev Mex Cienc Pecu 2019;10(2):511-521

enteric symptoms. Lapine rotavirus was identified in nine (18.7 %) of the diseased animals, and none of the healthy individuals. The results support the hypothesis that in rabbits with enteric disease, viruses play an important but not decisive role, and that rotavirus does not determine disease occurrence. Lapine rotavirus is probably not endemic in rabbit production systems in the studied region, and may occur without inducing serious enteric episodes in individuals. However, in association with other pathogens, it may also be an important contributing factor in enteric outbreaks. This is one of the first reports of rotavirus in rabbits with enteric disease in Mexico. Key words: Mexico, Rotavirus, Rabbits, Diarrhea.

Received: 26/09/2017 Accepted: 09/02/2018

Rabbit (Oryctolagus cuniculus) production involves their systematic breeding, growing and reproduction to generate profit from the sale of products and by-products(1). Production of rabbits is growing in Mexico. In 2016, the Ministry of Agriculture, Livestock, Rural Development, Fisheries and Food (Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación - SAGARPA) estimated that total national rabbit meat production exceeded 15,000 t, with production being highest in the states of Puebla, Tlaxcala, Morelos, Michoacán, Queretaro and the State of Mexico(2). This latter state accounts for the highest rabbit meat production and consumption nationwide, and the southeast portion of the state is responsible for most of the production, marketing and consumption(2, 3). Despite constant growth in rabbit production in Mexico, it is not given the importance of other common livestock species, and thus remains a largely rural backyard enterprise done by subsistence farmers in low-income regions(4). This type of small-scale production represents 95 % of total national rabbit production(5). One of the principal problems in rabbit production is a lack of information on good production practices, especially on vital issues such as health, biosafety and animal welfare. This can favor the occurrence of pathogenic agents responsible for various diseases(6,7). Enteric diseases can seriously impact farms focused on animal production because they can generate severe financial losses due to mortality, compromised growth performance and lower conversion rates(8-11). Rotavirus (RV) is among the pathogens that can cause signs of enteric diseases in rabbit production systems(9,12), and is one of the leading causes of acute viral gastroenteritis in humans and young animals worldwide(13,14), including in rabbits(15). Rotavirus is a double-stranded RNA virus (dsRNA) belonging to the Reoviridae family, subfamily Sedoreovirinae, genus Rotavirus(16). Lapine rotavirus (LRV) strains can cause

512

Rev Mex Cienc Pecu 2019;10(2):511-521

enteric cases, mainly in post-weaning rabbits, but it is also implicated in the etiology of severe enteritis outbreaks in association with bacteria, parasites and other viruses. Rotavirus (RV) infection is most common in rabbits from 35 to 50 d of age, is characterized by a high morbidity rate and the presence of non-specific clinical signs, such as diarrhea, dehydration, anorexia and depression. Diseased rabbits may die from dehydration and secondary infections, while those that recover usually exhibit decreased productivity due to reduced nutrient absorption capacity(9,12,17). In Mexico, there is only one report to date of the presence of RV in rabbits with enteric clinical profiles(18). The present study objective was to analyze the presence of LRV in healthy rabbits and those with enteric symptoms in the thirteen municipalities conforming the southeast region of the State of Mexico. Samples were collected from April 2014 to November 2016 at 39 rural backyard production units. A total of 147 samples were collected from rabbits between 25 and 60 d of age, from both healthy individuals and those manifesting enteric clinical symptoms (e.g. abdominal distension, anorexia, depression, diarrhea, dehydration). Production systems were basic, involving few or no biosafety measures and inadequate sanitation management. The sampled farms were located in the southeast region of the State of Mexico, consisting of thirteen municipalities: Valle de Chalco; Chalco; Temamatla; Cocotitlan; Tlalmanalco; Juchitepec; Tenango del Aire; Ayapango; Amecameca; Atlautla; Ozumba; Tepetlixpa; and Ecatzingo (Figure 1).

Figure 1: Study area location. A: Mexico; B: State of Mexico; C: Southeast region.

