Technical note
Vol. 17(1) | 2026 | e1716961
Revista Mexicana de Ciencias Pecuarias
Technical note

Molina Puentes, Luis Fernandoa

Molina Barrios, Ramón Miguela*

Hernández Chávez, Juan Franciscoa

Cedillo Cobián, Jesús Raymundoa

Rentería Mexía, Ana Maríaa

González Peraza, Fernandob

Fragoso Salazar, Alejandroa

a Instituto Tecnológico de Sonora. Departamento de Ciencias Agronómicas y Veterinarias. Antonio Caso S/N. Cd. Obregón, Sonora. México.

b Diagnósticos Integrales en Patología Animal A.C. México.

rammol1962@gmail.com

Abstract

The objective was to determine the occurrence of Mycoplasma gallisepticum (Mg) and Mycoplasma synoviae (Ms) in commercial laying hen farms of small producers in the southern region of Sonora from October to November 2022, through the polymerase chain reaction test and the rapid serum agglutination test. A total of 300 blood samples and 300 tracheal swabs were collected from 10 flocks of laying hens. Blood samples were analyzed using the rapid serum agglutination test, whereas tracheal swabs were analyzed by polymerase chain reaction (PCR) through molecular amplification of the Mgc2 and vlhA genes for detecting Mg and Ms, respectively. A total of 285 (95.0 %) and 215 (71.6 %) samples were positive for Mg and Ms, respectively, by PCR, and the results of the rapid serum agglutination test demonstrated that a total of 166 (56.4 %) and 133 (44.3 %) samples were positive for Mg and Ms, respectively. In the distribution of positivity by flock, PCR showed that 100 % were positive for Mg and 80 % for Ms; likewise, through the rapid serum agglutination test, 100 % of the flocks were positive for Mg and Ms. This information, in laying hen farms in the Sonora region, will allow technicians, veterinarians, zootechnicians, and those in charge of livestock units to take corrective actions for their treatment and preventive actions to avoid their dispersion.

Keywords: Mycoplasma gallisepticum; Mycoplasma synoviae; Laying hens; PCR

Received: September 01, 2025

Accepted: January 10, 2026

Published: March 06, 2026

Avian mycoplasmosis is caused by some pathogenic mycoplasmas, of which Mycoplasma gallisepticum (Mg) and Mycoplasma synoviae (Ms) are the most important due to the enormous economic losses resulting in millions of dollars in annual losses due to decreased egg production, reduced hatching, and reduced feed efficiency1. Mycoplasmosis is mainly transmitted horizontally, through direct or indirect contact with infected poultry, or vertically, through the eggs of infected breeding poultry2,3.

M. gallisepticum is considered the most impactful mycoplasma in the poultry industry, with a worldwide distribution that produces respiratory and reproductive signs that decrease weight gain, reduce feed conversion, and decrease egg quantity and quality1. M. synoviae most often occurs as a subclinical infection of the upper respiratory tract, associated with decreased egg production and quality; when the infection is clinically apparent, the primary lesion of an Ms infection is tenosynovitis4.

Mycoplasma diagnosis is made by plate agglutination assay, direct enzyme-linked immunosorbent assay (ELISA), and molecular assays, such as the polymerase chain reaction (PCR) test5,6. Nevertheless, the isolation of these pathogens is considered the standard test for diagnosing microorganisms, this technique is difficult and time-consuming for avian mycoplasmas, as they require special growth conditions and are very time-consuming4.

Molecular tests are diagnostic alternatives for detecting and analyzing mycoplasma DNA, with high sensitivity, specificity, and rapid response, which has enabled the development of control and eradication programs3. An additional advantage of PCR is the ability to differentiate between standard strains of Mg, the F strain associated with the vaccine for Mg and Ms7, unlike serological methods, which present the possibility of non-specific results due to cross-reaction of Mg and Ms or the inability to differentiate the immune response between field infection and vaccination response8.

Studies on the detection, incidence, and prevalence of Mg in poultry have been carried out in several countries; 6.43 % of positive results for Mg have been detected in laying poultry and in broilers in India9, 27.27 % of positive results in flocks of backyard poultry in Italy10, 85.9 % in Iraq11, and 46.56 % in poultry in Pakistan5.

