Introduction
The Los Llanos region of Durango, Mexico, is important in the production of beans (Phaseolus vulgaris), an essential crop for the local economy and food security1. This agro-industrial waste is widely used as a source of livestock feed; however, its high content of cell wall components (cellulose, hemicellulose, and lignin) and low crude protein content limit its utilization, thereby justifying the exploration of the native microbiota as an alternative to improve its nutritional value2. The sustainability of these agricultural systems is threatened by dependence on chemical inputs for pest and disease management, which contributes to environmental deterioration and limits producers’ resilience to the challenges of climate change and market variability. Consequently, more sustainable, innovative agricultural models adapted to local conditions are required.
In this context, the Organization for Economic Co-operation and Development (OECD) recommends reorienting agricultural policies towards practices that benefit the environment and promote the sustainable use of natural resources, where the use of native biodiversity stands out as a strategic path3. The isolation and study of native microorganisms, such as fungi associated with bean straw, represent a possible alternative for developing bio inputs and producing enzymes with biotechnological applications.
The discovery and bioprospecting of fungi in agroecosystems underscore the importance of conserving local biodiversity, as these organisms can be a source of metabolites and enzymes of high value for agriculture, industry, and health. Integrating these scientific advances into regional production chains can strengthen competitiveness, generate new economic opportunities, and promote social inclusion, in line with the principles of sustainability, innovation, and equity promoted by the OECD.
The objective of this research was to isolate, identify, and evaluate the bioprospecting of native fungi from bean (Phaseolus vulgaris) straw with an emphasis on their potential to produce enzymes of biotechnological interest. This approach seeks to contribute to the development of more sustainable and resilient agricultural practices in Durango and promote biodiversity conservation and regional development, aligning international recommendations for the agri-food sector.
Material and methods
Obtaining raw materials
Pinto saltillo bean straw was collected in the Santa Catalina de Siena property (Latitude: 24.58º, Longitude: -104.09º). In Guadalupe Victoria, Durango, Mexico, from the autumn to the winter of 2023.
Fungal isolation
Thirty (30) grams of ground bean straw (particle size of 8 mm) were used. Each sample was placed in a 100 mL flask with a moisture content of 65 % and incubated at room temperature in darkness for 10 d. Subsequently, a fraction of the straw containing at least one colony was taken and inoculated with Potato Dextrose Agar (PDA) with 1 % ampicillin as an antibiotic. The plates were incubated at 28 °C for 72 h. Periodic reseedings were carried out in the same medium until the strains were pure.
Macro- and microscopic morphological identification of fungi
Six strains were subjected to macroscopic and microscopic identification (Figure 1) according to the methodology proposed by Ríos-Ruiz4. A LEICA DM750® optical microscope with a LEICA ICC50HD® camera (Leica Microsystems, Wetzlar, Germany) was used. The macroscopic characteristics evaluated were strain color, shape, contour, texture, type of growth, and growing area, compared to the Royal Botanic Garden Edinburgh (Scotland, United Kingdom)5.
Cellulolytic activity
Cellulolytic activity was determined using the Congo red technique6. From the strains preserved in PDA, a spore solution was obtained at 96 h of growth. Fifty (50) microliters were placed into a 6-mm-diameter hole in the Carboxymethyl cellulose (CMC) medium; they were incubated at 30 °C for 48 h. The medium was stained with 5 mL of 1 % Congo red for 15 min; the excess was removed, and a washing was performed with 5 mL of 2 M NaCl solution for 15 min. Cellulolytic activity was determined by cellulose degradation halos (mm).