Samples were collected from live animals, either as 1 ml of liquid excrement or 2 g of soft or solid excrement. These were placed in sterile vials, transported under refrigeration to the Biotechnology, Molecular Biology and Genetics Laboratory of the Autonomous University of the State of Mexico (Universidad Autonoma del Estado de Mexico UAEM), UAEM Amecameca University Center, where they were stored at -75 Â°C until analysis. In dead animals, samples were taken directly from the small intestine within a 513

Rev Mex Cienc Pecu 2019;10(2):511-521

period no greater than 5 h post mortem. Animals manifesting severe enteric clinical symptoms were killed following established guidelines (NOM-033-ZOO-1995), and samples taken of excrement and small intestine tissue (including contents). The study design was approved by the UAEM Amecameca University Center Bioethics Committee (CBE/13/2014). Samples were analyzed for LRV identification by amplification of three of its structural proteins; VP6, VP4 and VP7 using reverse transcription polymerase chain reaction (RTPCR) with total RNA extracted from samples. Detection of VP6 was done using primers designed by Iturriza-Gómara et al(19) which amplify a 379 base pair (bp) fragment of the VP6 gene (VP6-F [nt 747 – 766] 5' GACGGVGCRACTACATGGT 3' and VP6-R [nt 1126 - 1106] 5' GTCCAATTCATNCCTGGTGG 3'). For VP4, previously reported primers(20) were used for amplification of an 876 bp fragment encoding for the VP4 protein (with 3 [nt 11 – 32] F 5' TGGCTTCGCCATTTTATAGACA 3' and 2 [nt 887 – 868] R 5' ATTTCGGACCATTTATAACC 3'). Complete amplification of VP7 was done with the primers Beg 9 (nt 1 – 28) F 5' GGCTTTAAAAGAGAGAATTTCCGTCTGG 3' and End 9 (nt 1062 – 1036) R 5' GGTCACATCATACAATTCTAATCTAAG 3'(21). Total RNA was obtained using the GeneJET Viral DNA and RNA purification kit (Thermo Scientific™), according to the manufacturer instructions. After isolation of virus RNA, a single-step RT-PCR was run using the commercial Superscript® III One Step RT-PCR with Platinum® Taq (Invitrogen™) kit. Reaction positive control was the pentavalent Rotateq vaccine (Sanofi Pasteur MSD), and the negative control was rabbit DNA. PCR products were viewed in 2% agarose gels stained with ethidium bromide. A total of 147 samples were processed, 99 from healthy rabbits and 48 from rabbits exhibiting enteric symptoms. Lapine rotavirus (LRV) was identified in nine of the diseased animals and was not detected in healthy ones (Table 1).

514

Rev Mex Cienc Pecu 2019;10(2):511-521

Table 1: Data on samples collected for lapine rotavirus (LRV) detection in thirteen municipalities in the southeast region of the State of Mexico Municipality Valle de Chalco Amecameca Atlautla Ozumba Tepetlixpa Juchitepec Ayapango Tenango del Aire Temamatla Cocotitlรกn Chalco Tlalmanalco Ecatzingo Total

Farms 2 5 4 2 2 4 4 2 3 2 3 4 2 39

Total Rabbits 8 19 14 9 8 12 15 9 8 10 8 15 12 147

Healthy

Diseased

LRV+

6 12 11 6 6 9 8 6 5 6 6 10 8 99

2 7 3 3 2 3 7 3 3 4 2 5 4 48

0 3 1 0 0 1 3 0 0 0 0 1 0 9

Clinical manifestations in diseased rabbits included abdominal distension, anorexia, depression, diarrhea and dehydration. Lapine rotavirus (LRV) identification was done using excrement samples from all animals, as well as small intestine samples from those manifesting enteric symptoms. The RT-PCR technique was used to amplify 379 bp fragments of VP6 (Figure 2), 1062 bp fragments of VP7 (Figure 3), and 879 bp fragments of VP4 (Figure 4).

515

Rev Mex Cienc Pecu 2019;10(2):511-521

Figure 2: 2% agarose gel amplification of 379 bp fragments corresponding to the VP6 gene of LRV

Row 1: 1 Kb molecular weight marker; row 2: positive control (vaccine); rows 3 and 4: rabbit samples; row 5: negative control.

Figure 3: 2% agarose gel amplification of 1062 bp fragments corresponding to the VP7 gene of LRV.

Row 1: 1 Kb molecular weight marker; row 2: positive control (vaccine); rows 3 to 6: rabbit samples; row 5: negative control.

516

Rev Mex Cienc Pecu 2019;10(2):511-521

Figure 4: 2% agarose gel amplification of 876 bp fragments corresponding to the VP4 gene of LRV

Row 1: 1 Kb molecular weight marker; row 2: positive control (vaccine); row 3: amplification VP4; row 7: negative control.