In Mexico, few reports on avian mycoplasmosis have been published; only one study on the presence of Mg in the state of Sonora was published in 196512. In another study on the seroprevalence of Mg and Ms in fighting poultry in the Toluca Valley, the frequency of antibodies for Mg and Ms was 78 % and 91 %, respectively13. In the regions of Aguascalientes, Chiapas, State of Mexico, Jalisco, Querétaro, Veracruz, and Puebla, isolations and antimicrobial sensitivity tests of Mg and Ms were performed, with 23.14 % isolation of Mycoplasma spp. (84.25 % Ms and 15.75 % Mg)14. In the state of Sonora, only one publication in 1965 demonstrated positive serology for Mycoplasma gallisepticum in fighting poultry, so there is no recent published information on the situation of avian mycoplasmosis in southern Sonora. Therefore, this study aimed to determine the molecular and serological occurrence of these two mycoplasmas in farms in southern Sonora, specifically, in farms of small producers participating in the Program for the Economic Strengthening of Indigenous Peoples and Communities.

The study on the identification of M. gallisepticum and M. synoviae by PCR was carried out in 10 flocks located in commercial laying poultry farms in the southern region of Sonora, Mexico (27.4828° N, 109.9304° W).

This study, with a cross-sectional, descriptive, and observational design, was conducted from October to November 2022. Sampling was carried out on 30 hens from 10 commercially laying flocks, with no history of vaccination or prophylactic treatments against mycoplasmosis, and with ages ranging from 40 to 70 weeks. In total, 300 blood samples were collected from the venous sinus of the foramen magnum, approximately 2 ml each, and deposited in Vacutainer tubes without anticoagulant; likewise, 300 tracheal swab samples were obtained, immediately immersed in 1 ml of saline solution, and kept refrigerated at 4 °C until processing1,15.

Blood samples were centrifuged at 5,500 rpm for 7 min to extract serum from Vacutainer tubes and deposited in 1.5 mL vials (Eppendorf). The sera were stored at -20 °C until later use. Tracheal swabs were processed by vortexing (Vortex Genie 2, Scientific Industries) the samples for 5 min, then 200 μL of the saline solution was removed, and the swabs were deposited in 1.5 mL Eppendorf tubes; then, pools of 5 samples were formed and transferred for DNA extraction. The remaining tracheal swab samples were kept at 4 °C.

The standardization of the primers to be used for polymerase chain reaction was carried out with a positive control of M. gallisepticum, strain A5969 (Charles River SPAFAS Inc.), and a positive control of M. synoviae, strain WVU1853 (Charles River SPAFAS Inc.), at hemagglutination inhibition (HI) titers of 1:1024, 1:2048, and 1:4096. Standardization was performed with an annealing temperature gradient of 58 °C and 62.2 °C for M. gallisepticum, and 48 °C, 48.8 °C, 50 °C, 52 °C, 52.5 °C, and 55 °C for M. synoviae, in a Bio-Rad C1000 Touch Thermal Cycler, to determine the appropriate temperature. The electrophoresis protocol was standardized on a horizontal device (ENDURO, Labnet International, Inc.), applying a voltage of 120 to 200 V to the gel for 11 to 30 min. DNA extraction was performed with an extraction kit (taco™ Nucleic Acid Automatic Extraction System). The supernatant with DNA was collected in 1.5 ml Eppendorf tubes and stored at -20 °C.

Polymerase chain reaction was performed with the primers Mgc2 2F (CGCAATTTGGTCCTAATCCCCAACA) and Mgc2 2R (TAAACCCACCTCCAGCTTTATTTCC) to amplify the Mgc2 gene of M. gallisepticum. The PCR protocol8,16 was performed by starting with the initial denaturation at 94 °C for 3 min, followed by 35 denaturation cycles at 94 °C for 30 sec, annealing at 58 °C for 30 sec and extension at 72 °C for 60 sec, ending with an extension at 72 °C for 10 min and preservation of the amplicons at 4 °C in the thermal cycler and -20 °C in freezing. Amplification reactions were performed with a total volume of 25 μL, with 12.5 μL of Taq Master Mix (Qiagen Taq PCR Master Mix Kit, 1000 U), 2.5 μL of the Mgc2 2F primer, 2.5 μL of the Mgc2 2R primer, 5 μL of DNA, and 2.5 μL of RNAse-free water.