Molecular identification
Genomic DNA extraction was performed using InstaGene Matrix (BIO-RAD) and MG Tissue SV (Doctor Protein INC, Korea) commercial kits. The following oligos were employed: ITS5: GGAAGTAAAAGTCGTAACAAGG and ITS4 (TCCTCCGCTTATTGATATGC). PCR amplifications were performed with Axen™️ H Taq PCR Master Mix (2X) (Roche), under the following conditions: 95 °C for 5 min, 35 cycles of 95 °C/30 sec, 52 °C/30 sec, 72 °C/1 min, and final extension of 72 °C for 10 min, in DNA Engine Tetrad 2 Peltier Thermal Cycler (BIO-RAD). The products were purified with a Multiscreen filter plate (Millipore). Sequencing was performed with BigDry Terminator v3.1 and ABI PRISM 3730XL Sequencer (96 capillaries) at the Macrogen Genomic Services Laboratory, Seoul, Republic of Korea. Variant analysis was performed using Varianr Report c2.1 (Applied Biosystems), complemented with DNASTAR Lasergene SeqMan 7.0 and the Macrogen SNP analysis program, v1.0. The sequences were analyzed and compared with other sequences employing BioEdit7, the National Center for Biotechnology Information (NCBI) database using the BLAST8 tool, and MEGA 7®9 software.
Evolutionary history was obtained employing Maximum Likelihood under the two-parameter model of Tamura and Nei9. The tree with the highest logarithmic probability (1933.53) is shown, along with the percentage of taxa clustering on branches. For the heuristic search, initial trees were generated using the Neighbor-Join and BioNJ algorithms, applied to pairwise distance matrices with the Maximum Composite Likelihood (MCL) approach. The topology with the highest logarithmic probability was selected. Variants in evolutionary rates were modeled between sites using a discrete Gamma distribution (five categories; +G, parameter= 0.2211)10. The sequences were deposited in the NCBI GenBank database.
Enzymatic activity assessment
A disc (5 mm in diameter, 24 h incubation) was taken per isolated fungus and seeded onto agar plates with the medium described by Córdova-Albores et al10. For each strain, two plates of each medium were inoculated with different carbon sources. The potency index (PI) was calculated by dividing the diameter of the hydrolysis halo by the mycelial growth diameter2. The determinations were made in triplicate.
Determination of enzymatic activity and potency index
Amylase (EC 3.2.1.1). Carbon source: 20 % starch (Castañeda medium-starch); after incubation for 72 h at 28 °C, the plates were flooded with iodine for 15 min (Sigma-Aldrich Corporation). Activity was detected as a transparent halo.
ATPase (EC 3.6.5). Carbon source: 5 % glucose (Alkeksandrow medium + bromophenol blue). After incubation for 72 h at 28 °C, the plates were flooded with iodine for 15 min (Sigma-Aldrich Corporation). Activity was detected as a transparent halo.
Cellulase (EC. 3.2.1.4). Carbon source: 1 % carboxymethyl cellulose (CMC). Congo red staining after incubation for 4 h at 28 °C. Activity was detected as a yellow halo around the mycelium.
Esterases (EC 3.1.1). Carbon source: 10 % peptone (Tween 80 medium). After incubation for 72 h at 28 °C, activity was detected as a halo with a greasy appearance and iridescent hue.
Phosphatase (EC 3.1.3). Carbon source: 10 % glucose (NBRIP medium + bromophenol blue). After incubation for 72 h at 28 °C, the plates were flooded with iodine for 15 min (Sigma-Aldrich Corporation). Activity was detected as a transparent halo.
Lignin manganese peroxidase (EC 1.11.1.14). Carbon source: 5 % peptone (lignin media (lactase, manganese peroxidase, peroxidase)). After incubation for 96 h at 28 °C, the plates were flooded with iodine for 15 min (Sigma-Aldrich Corporation). Activity was detected as a transparent halo.
Lipase (EC 3.1.1). Carbon source: 10 % peptone (Tween 20 medium). After incubation for 72 h at 28 °C, activity was detected as a halo with a greasy appearance and iridescent hue.
Nitrogenase (EC 1.18.6.1). Carbon source: 10 % glucose (Winogradsky’s nitrogen-free medium: minimal medium (MM) + bromothymol blue). After incubation for 72 h at 28 °C, the plates were flooded with iodine for 15 min (Sigma-Aldrich Corporation). Activity was detected as a transparent halo.