Enteric diseases can cause substantial financial losses in rabbit production systems(9,22). Enteric syndrome is a major disease in rabbits due to its productive and economic impacts. Among the various pathogens that have been identified in rabbits with enteric clinical profiles is a RV strain, which is considered of low virulence(23). Alone it should not be able to induce severe episodes, however it can cause enteric disease in post-weaning rabbits and is implicated in the etiology of severe enteritis outbreaks in association with other pathogens(24). Of the 147 samples analyzed here for LRV, 99 were from healthy rabbits and 48 from rabbits manifesting enteric symptoms. Lapine rotavirus was identified in 9 (18.7 %) of the diseased animals. Samples from healthy rabbits were analyzed to identify possible subclinical infections, since once LRV has entered an organism the extent and severity of clinical signs and intestinal lesions depend on the amount of viral particles ingested. Under these circumstances rabbits 4 to 5 wk of age can have a subclinical infection, favoring virus dissemination(9,12). Occurrence of LRV in the diseased rabbits agrees with the assumption that in rabbits with enteric symptoms viruses seem to play an important but not decisive role, and that LRV does not trigger enteric disease(6,9). The present results support the hypothesis that enteric syndrome in rabbits is multifactorial in origin with various pathogens acting synergistically to induce gastroenteritis(22,25-28). In wild as well as domestic rabbit populations LRV may play an important role in inducing the disease, either by exerting direct pathogenic activity or by facilitating the entry and replication of other pathogenic agents through minimal alteration of the intestinal epithelium(17).

517

Rev Mex Cienc Pecu 2019;10(2):511-521

The 18.7 % LRV infection rate observed in the present results is higher than the 15.3 %(9), 17.6 %(25), and 16 %(27) reported in studies done in Italy, and the 3 % reported in a study done in Canada(28). However, it was lower than the 23 % reported in another study in Italy(29). Worldwide, Italy is one of the main producers of rabbit meat(30), with highly technical production facilities. Nonetheless, intensive rabbit production is characterized by intense genetic selection, excess productive yield, overpopulation and overcrowding, which contribute to high levels of environmental pollution with facultative pathogens(9). Large-scale rabbit production may generate animal health challenges, but the present results suggest that backyard production implies an increased risk of disease occurrence, possibly due to factors such as lack of health and biosafety measures, and inadequate infrastructure. These factors are symptomatic of limited financial resources and a lack of information on good production practices. The LRV infection rate in the present results is higher than the 10.34 % previously reported in Mexico(18). This higher rate may be the result of the constant growth in rabbit meat production(2). A larger rabbit population in conjunction with more intra-regional commerce of animals and constant production could explain this increase in LRV, and perhaps in other pathogens. Further studies are needed to determine the epidemiology of LRV and other infectious microorganisms circulating among rabbit farms in this region of intense rabbit meat production, sale and consumption. In addition to their financial impacts, several animal rotaviruses are potential sources of human infection (zoonoses), with confirmed events(31-33). Epidemiological surveillance and molecular characterization of certain strains has been intensified in response, especially in host species in proximity to human populations(22). In the present study samples were collected from backyard rabbit production systems that had similar infrastructure and management practices. This approach was used because 95 % of rabbit meat production in Mexico occurs in small-scale systems(5), and several animal species continuously interact in these systems, favoring inter-species disease transmission, as well as zoonotic events. It is vital to know the pathogens present in livestock production systems, especially those posing a potential risk to public health. The results suggest that LRV is not endemic in rabbit production systems in the southeastern region of the State of Mexico. Apparently it occurs occasionally but without inducing severe enteric episodes in individuals; however, it may be an important factor in the appearance of enteric outbreaks in association with other pathogenic agents. Continued growth in rabbit meat production in Mexico highlights the need for development and application of good production practices aimed at reducing biological risks to animals and humans, improving production performance and minimizing financial losses. Further research is clearly required to understand the epidemiology of lapine rotavirus and other pathogens that affect rabbit production systems in Mexico. This is among the first reports of the presence of rotavirus in rabbits exhibiting enteric symptomatology in Mexico.

518

Rev Mex Cienc Pecu 2019;10(2):511-521

Literature cited: 1. Gamboa RC. Estudio de mercado de la carne de conejo en el municipio de Texcoco [tesis maestría]. Texcoco, Estado de México, México; Colegio de Posgraduados; 2001. 2. SAGARPA. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. Todo sobre la producción de carne de conejo. México. 2016. 3. Rodríguez AGI. Competitividad del sistema agroalimentario localizado productor de carne de conejo de la zona sur oriente del estado de México [tesis maestría]. Amecameca, Estado de México, México; Universidad Autónoma del Estado de México; 2012. 4. Comité Nacional Sistema Producto Cunícola. http://sistemaproductocunicola. org.mx/cunicola.html Consultado 25 Sep, 2017. 5. SAGARPA. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. Manual de buenas prácticas de producción de carne de conejo. México. 2015. 6. Percy DH, Muckle CA, Hampson RJ, Brash ML. The enteritis complex in domestic rabbits: a field study. Can Vet J 1993;34(2):95-102. 7. European Food and Safty Authority. The Impact of the current housing and husbandry systems on the health and welfare of farmed domestic rabbits [The EFSA Journal]. 2005;(267):1-31. 8.