The primers vlhA F (TACTATTAGCAGCTAGTGC) and vlhA R (AGTAACCGATCCGCTTAAT) were used to locate the vlhA gene of M. synoviae and to amplify DNA. The PCR protocol was performed by starting with the initial denaturation at 94 °C for 3 min, followed by 35 denaturation cycles at 94 °C for 30 sec, annealing at 48.8 °C for 30 sec and extension at 72 °C for 60 sec, ending with an extension at 72 °C for 10 min and preservation of the amplicons at 4 °C in the thermal cycler and -20 °C in freezing. Amplification reactions were performed with a total volume of 25 μL, containing 12.5 μL of Taq Mix, 2.5 μL of the vlhA F primer, 2.5 μL of the vlhA R primer, 5 μL of DNA, and 2.5 μL of RNAse-free water. Reactions were performed with 2.5 U of DNA polymerase, 1.5 mM of MgCl2, 200 μM of dNTPs, 10 μM of F primer and 10 μM of R primer, and 1.0 μg of DNA.

Electrophoresis was performed on agarose gel at a concentration of 1.5 %. In short, 0.75 grams of agarose was mixed in 50 ml of 1x Tris-Acetate-EDTA (TAE) buffer. It was heated in the microwave oven for 35 sec until a melted solution was obtained, and 4 μL of ethidium bromide was added. A volume of 1 μL of bromophenol blue with 4 μL of DNA was used as a loading buffer. A 130 V voltage was applied for 30 min at 300 amperes. Its subsequent reading was performed to visualize the bands of the amplified product.

Plate agglutination was performed with Mg and Ms antigens (Charles River SPAFAS Inc.). The components used were worked at room temperature. The process began with the homogenization of the antigen using a vortex (Vortex Genie 2, Scientific Industries) for 15 sec. Subsequently, 20 μL of the antigen was mixed with 20 μL of serum on the glass plate. The mixture was homogenized for 2 min, rotating the glass plate. Agglutination reactions were read by direct visualization under a stereo microscope (Leica EZ4, Leica Microsystems).

The PCR protocol was standardized by the analysis of relevant genetic sequences in CLC Sequence Viewer 8 of Mc strains (F, R High, R Low, F99 Lab, F99 Avipro_Vaccine, F 6_85) and Ms strains (WVU1853, 86079-7NS, NCTC10124, 5-9, MS-H, 53, 18DW) in conjunction with the sequences of the Mgc2 and vlhA primers; it was identified that the primers complement each other precisely with the region of interest of the DNA.

In this study, 300 tracheal swabs and 294 sera were analyzed by PCR and plate agglutination (PA), respectively. To determine the frequency of positivity in commercial laying poultry farms, the Mgc2 and vlhA genes were molecularly amplified to detect Mg and Ms, respectively. The interpretation of the PCR results was performed by visualizing the amplified fragments of M. gallisepticum (Mgc2) (Figure 1) and M. synoviae (vlhA) (Figure 2) by 1.5 % agarose gel electrophoresis.

Figure 1. Agarose gel electrophoresis (1.5 %) showing results of Mycoplasma gallisepticum (Mgc2) amplification at 300 bp
M= DNA molecular weight marker of 1 kbp.
Lanes 1, 3, 4, 5, 6= Mg-positive samples; Lane 2= Mg-negative sample; Lane (-)= negative control; Lane (+)= positive control.

Figure 2. Agarose gel electrophoresis (1.5 %) showing results of Mycoplasma synoviae (vlhA) amplification at 398 bp
M= DNA molecular weight marker of 1 kbp.
Lanes 1, 2, 3, 4, 5, 6= Ms-positive samples; Lane (-): negative control; Lane (+): positive control.

Of the 300 tracheal swabs, there were 285 (95.0 %) and 215 (71.6 %) positive samples for Mycoplasma gallisepticum and Mycoplasma synoviae, respectively (Table 1).