Pectinase (EC 3.2.1.8). Carbon source: 20 % starch (Castañeda medium-pectin). After incubation for 72 h at 28 °C, the plates were flooded with 5 % CTAB (cetyltrimethylammonium bromide) for 20 min. Activity was detected as a transparent halo.
Protease (EC 3.4.21). Carbon source: 10 % tryptone (Luria-Bertani (LB) medium-milk). After incubation for 72 h at 28 °C, activity was detected as a brown halo.
Siderophores/Chitinase (EC 3.2.1.15). Carbon source: 20 % starch (chrome azurol (CAS) medium. After incubation for 72 h at 28 °C, activity was detected as a yellow halo.
Tryptophanase (EC 4.1.99.2). Carbon source: 30 % glucose, (potato dextrose agar (PDA) + tryptophan). After incubation for 96 h at 28 °C, the plates were flooded with Saukowski solution for 30 min in complete darkness. Activity was detected as a brown halo11,12.
Statistical analysis
PI (potency index) values and enzyme activities were analyzed by one-factor analysis of variance (ANOVA) and Tukey’s test for mean comparison, using Minitab, LLC® (2019).
Results
Isolation
Six strains of filamentous fungi were obtained: two Aspergillus spp. (RC1 and RC4), three Clonostachys spp. (RC2, RC5, and RC7), and one of the genera Mucor spp. (RC8). Due to its pathogenic nature, the characterization of Mucor was ruled out; likewise, Aspergillus spp. strains were excluded due to their possible pathogenicity. The identification confirmed that the remaining strains belonged to the genus Clonostachys, recognized for its potential as a biological control agent against phytopathogenic fungi in plants through competition for nutrients and space, mycoparasitism, and antibiosis due to the production of secondary metabolites that induce resistance in plants. These mechanisms enable Clonostachys to control pathogenic fungal populations and protect plants from significant damage. The isolation and characterization of Clonostachys strains is emerging as a feasible alternative for developing sustainable and effective biological control strategies for crop and ecosystem protection13.
Cellulolytic activity
Growth rates and cellulose degradation halos were analyzed to compare the performance of different fungal colonies. The statistical analysis revealed significant differences among the fungi in both growth rate and the diameter of degradation halos, confirming functional variability among the strains and facilitating the selection of isolates with the best potential in cellulose degradation.
The potency index is presented in Figure 2, where PI showed significant differences between the strains evaluated (ANOVA, P<0.05). Tukey’s test confirmed greater cellulolytic capacity in the Clonostachys strains compared to Aspergillus. The RC5 strain had the highest value (2.60a), followed by RC2 with (2.05a), both higher than the Aspergillus strains RC1 (1.36b) and RC4 (1.27b). These results position Clonostachys RC5 and RC2 as isolates with better performance in cellulose degradation. The strains of Clonostachys spp. exhibited potential to degrade forage cell walls and control fungi responsible for postharvest deterioration of fruits and vegetables, which contributes to food safety13.
Enzymatic activity and Potency index
Figure 3 presents the relevant data from the enzymatic evaluation of the three Clonostachys strains characterized by their ability to produce and secrete. The analysis of enzymatic activity showed significant differences between the evaluated strains (P<0.05). The means ± standard deviation reflected controlled variability; for its part, Tukey’s test distinguished the performance of each isolate. The RC5 and RC7 strains exhibited the highest activities in most hydrolytic and oxidative enzymes; by contrast, the RC2 strain stood out in phosphatase and pectinase. No differences in protease activity were observed. Overall, there is evidence of functional diversity that positions RC5 and RC7 are isolated as the strains with the greatest biotechnological potential under the conditions evaluated. These results provide valuable information for optimizing and developing new biotechnological applications.
The analysis of the enzymatic activity of the native strains of Clonostachys spp. (RC2, RC5, and RC7) through the statistical evaluation using one-way ANOVA showed significant differences (P<0.05) in several of the enzymes analyzed.