Peeters JE, Pohl P, Charlier G. Infectious agents associated with diarrhoea in commercial rabbits: a field study. Ann Rech Vet 1984;15(3):335-340.

9. Lavazza A, Cerioli M, Martella V, Tittarelli C, Grilli G, Brivio R, et al. Rotavirus in diarrheic rabbits: prevalence and characterization of strains in Italian Farms. Proc IX World Rabbit Congress. Verona, Italy. 2008:993-998. 10. Dhama K, Chauhan RS, Mahendran M, Malik SV. Rotavirus diarrhea in bovines and other domestic animals. Vet Res Commun 2009;(33):1-23. 11. Papp H, László B, Jakab F, Ganesh B, De-Grazia S, Matthijnssens J, et al. Review of group A rotavirus strains reported in swine and cattle. Vet Microbiol 2013;(165):190-199. 12. Kerr PJ, Donnelly TM. Viral infections of rabbits. Vet Clin North Am Exot Anim Pract 2013;16(2):437-68. 13. Bishop R. Discovery of rotavirus: Implications for child health. J Gastroenterol Hepatol 2009;24(Suppl 3):S81–S85.

519

Rev Mex Cienc Pecu 2019;10(2):511-521

14. Estes M, Greenberg H. Rotaviruses. In: Knipe DM, Howley P. et al. editors. Fields virology. 6th ed., Philadelphia, PA; Wolters Kluwer Health/Lippincott Williams & Wilkins 2013:1347–1401. 15. Schoeb TR, Casebolt DB, Walker VE, Potgieter LN, Thouless ME, DiGiacomo RF. Rotavirus-associated diarrhoea in a commercial rabbitry. Lab Anim Sci 1986;(36):149-152. 16. ICTV. International Committee on Taxonomy of Viruses. Virus Taxonomy, EC 48. 2016 https://talk.ictvonline.org/taxonomy/ Consultado 25 Sep, 2017. 17. Ciarlet M, Gilger MA, Barone C, McArthur M, Estes MK, Conner ME. Rotavirus disease, but not infection and development of intestinal histopathological lesions, is age restricted in rabbits. Virology 1998;251(2):343-60. 18. García-Rubio VG, Bautista-Gómez LG, Martínez-Castañeda JS, Romero-Núñez C. Multicausal etiology of the enteric syndrome in rabbits from Mexico. Rev Argent Microbiol 2017;49(2):132-138. 19. Iturriza-Gómara M, Wong C, Blome S, Desselberger U, Gray J. Molecular characterization of VP6 genes of human rotavirus isolates: Correlation of genogroups with subgroups and evidence of independent segregation. J Virol 2002;76(13):6596–6601. 20. Gentsch JR, Glass RI, Woods P, Gouvea V, Gorziglia M, Flores J, et al. Identification of Group A Rotavirus gene 4 types by polymerase chain reaction. J Clin Microbiol 1992;(30):1365-1373. 21. Gouvea V, Glass RI, Woods P, Taniguchi K, Clark HF, Forrester B, et al. Polymerase chain reaction amplification and typing of rotavirus nucleic acid from Stool specimens. J Clin Microbiol 1990;(28):276-282. 22.

Bányai K, Forgach P, Erdelyi K, Martella V, Bogdan A, Hocsak E, et al. Identification of the novel lapine rotavirus genotype P[22] from an outbreak of enteritis in a Hungarian rabbitry. Virus Res 2005;(113):73-80.

23. Thouless ME, Digiacomo RF, Deeb BJ, Howard H. Pathogenicity of Rotavirus in rabbits. J Clin Microbiol 1988;26(5):943-947. 24. Lavazza A, Capucci L. Viral infection of rabbits. Proc IX World Rabbit Congress. Verona, Italy. 2008:993-998. 25. Martella V, Ciarlet M, Lavazza A, Camarda A, Lorusso E, Terio V. et al. Lapine rotaviruses of the genotype P[22] are widespread in Italian rabbitries. Vet Microbiol 2005;111(1-2):117-124. 26. Licois D. Domestic rabbit enteropathies. Proc. VIII World Rabbit Congress. Puebla, Mexico. 2004:385-403.