Table 1. Frequency of positivity of Mycoplasma gallisepticum and Mycoplasma synoviae by PCR, using primers for the Mgc2 and vlhA genes, respectively
Mycoplasma gallisepticum Mycoplasma synoviae
Flock No. of samples Positive Percentage Positive Percentage
1 30 25 83.3 25 83.3
2 30 25 83.3 25 83.3
3 30 30 100.0 15 50.0
4 30 30 100.0 30 100.0
5 30 30 100.0 0 0.0
6 30 30 100.0 30 100.0
7 30 30 100.0 30 100.0
8 30 30 100.0 30 100.0
9 30 30 100.0 30 100.0
10 30 25 83.30 0 0.0
Total 300 285 95.00 215 71.66

Additionally, PA was used to detect antibodies against Mg and Ms in serum, and it was interpreted by visualizing the samples agglutinated with M. gallisepticum and M. synoviae antigens. Results from the serum agglutination rapid test showed that 166 (56.45 %) and 133 (44.33 %) samples were positive for Mycoplasma gallisepticum and Mycoplasma synoviae, respectively (Table 2).

Table 2. Frequency of positivity of Mycoplasma gallisepticum and Mycoplasma synoviae by rapid serum agglutination test
  Mycoplasma gallisepticum Mycoplasma synoviae
Flock No. of samples Positive Percentage Positive Percentage
1 30 11 36.6 18 60.0
2 30 13 43.3 13 43.3
3 30 14 46.6 24 80.0
4 29 9 31.0 10 34.4
5 30 12 40.0 12 40.0
6 30 24 80.0 15 50.0
7 30 27 90.0 17 56.6
8 29 23 79.3 13 44.8
9 27 25 92.5 6 22.2
10 29 8 27.5 5 17.2
Total 294 166 56.4 133 43.5

Mg and Ms are considered the most important pathogenic mycoplasmas in the poultry industry globally. The impact of these infections is characterized by respiratory problems, causing a syndrome identified as chronic respiratory disease (CRD) in laying poultry, broilers, and breeding flocks; this infection also affects the production of eggs for consumption and reduces hatchability. It also negatively affects the effectiveness of immunization programs against viral diseases and exaggerates responses to viral infections and secondary bacterial complications4,18. Similarly, the presence of Mg and Ms represents a risk to animal welfare and a negative economic impact on the poultry industry5,17.

Regarding the percentage of positivity by the PCR test, the present study reports 95.0 % positivity for Mg, high results, such as those previously reported in Iraq, where up to 85 % positivity was reported, attributed to the stage of infection, the technique used in sampling, climatic differences, and the level of biosecurity11. Likewise, it aligns with the results reported in Egypt, with an 85 % positivity rate18.

On the other hand, there are reports with low positivity percentages, such as 36.7 %19. In India, there are reports of positivity for Mg (6.43 %), Ms (23.6 %), and co-infection of Mg and Ms (15.49 %)9. In Haryana, positivity rates of 11.6 % for Mg and 33.0 % for Ms have been reported in 26 breeding flocks20. In Pakistan, a high prevalence of Mg (38.18 %) and Ms (18.48 %) was reported in winter21.

It is important to note that the poultry included in this study did not present clinically apparent diseases; however, during the nocturnal examination of the flocks, tracheal sounds suggestive of tracheitis were detected, signs associated with Mycoplasma spp. infections in some reports7,10,18.

Regarding M. synoviae, the period of farm establishment, the age of the poultry, and the distribution of flocks of various ages within a poultry production site are other factors attributed to its presence. In Portugal, a higher prevalence (77.3 %) was found in farms less than 3 yr old than in those older than 3 yr old (35.7 %), and a higher prevalence in production sites on farms with a variety of ages (66.7 %) compared to development (8.3 %)22. This suggests that Ms infection may be better established in production sites where poultry have immunocompromised immune systems due to stressors, such as intensive production. The concentration of poultry farms in the region and the population density within them, together with the lack of biosecurity or health barriers23.

The seroprevalence in this study shows a percentage of Mg positivity (56.4 %) by PA, which is consistent with what was previously reported, with 58.0 % seroprevalence in Mg attributed to variations in maintenance practices, treatments, and deficiencies in biosecurity24; likewise, it aligns with those reported in a study in Algeria, with a percentage of positives of 69.9 %25. On the other hand, the present study differs from others that report 100 % seroprevalence for Mg18,19, considering that the PA test is a reliable and efficient test for detecting Mg.