For amylase activity, RC5 showed the highest production, exceeding RC2, whereas RC7 presented an intermediate value. In cellulase, RC5 was the most outstanding, surpassing RC2 and RC7. In phosphatase, RC2 had the highest activity. In oxidative enzymes, RC7 presented the highest values in lignin manganese peroxidase, followed by RC5 and RC2; lipase activity maintained the same pattern. In pectinase, RC7 showed the lowest activity; RC2 and RC5 did not differ from each other. In protease, there were no significant differences. In siderophores/chitinase, RC7 was the most active, outperforming RC2 and RC5. In tryptophanase, RC7 presented the highest production, followed by RC5 and RC2; all statistically different.
These results highlight functional variability among native strains of Clonostachys spp., with potential for biotechnological applications oriented to agriculture and industry. In particular, RC7 exhibited an outstanding enzyme profile in key activities, such as lignin manganese peroxidase, lipase, siderophore-chitinase, and tryptophanase, positioning it as an ideal candidate for future bioinput developments. The observed functional diversity reinforces the relevance of microbial bioprospecting in agroecosystems, in line with the OECD recommendations for the sustainable use of biodiversity and innovation in strategic sectors such as agriculture.
Molecular identification and phylogeny
Molecular analysis identified three strains of the genus Clonostachys from bean (Phaseolus vulgaris) straw. The sequences showed adequate similarity and coverage values. In phylogeny, the three strains formed a well-defined clade, supporting their separation from other species of the genus (Figure 4), where the strains show a close relationship with Clonostachys kunmingensis. This grouping suggests the presence of lineages not previously recorded in the material evaluated. The data generated constitutes a solid reference on the diversity of Clonostachys associated with bean straw under the conditions of the present study.
Discussion
The isolation and characterization of fungi of the genus Clonostachys from bean straw contribute to the ecological understanding of these fungi and open new avenues for the development of biological methods for controlling phytopathogens, as has been reported for Clonostachys rosea in biological control and bioremediation11. It has been reported that Clonostachys rosea inhibits the growth of phytopathogenic fungi Fusarium oxysporum and Botrytis cinerea14. Clonostachys species occupy diverse habitats, showing their adaptability to different environmental conditions. The absence of reports on their isolation in bean straw suggests a new ecological niche that has been explored little; other authors have isolated the genus from other substrates, such as soil, dead leaves, and wood12-17, underlining the importance of the edaphic environment and plant detritus for their development.
All three strains were identified at the genus level. The region used (ribosomal RNA complex 18S, 5.8S, and 28S) is the most used for identifying fungal DNA. Phylogenetic analyses with ITS suggest the probable existence of new species; nevertheless, given the morphological complexity of the genus Clonostachys, it is advisable to complement them with RPB2, LSU, TEF2, and TUB2 genes to specify the taxonomy delimitation.
In this study, analysis of ITS gene sequences enabled precise genus-level identification. The biotechnological potential of nine extracellular enzymes synthesized by fungi isolated from bean straw was evaluated. The experimental design was rigorously applied; the potency index and enzyme activities were analyzed using one-factor ANOVA and Tukey’s test, employing Minitab, LLC® (2019). The assumptions of normality, homogeneity of variances, and independence were verified. In the genus Clonostachys, the ability to produce amylase, cellulase, phosphatase, lignin manganese peroxidase, lipase, pectinase, protease, siderophores/chitinase, and tryptophanase was observed; the variability between strains coincides with that reported by Figueroa-Ceballos et al18 on the production of amylases among anamorphic fungi isolated from leaf litter; similarly, the contrasts observed in this study reflect the distinctive metabolic potential of each isolate and confirm the importance of exploring native microorganisms as a source of enzymes of biotechnological interest18. Amylases have multiple applications in the food industry (beers and bread). Their ability to degrade starches makes them useful in cleaning formulations for detergent production and facilitates the conversion of biomass into fermentable sugars for bioethanol production. Clonostachys spp. produces different types of cellulase (endo, exo, and cellobioses) that act together to break down cellulose into simple sugars, necessary in the bioconversion of biomass, improvement of food processes, and treatment of agro-industrial waste, and, in relation to what has been reported, these fungi have great potential for application, as mentioned by Gutiérrez et al19.