520

Rev Mex Cienc Pecu 2019;10(2):511-521

27. Nieddu D, Grilli G, Gelmetti D, Gallazzi D, Toccacieli S, Lavazza A. Electron microscopy detection of viral agents in rabbits with enteropathy during the period 1982-1999 in Italy. Proc VII World Rabbit Congress. Valencia, Spain. 2000:4-7. 28. Xie X, Bil J, Shantz E, Hammermueller J, Nagy E, Turner PV. Prevalence of lapine rotavirus, astrovirus, and hepatitis E virus in Canadian domestic rabbit populations. Vet Microbiol 2017;208:146-149. 29. Cerioli M, Cordioli P, Palotta C, Lavazza A. Survey on enteric viruses identified in diarrhoeic rabbits. Proc Cost 848: Workshop pathology and nutrition. Cercedilla, Spain. 2004:26. 30.

FAO. Food and Agriculture Organization of the United Nations. FAOSTAT. http://www.fao.org/home/en/ Consultado 28 Sep, 2017.

31. De-Leener K, Rahman M, Matthijnssens J, Van-Hoovels L, Goegebuer T, van-derDonck I, et al. Human infection with a P[14], G3 lapine rotavirus. Virology 2004;325(1):11-17. 32. Matthijnssens J, Rahman M, Martella V, Xuelei Y, De-Vos S, De-Leener K, et al. Full genomic analysis of human rotavirus strain B4106 and lapine rotavirus strain 30/96 provides evidence for interspecies transmission. J Virol 2006;80(8):3801-10. 33. Bonica MB, Zeller M, Van-Ranst M, Matthijnssens J, Heylen E. Complete genome analysis of a rabbit rotavirus causing gastroenteritis in a human infant. Viruses 2015;7(2):844-856.

521

Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 10 Núm. 2, pp. 267-521, ABRIL-JUNIO-2019

ISSN: 2448-6698

Fermentación ruminal y producción de metano usando la técnica de gas in vitro en forrajes de un sistema silvopastoril de ovinos de Chiapas, México

Evaluation of nutritional methods to reactivate preserved ruminal inoculum assessed through in vitro fermentation kinetics and forage digestibility

Productive and economic response to partial replacement of cracked maize ears with ground maize or molasses in supplements for dual-purpose cows

Rendimiento de alfalfa (Medicago sativa L.) a diferentes edades de la pradera y frecuencias de defoliación

Propiedades tecnológicas y fisicoquímicas de la leche y características fisicoquímicas del queso Oaxaca tradicional

Evaluación de las condiciones de bienestar animal de camélidos sudamericanos ingresados al camal municipal de Huancavelica, Perú

REVISION DE LITERATURA Ácidos hidroxicinámicos en producción animal: farmacocinética, farmacodinamia y sus efectos como promotor de crecimiento. Revisión

Hydroxycinnamic acids in animal production: pharmacokinetics, pharmacodynamics and growth promoting effects. Review Edgar Fernando Peña-Torres, Humberto González-Ríos, Leonel Avendaño-Reyes, Nidia Vanessa Valenzuela-Grijalva, Araceli Pinelli-Saavedra, Adriana Muhlia-Almazán, Etna Aida Peña-Ramos..............................................................................................................................................................................................................391

Efecto de la radiación ultravioleta (UV) en animales domésticos. Revisión

Estrés oxidativo y el uso de antioxidantes en la producción in vitro de embriones mamíferos. Revisión

NOTAS DE INVESTIGACIÓN DL-malic acid supplementation improves the carcass characteristics of finishing Pelibuey lambs

La suplementación con DL-ácido málico mejora las características de la canal de borregos Pelibuey en finalización José Lenin Loya-Olguín, Fidel Ávila Ramos, Sergio Mar�nez González, Iván Adrián García Galicia, Alma Delia Alarcón Rojo, Francisco Escalera Valente ..........................................460

Prediction of carcass characteristics of discarded Pelibuey ewes by ultrasound measurements

Estudio de asociación genómica para resistencia a Cooperia punctata en bovinos cruzados en el trópico subhúmedo de México

Similarity in plant species consumed by goat flocks in the tropical dry forest of the Cañada, Oaxaca

Evidencia serológica de infección por herpesvirus caprino tipo 1 en cabras en México

Análisis de la presencia de Rotavirus en conejos del Estado de México

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 10 Núm. 2, pp. 267-521, ABRIL-JUNIO-2019

Rev. Mex. Cienc. Pecu. Vol. 10 Núm. 2, pp. 267-521, ABRIL-JUNIO-2019