In Mexico, only three studies on avian mycoplasmosis have been published; one study found a seroprevalence of Mg (78 %) and Ms (91 %) in fighting poultry from the National Federation of Gamecock Breeders in the Toluca Valley13; a report on isolation and antimicrobial susceptibility of Mg and Ms in the regions of Aguascalientes, Chiapas, State of Mexico, Jalisco, Querétaro, Veracruz, and Puebla, which reported an isolation of Mycoplasma spp. (23.1 %), of which it is distributed between Ms (84.2 %) and Mg (15.7 %)14. The only study conducted in 1965, which used samples from the state of Sonora, characterized strains of Mycoplasma spp. of avian origin, reporting seven different strains in the state of Sonora, along with six in the state of Jalisco and two in la Ciudad de México12. The lack of updated information on the presence of Mg and Ms in Mexico should be considered a factor in the lack of monitoring, control, diagnosis, and treatment measures.

In the present research, it is concluded that avian mycoplasmosis in the state of Sonora is a problem that must be addressed through a comprehensive control program that includes the implementation of strict biosecurity measures, disinfection, all-in-all-out management, and, due to the high percentage of seropositivity, the implementation of an immunization program with bacterins.

The positivity percentages were 95.0 % for Mg and 71.6 % for Ms by molecular tests (PCR), and 56.4 % for Mg and 44.3 % for Ms by the rapid plate agglutination test. It is important to note that all 10 tests were positive for the presence of antibodies against both mycoplasmas. The integration of PCR analyses for Mg and Ms, together with PA, enabled to obtain a comprehensive and robust perspective on the presence of these mycoplasmas in the region of Sonora. The lack of information on the status of these mycoplasma infections in this region causes enzootic distribution and poor care. These findings not only contribute to understanding the current poultry health situation in the region but also offer information for implementing effective control, monitoring, and management strategies that improve biosecurity and productivity in the poultry industry of southern Sonora.

Funding:

This work was funded by the Technological Institute of Sonora through the PROFAPI (PROFAPI 2025-0568)

Conflicts of interest:

The authors declare that they have no conflicts of interest in the development of this work.

License:

This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License (CC BY-NC-SA 4.0).

Literature cited:

1. Kursa O, Tomczyk G, Sieczkowska A, Kostka S, Sawicka-Durkalec A. Mycoplasma gallisepticum and Mycoplasma synoviae in turkeys in Poland. Pathogens 2024;13(1):78.

2. Demirbilek SK, Ardicli Ö, Carli KT. Comparison of Mycoplasma gallisepticum infection in different samples and ages of chicken breeder flocks. Braz J Poult Sci 2020;22(2).

3. Zikibayeva KB, Svanbayev AA, Akhmetsadykov NN, Kudaibergenova KN, Akhmetsadykova SN, Nurolda EN, Kydyrmanov AI. Epidemiological investigation of poultry infectious in Kazakhstan (2021-2024). Front Vet Sci 2025;11:1520606.

4. Galluzzo P, Migliore S, Galuppo L, Condorelli L, Hussein HA, Licitra F, et al.. First molecular survey to detect Mycoplasma gallisepticum and Mycoplasma synoviae in poultry farms in a strategic production district of Sicily (South-Italy). Animals 2022;12:962.

5. Abbas N, Suleman M, Khan NA, Ali I, Rauf M, Rahman S. Prevalence of Mycoplasma gallisepticum in poultry and wild life birds suspected of chronic respiratory disease in northern Pakistan. Pak J Zool 2018;50(3):1071-1077.

6. Tipu JH, Miah R, Islam O, Rahman MM, Talukdar L, Miah R, Hussain MS, et al.. Molecular and seroprevalence of Mycoplasma gallisepticum in turkeys in Sylhet District of Bangladesh. Vet Med Sci 2025;11(2).

7. Manimaran K, Mishra A, Hemalatha S, Karthik K, Ganesan PI. Detection of Mycoplasma gallisepticum infection in chickens from Tamil Nadu State of India. Indian J Anim Res 2019;53(1):115-118.

8. Rauf M, Chaudhary ZI, Younus M, Anjum AA, Ali MA, Ahmad AN, Khan MUR. Identification of Mycoplasma gallisepticum by polymerase chain reaction and conventional diagnostics from white leghorn layer flocks. J Anim Plant Sci 2013;23(2):393-397.