Phosphatases in Clonostachys (e.g., RC7) facilitate phosphate availability and are related to crop propagation. These enzymes are essential for the regulation of cell metabolism and signaling, act on substrates that contain phosphate groups, and facilitate availability in the environment; in this case, because it is an isolate from straw, this is consistent with what was reported by Diaz et al20. On the other hand, the lignin manganese peroxidase produced by Clonostachys spp. is crucial for the degradation of lignin, a structural component in plant cell walls. This enzyme catalyzes manganese oxidation using hydrogen peroxide as a cofactor, allowing the breakdown of phenolic compounds in lignin. In the case of lignin manganese peroxidase, it was produced in bean straw by the fungus Clonostachys spp. RC5, which can be attributed to the biochemical conditions of straw to produce phenols21. On the other hand, the RC2 fungus exhibited greater lipase activity, so it can be considered that, for the process of improvement of bean straw, they are effective in the decomposition of lipids, as they catalyze the hydrolysis of triacylglycerols; these enzymes have been reported to improve digestibility and taste in dairy products22. Pectinase is an enzyme that catalyzes the hydrolysis of glycosidic bonds in pectin, a polysaccharide present in the cell wall of plants. This enzyme is essential in various industrial applications, especially in the food industry, where it is used to improve the texture and clarity of juices and other fruit products, as is the case of the RC2 and RC5 strains, which showed the highest production of pectinase, an enzyme responsible for the hydrolysis of the glycosidic bonds of pectin, as mentioned by Haile and Ayele23.
Protease is a fundamental enzyme in various biological processes, including digestion, protein recycling, and the regulation of cellular functions. The siderophore chitinase is an enzyme that catalyzes the hydrolysis of chitin, a structural polysaccharide found in the cell walls of fungi and in the exoskeletons of arthropods. This enzyme is essential for the degradation of chitin, releasing products such as N-acetylglucosamine, which have applications in various industries. Clonostachys spp. has proven to be an effective producer of this enzyme, making it an organism of interest for biotechnology. Clonostachys spp. produces tryptophanase under specific conditions that favor its enzymatic activity. The production of this enzyme can be influenced by factors such as substrate type, pH, and temperature. Tryptophan-rich substrates, such as certain agricultural waste, can be used to optimize tryptophanase production, which not only improves process efficiency but also contributes to sustainability and circular use of agro-industrial waste, such as bean straw.
The evaluation of this biotechnological potential of Clonostachys strains allows to consider their application as agents to produce secondary metabolites and effective biological control, and to have applications in the bioconversion of dry forages. So far, there are no reports of this application for this genus; it has only been evaluated as a biocontrol agent16 and a soil bioremediation agent19. There are studies on bioprospecting native microorganisms in other substrates, such as candelilla2. Nonetheless, the bioprospection of native strains associated with bean straw is a contribution of this study, providing a new application for the genus Clonostachys.
Conclusions and implications
The bioprospection of isolated native strains of bean straw showed advances with regional relevance and global projection. The identification of possible new species of Clonostachys and their ability to inhibit phytopathogens such as Fusarium oxysporum confirms their potential as a biocontrol agent, aligned with principles of responsible innovation and with an impact on food security (SDG 2). The production of extracellular enzymes, including amylases, cellulases, and lignin manganese peroxidase, positions these strains as strategic resources for the circular bioeconomy (SDGs 9 and 12), by transforming agricultural waste into value-added inputs. Their ability to degrade cellulose and lignin expands their applications in soil bioremediation (SDG 15) and reduces dependence on synthetic chemical inputs. In the agricultural field, their implementation could reduce fungicide use and strengthen sustainable production systems. Likewise, valorizing bean straw would mitigate greenhouse gas emissions and generate economic value from waste. It is necessary to have incentives and regulatory frameworks that facilitate the adoption of bio inputs and technology transfer, and to deepen functional characterization.