9. Giram P, Bhutada P, Prajapati C, Koratkar SS, Patil S, Hooda D, et al.. Percent positivity and phylogenetic analysis of Mycoplasma gallisepticum and Mycoplasma synoviae in commercial poultry from the different States of India. Vet World 2022;15(7):1843-1851.

10. Felice V, Lupini C, Mescolini G, Silveira F, Guerrini A, Catelli E, et al.. Molecular detection and characterization of Mycoplasma gallisepticum and Mycoplasma synoviae strains in backyard poultry in Italy. Poult Sci 2020;99(2):719-724.

11. Mahmmoud EN, Hamad MA, Khudhur ZN. Detection of Mycoplasma gallisepticum in broiler chickens by PCR. Open Vet 2022;12(3):329-334.

12. Solana-Martagón P. Caracterización de cepas de Mycoplasma de origen aviario aisladas en México. Tec Pecu Mex 1965;5(1):15-20.

13. Rojas M, Vera V, Rosas F, Horacio A, Romero P, Soriano E, et al.. Seroprevalence of Mycoplasma gallisepticum and Mycoplasma synoviae in Cockfight chickens from Central México Highlands. Rev Fac Cienc Vet 2012;2:135-138.

14. García V, Tellez G, Hurtado F, Vuong C, Lopez R. Isolation and antimicrobial sensitivity of Mycoplasma synoviae and Mycoplasma gallisepticum from vaccinated hens in Mexico. Pathogens 2020;9(11):924.

15. Michiels T, Welby S, Vanrobaeys M, Quinet C, Rouffaer L, Lens L, et al.. Prevalence of Mycoplasma gallisepticum and Mycoplasma synoviae in commercial poultry, racing pigeons and wild birds in Belgium. Avian Path 2016;45(2):244-252.

16. Garcia M, Ikuta N, Levisohn S, Kleven SH. Evaluation and comparison of various PCR methods for detection of Mycoplasma gallisepticum infection in chickens. Avian Dis 2005;49(1):125-132.

17. Emam M, Hashem Y, El-Hariri M, El-Jakee J. Detection and antibiotic resistance of Mycoplasma gallisepticum and Mycoplasma synoviae among chicken flocks in Egypt. Vet World 2020;13(7):1410-1416.

18. Marouf S, Khalf M, Alorabi M, El-Shehawi A, El-Tahan A, El-Hack M, et al.. Mycoplasma gallisepticum: a devastating organism for the poultry industry in Egypt. Poult Sci 2022;01(3):101658.

19. Evans J, Thornton D, Branton S. Diagnosis of Mycoplasma gallisepticum from a Broiler Breeder Flock: Comparison of three diagnostics methods. Int J Poult Sci 2009;8:104-107.

20. Rajkumar S, Reddy MR, Somvanshi R. Molecular prevalence and seroprevalence of Mycoplasma gallisepticum and M. synoviae in Indian poultry flocks. J Anim Res 2018;8(1):15-19.

21. Rehman A, Shah A, Rahman S. Seroprevalence of Mycoplasma gallisepticum and Mycoplasma synoviae in commercial broilers and backyard poultry in five districts of Khyber Pakhtunkhwa-Pakistan. Pak Vet J 2018;38(2):149-152.

22. Moreira FA, Cardoso L, Coelho AC. Epidemiological survey on Mycoplasma synoviae infection in Portuguese broiler breeder flocks. Vet Ital 2015;51(2):93-98.

23. Moreira F, Cardoso L, Coelho A. Mycoplasma synoviae and Reovirus: (re)emerging infectious diseases in broiler breeders. J Hell Vet Med Soc 2017;68(2):113-122.

24. Barua S, Prodhan A, Islam S, Chowdhury S. Study on Mycoplasma gallisepticum in chickens in selected areas of Bangladesh. BJVM 2006;4(2):142-142.

25. Heleili N, Ammar A, Bakir M, Chelihi A. Seroprevalence of Mycoplasma synoviae and Mycoplasma gallisepticum at Batna commercial poultry farms in Algeria. Vet World 2012;5:709-712.